La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita."

Transcript

1 IL CICLO CELLULARE

2 Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. E un processo geneticamente controllato, costituito da una serie di eventi coordinati e dipendenti tra loro, dai quali dipende la corretta proliferazione delle cellule. Gli eventi molecolari che controllano il ciclo cellulare sono ordinati e direzionali: ogni processo è la diretta conseguenza dell'evento precedente ed è la causa di quello successivo. Ė caratterizzato da cinque fasi: G1,S,G2, mitosi e citodieresi

3 Affinché l informazione genetica venga correttamente trasmessa dalla cellula madre alle cellule figlie, il genoma deve essere prima duplicato durante il periodo di tempo denominato fase S e in seguito i cromosomi vengono segregati nelle due cellule figlie durante la fase M. La fase M è a sua volta composta da due processi, strettamente collegati: la mitosi, durante la quale i cromosomi della cellula sono divisi tra le due cellule figlie e la citodieresi, che comporta la divisione fisica del citoplasma della cellula.

4 Il centromero non occupa la stessa posizione in tutti i cromosomi e divide ogni cromatide in due parti, i bracci, la cui lunghezza dipende dalla posizione del cinetocore. La posizione del centromero permette di classificare i cromosomi in 4 tipi: acrocentrici: centromero in posizione terminale. telocentrici: centromero in posizione subterminale. submetacentrici: centromero in posizione submediana. metacentrici: centromero in posizione mediana.

5 Il cinetocore è una componente del centromero. Di solito per ogni centromero abbiamo 2 cinetocori, un cinetocore per ogni cromatidio. Il ruolo dei cinetocori è quello di agganciarsi ai microtubuli del fuso mitotico durante la divisione cellulare. In questo modo i cromosomi vengono allineati correttamente all'equatore del fuso, e successivamente grazie alla trazione dei microtubuli, che si accorciano i cromatidi fratelli vengono separati e trascinati ai due poli opposti della cellula. Sono collocati sulla parte esterna di ciascun cromatidio e sono costituiti da tre strati proteici.

6 CARIOTIPO Ogni specie ha un determinato numero di cromosomi e caratteristiche morfologiche peculiari I cromosomi sono classificati in ordine decrescente, dai più grandi ai più piccoli, secondo uno schema standardizzato CROMOSOMI Costituiti da un filamento a doppia elica di DNA e da proteine i cromosomi sono spesso presenti in coppie. Le cellule che hanno coppie di cromosomi omologhi (simili) sono dette diploidi (2n), mentre sono definite aploidi (n) quelle che possiedono solo un cromosoma per tipo. I cromosomi omologhi contengono lo stesso tipo di informazione (variazioni di uno stesso carattere) Nell'uomo si hanno 23 coppie di cromosomi, di cui 22 sono cromosomi somatici non sessuali ed una coppia di cromosomi diversi, i cromosomi sessuali

7 Una cellula si definisce aploide se presenta un unico assetto cromosomico, ovvero possiede un solo cromosoma per ogni tipo. Una cellula aploide si differenzia da una cellula diploide in quanto questa ha due patrimoni genetici, ereditati solitamente dal padre e dalla madre. Per tale motivo, mentre per indicare una cellula diploide si usa usare la notazione 2n, per indicare una cellula aploide si usa n.

8 INTERFASE (attività metabolica) CICLO CELLULARE Le cellule che non si dividono escono dal ciclo e rimangono bloccate nella fase G1 (G0 ) MITOSI (divisione) CITODIERESI (divisione citoplasma)

9

10 Punti di controllo Il ciclo cellulare è un processo estremamente importante; errori in questo processo potrebbero compromettere la vitalità cellulare. Per tale motivo, nel ciclo cellulare, sono presenti dei punti di controllo o checkpoints, localizzati a livello delle transizioni G1/S e G2/M. G1 fra la fine della mitosi e l inizio della fase S G2 fra il termine della fase S e l inizio della fase M. In questi periodi di tempo si ha la maggior parte della sintesi proteica con conseguente aumento della massa cellulare e la realizzazione dei controlli che impediscono l inizio della fase successiva se non è stata completata quella precedente.

11 G1 phase (G = gap): la cellula monitora le sue dimensioni e l ambiente esterno e cresce sintetizzando RNA e proteine S (S = synthesis): replicazione del materiale genetico. Il DNA passa da 2n a 4n. G2: controllo dell avvenuta replicazione di tutti i cromosomi e una crescita secondaria prima della mitosi. In questa fase il DNA ha un corredo 4n. M (M = Mitosis): si compone di profase, metafase, anafase e telofase e citochinesi Alcuni tipi cellulari non si dividono più (cellule terminalmente differenziate), sono usciti irreversibilmente dal ciclo cellulare, altre cellule entrano in uno stato di quiescienza chiamato G0 e possono essere stimolate a lasciare G0 e a rientrare nel ciclo cellulare. Le cellule nervose e quelle striate dei muscoli scheletrici, ad esempio, rimangono in questo stadio per tutta la vita dell'organismo. La lunghezza di G1 riflette il fatto che le cellule per lo più richiedono più tempo per crescere e raddoppiare la massa di proteine e organelli che per duplicare il DNA e dividersi. Se le condizioni extracellulari sono sfavorevoli, per esempio, la cellula ritarda la progressione in G1 e può entrare in G0. Le cellule che non vanno più incontro a divisione in seguito ad invecchiamento o a danneggiamento del DNA sono invece chiamate senescenti.

12 MITOSI PROCESSO DI DIVISIONE CELLULARE CHE GARