GENETICA seconda parte

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GENETICA seconda parte"


1 GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una scala a pioli attorcigliata. Il Dna fu scoperto da Wotson e Crick nel I componenti di questa lunga molecola sono: zuccheri acido fosforico basi azotate Le basi azotate sono di quattro tipi: Genetica_2p - prof. Enzo Mardegan - 1

2 Una molecola di acido fosforico, una di zucchero e una base azotata formano il nucleotide. Le basi azotate di un filamento si uniscono con quelle del secondo filamento per formare la doppia elica. L unione fra le basi dei due filamenti avviene in modo preciso. sempre e solo: adenina e timina (A-T) citosina e guanina (C-G) Genetica_2p - prof. Enzo Mardegan - 2

3 Il DNA è quindi una lunga sequenza di nucleotidi. Un pezzo più o meno lungo di questa sequenza si chiama gene. Il gene contiene l istruzione per costruire una proteina, cioè un carattere. Ogni essere vivente ha il proprio DNA, il proprio patrimonio genetico o genoma. Il DNA fa due cose importanti: - trasmette le informazioni ereditarie da una cellula all altra durante la riproduzione cellulare, - forma i vari caratteri dando ordini per costruire precise proteine. Per fare questo il DNA deve: duplicarsi formando copie di se stesso ordinare la costruzione di proteine Il codice genetico è l insieme di regole che dicono al gene come costruire la proteina. Questo codice e fatto da simboli ciascuno dei quali corrisponde a tre basi azotate, dette triplette. Ciascuna tripletta individua un amminoacido. Il codice genetico è uguale per tutti gli esseri viventi. Genetica_2p - prof. Enzo Mardegan - 3

4 La duplicazione del DNA significa fare una copia di se stesso, avviene durante la mitosi. Osserva bene la figura. La sintesi proteica è la fabbricazione delle proteine, avviene nel citoplasma, precisamente nei ribosomi. Le informazioni contenute nei geni devono essere portate ai ribosomi. Questo lavoro viene svolto dall acido ribonucleico o RNA. L RNA assomiglia al DNA ma è formato da un singolo filamento. filamento di RNA Genetica_2p - prof. Enzo Mardegan - 4

5 I nucleotidi dell RNA sono simili a quelli del DNA, la differenza è nello zucchero: ribosio e una base azotata. Le basi azotate dell RNA sono: - citosina, - guanina, - adenina, - uracile (al posto della timina) L RNA si forma partendo dal DNA. Il doppio filamento di DNA si apre e, su uno dei due, viene stampato l RNA Questo RNA si chiama RNA messaggero, mrna. L mrna esce dal nucleo e va nei ribosomi dove viene letto e si procede alla formazione delle proteine. Genetica_2p - prof. Enzo Mardegan - 5

6 Serve anche un altro RNA detto RNA di trasporto, trna. Ci sono 20 trna diversi, tanti quanti sono gli amminoacidi, ogni trna riconosce il suo amminoacido. La mutazione genetica. è la comparsa di un nuovo carattere, non presente in alcun antenato. Sono degli errori nelle basi azotate del DNA. Di solito avvengono durante la duplicazione del DNA. Se la mutazione interessa una cellula somatica l effetto riguarda solo quel individuo. Se la mutazione riguarda una cellula sessuale l effetto riguarda i figli. Esistono anche mutazioni provocate da vari fattori detti agenti mutageni: - radiazioni ionizzanti (raggi X e raggi ultravioletti), - inquinamento atmosferico, - inquinamento agricolo, - fumo di sigarette, - coloranti e additivi alimentari, - farmaci e cosmetici. Genetica_2p - prof. Enzo Mardegan - 6

7 L ereditarietà nell uomo Nell uomo i caratteri ereditari si trasmettono secondo le leggi di Mendel ma di solito in modo più complesso perché determinati da più geni. La nascita di un figlio maschio o femmina è decisa dalle leggi di Mendel. Una delle 23 coppie di cromosomi è diversa a seconda del sesso: nella donna è formata da cromosomi uguali (XX) nell uomo da cromosomi diversi (XY) Questa 23 a coppia di cromosomi, detti cromosomi sessuali, sono quelli che determinano il sesso del nascituro. Genetica_2p - prof. Enzo Mardegan - 7

8 I casi possibili sono: SS omozigote con occhi scuri Vediamo i possibili incroci: Il colore degli occhi ss omozigote con occhi azzurri Ss eterozigote con occhi scuri Genetica_2p - prof. Enzo Mardegan - 8

9 Genetica_2p - prof. Enzo Mardegan - 9

10 Malattie ereditarie legate al sesso perché sono trasmesse da geni presenti nei cromosomi sessuali. emofilia incapacità di coagulare il sangue. causata da un allele recessivo nel cromosoma X. i casi possibili sono: XX femmina sana XX femmina portatrice sana X X femmina emofilica XY maschio sano X Y maschio emofilico madre portatrice sana padre sano madre sana padre emofilico Genetica_2p - prof. Enzo Mardegan

11 madre emofilica padre sano madre emofilica padre emofilico daltonismo difficoltà di distinguere alcuni colori. causata da un allele recessivo nel cromosoma X. i casi possibili sono: XX femmina sana XX* femmina portatrice sana X*X* femmina daltonica XY maschio sano X*Y maschio daltonico Genetica_2p - prof. Enzo Mardegan


LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:


Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,


Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione


-malattie monogeniche o mendeliane:

-malattie monogeniche o mendeliane: Martedì 16 Febbraio è venuta nella nostra classe la dr.ssa Petrelli Maria a spiegarci le malattie sessualmente trasmissibili e ereditarie, sessualità e affettività. Ci ha spiegato la divisione delle cellule





Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.


LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze


I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni


Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami



OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata


Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo


Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC Genetica umana Ramón Lucas Lucas, LC P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:


GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà GENETICA... lessico Genetica: studio dei geni e dell'ereditarietà Geni: porzioni di DNA contenenti un'informazione che permette di decodificare una certa proteina. Es: gene che determina il colore dei



LE MALATTIE GENETICHE CLASSE 3 C LE MALATTIE GENETICHE CLASSE 3 C Malattia causata da allele dominante Il nanismo acondroplastico è una malattia causata da un allele dominante; gli individui che ne sono affetti sono di statura molto bassa,


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,


La trasmissione delle malattie genetiche. Anna Onofri

La trasmissione delle malattie genetiche. Anna Onofri La trasmissione delle malattie genetiche Gli alberi genealogici Anna Onofri I simboli maggiormente utilizzati Le malattie genetiche Molte malattie genetiche sono legate ad un singolo gene e possono verificarsi



V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una


= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il



Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Durante la meiosi, i membri di una coppia allelica si separano in modo simmetrico nelle uova e negli spermatozoi. Questa separazione


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di



GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel


I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel il sesso di un individuo


Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma



I CARATTERI EREDITARI I CARATTERI EREDITARI I primi passi per comprendere come si trasmettono le caratteristiche attraverso le generazioni furono lenti e difficili. I caratteri di un individuo sono spesso molto simili a quelli


Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di


Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi

Determinazione della struttura di una molecola di RNA tramite una sequenza di numeri primi Università degli Studi di Milano Polo Didattico e di Ricerca di Crema Facoltà di Scienze Matematiche, Fisiche e Naturali Corso di Geometria Computazionale Determinazione della struttura di una molecola



ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel


Gli Acidi Nucleici DNA RNA

Gli Acidi Nucleici DNA RNA Gli Acidi Nucleici DNA RNA Gli Acidi nucleici Gli acidi nucleici sono il: DNA (acido desossiribonucleico) RNA (acido ribonucleico) Essi sono formati dai polimeri (molecole molto grosse) i cui monomeri


Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi


Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:


Malattie genetiche. Dott. Giovanni LONGO

Malattie genetiche. Dott. Giovanni LONGO Malattie genetiche Dott. Giovanni LONGO Il ruolo della ricerca scientifica Esistono una quantità quasi infinita di rimedi o cure contro un'altrettanta quantità di malattie. La ricerca scientifica si occupa



TEORIA CROMOSOMICA : ALLEGATI TEORIA CROMOSOMICA : ALLEGATI FIG. 2 a pag. 1 FIG. 5 a pag. 3 FIG. 7 a pag. 5 FIG. 9 a pag. 7 FIG. 3 e 4 a pag. 2 FIG. 6 a pag. 4 FIG. 8 a pag. 6 FIG. 10 e 11 a pag. 8 1 FIGURA 2 Perché sono tutti maschi


Progetto di una Unità di Apprendimento flipped

Progetto di una Unità di Apprendimento flipped Progetto di una Unità di Apprendimento flipped Dati dell Unità di Apprendimento Titolo: Studiare la vita: la molecola di DNA Scuola: Scuola Secondaria di Primo Grado Materia: Scienze Classe : Terza Argomento


Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


La Genetica. Le leggi di Mendel

La Genetica. Le leggi di Mendel La Genetica Le leggi di Mendel La Genetica Il monaco Gregor Mendel (1822-1884) fu il primo a studiare in modo rigoroso il fenomeno della trasmissione dei caratteri ereditari. Per questo, pur non avendo



MUTAZIONI ED EVOLUZIONE MUTAZIONI ED EVOLUZIONE Durante la duplicazione del DNA possono verificarsi errori di copiatura se ad esempio al posto di una base azotata ne viene inserita un altra. In questo caso può succedere che cambi


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


TEST Lo Studente Ricercatore edizione 2011

TEST Lo Studente Ricercatore edizione 2011 TEST Lo Studente Ricercatore edizione 2011 1. A chi soffre di colesterolo elevato è sconsigliato mangiare i crostacei, che ne contengono una quantità elevata. Dovrà pertanto eliminare dal suo menù soprattutto


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Psicologia generale. Dr. Alessandra Galmonte. e-mail:

Psicologia generale. Dr. Alessandra Galmonte. e-mail: Psicologia generale Dr. Alessandra Galmonte e-mail: 1 3 Evoluzione, Ereditabilità e Comportamento Evoluzione E costituita dai processi che hanno trasformato la vita sulla terra



NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato


GENETICA PRETEST 2014. Studenti Per

GENETICA PRETEST 2014. Studenti Per GENETICA PRETEST 2014 Studenti Per LA GENETICA è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui


IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE.

IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE. IL GENOMA UMANO Ogni cellula contiene nel nucleo una molecola chiamata DNA (acido desossiribonucleico) Tale molecola ha la forma di una lunghissima scala a chiocciola. I gradini che compongono la scala


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


Capitolo 3 Riproduzione e trasmissione dei cromosomi

Capitolo 3 Riproduzione e trasmissione dei cromosomi Capitolo 3 Riproduzione e trasmissione dei cromosomi 3.1 Nelle cellule somatiche del topolino domestico vi sono 40 cromosomi. a. Quanti cromosomi riceve dal padre? b. Quanti autosomi sono presenti nel


Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked



CROMOSOMI SESSUALI e ALLELI CROMOSOMI SESSUALI e ALLELI Nelle due immagini che seguono possiamo osservare una fotografia dei 46 cromosomi di una cellula somatica umana (a sinistra) e gli stessi cromosomi sistemati, grazie ad un programma



27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di


CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si





Prove associate al percorso UGUALI EPPUR DIVERSI

Prove associate al percorso UGUALI EPPUR DIVERSI Titolo: Prove associate al percorso UGUALI EPPUR DIVERSI Autore: Laura Cassata Percorsi didattici associati: A- Uguali eppur diversi AVVERTENZA: Le domande che seguono si ispirano al percorso o ai percorsi


GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna


Cellule e DNA. Per saperne di più. Nella terra e nello spazio

Cellule e DNA. Per saperne di più. Nella terra e nello spazio Nella terra e nello spazio ellule e DN utti i viventi sono fatti di cellule. Nelle cellule ci sono dei corpuscoli che hanno compiti diversi: nutrire la cellula, farla respirare, trasmettere informazioni,



PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice


Esperienza 9: estrazione del DNA

Esperienza 9: estrazione del DNA Esperienza 9: estrazione del DNA Il DNA è la molecola essenziale di tutti gli organismi viventi. Essa contiene l informazione genetica che fa di un organismo o di una cellula ciò che è. Soggetti: purificazione

Dettagli LE LEGGI DI MENDEL LE LEGGI DI MENDEL LE LEGGI DI MENDEL Gregor Johann Mendel (1822-1884) Comprese i principi che regolano la trasmissione dei caratteri ereditari alla progenie senza conoscere - l esistenza dei geni


unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute



CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso


I Composti Organici. Le Biomolecole

I Composti Organici. Le Biomolecole I Composti Organici I composti organici sono molecole tutte contenenti carbonio. Essi comprendono. 1. composti di interesse energetico che sono gli Idrocarburi ( i derivati del petrolio), 2. composti a


La terza legge: l'indipendenza dei caratteri

La terza legge: l'indipendenza dei caratteri La terza legge: l'indipendenza dei caratteri Formulazione semplificata della terza legge, supportata da immagine e filmato TERZA LEGGE DI MENDEL ANIMAZIONE a cura di Gigliola Merante 1 Verifichiamo la


LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione.

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. Gregor Jhoann Mendel (1822-1884) Mendel viveva nel monastero di Brum, a Brno in Repubblica Ceca, studiò


Analisi genetica nell uomo: alberi genealogici problemi interpretazione

Analisi genetica nell uomo: alberi genealogici problemi interpretazione Analisi genetica nell uomo: alberi genealogici problemi interpretazione Tipi di ereditarietà monofattoriale autosomica dominante recessiva legata al sesso dominante recessiva Alberi genealogici o pedigrees



DI TESTA VITO MARIA STA/L-CS VITERBO DI TESTA VITO MARIA STA/L-CS VITERBO 1 Sommario - Capitolo 1 Natura materiale ereditario da pag.3 a pag.7 - Capitolo 2 Organizzazione materiale ereditario da pag. 8 a pag.15 - Capitolo 3 Trasmissione del


Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta



LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in


Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule


Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare V Scuola di Ingegneria dell Informazione Laurea Magistrale in Ingegneria Informatica II Scuola di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione



CAUSE INTRINSECHE DI MALATTIA CAUSE INTRINSECHE DI MALATTIA CAUSA INTRINSECA (fattore endogeno, insito nell organismo) Alterazioni del Patrimonio Genetico Malattie Ereditarie Predisposizioni Fattori, ereditati geneticamente, che favoriscono


La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel


CAUSE INTRINSECHE DI MALATTIA CAUSA INTRINSECA (fattore endogeno, insito nell organismo) Alterazioni del Patrimonio Genetico Malattie Ereditarie Predisposizioni Fattori, ereditati geneticamente, che favoriscono


Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte



LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia


Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di



GENETICA ed EREDITARIETÀ GENETICA ed EREDITARIETÀ 1. Introduzione L Epidermolisi Bollosa (EB) è una malattia di carattere genetico, la cui causa è pertanto da ricercare nei caratteri ereditari di un individuo. I processi che avvengono


Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le tre leggi di Mendel, che descrivono la trasmissione dei caratteri ereditari da una generazione all altra, segnano l inizio della


. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo


Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia Ingegneria delle tecnologie per la salute Anatomia e istologia umana Cenni di Biologia Macromolecole: Glucidi Lipidi Proteine Acidi nucleici glucidi Monosaccaridi: glucosio, fruttosio, galattosio, desossiribosio,



CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati



LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole


Protocollo dei saperi imprescindibili

Protocollo dei saperi imprescindibili Protocollo dei saperi imprescindibili Ordine di scuola:professionale DISCIPLINA: Scienze integrate( Scienze della Terra e Biologia) RESPONSABILE: Meri Teti CLASSI SECONDE SEZIONE B INDIRIZZO: Grafico CONOSCENZE/CONTENUTI:


La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.


CLASSE I classico A e B



Genetica ed evoluzione

Genetica ed evoluzione Genetica ed evoluzione Lo zigote è una cellula che si ottiene con la fecondazione, ovvero dalla fusione di due cellule specializzate (i gameti, maschile e femminile). I cromosomi (formati dal DNA) sono





Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


PILLOLE DI GENETICA. Da Gregor Mendel ad oggi

PILLOLE DI GENETICA. Da Gregor Mendel ad oggi PILLOLE DI GENETICA Da Gregor Mendel ad oggi Obiettivi Conoscere: DNA, cromosomi, geni, genoma, alleli, eterozigote e omozigote, genotipo e fenotipo, tratti dominanti e recessivi, codominanza e dominanza


Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione


Struttura di una possibile serie di lezioni sull ereditarietà e sul DNA

Struttura di una possibile serie di lezioni sull ereditarietà e sul DNA 1 Struttura di una possibile serie di lezioni sull ereditarietà e sul DNA IL PERCORSO DIDATTICO Conosciamo noi stessi A chi assomiglio? Analisi dei caratteri ereditati Da dove derivano i caratteri? Costruiamo


Le mutazioni Quando le informazioni sono errate

Le mutazioni Quando le informazioni sono errate Le mutazioni Quando le informazioni sono errate Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Storia delle mutazioni Dal 1927 viene usato il concetto di mutazione così come è inteso oggi Il primo


Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente
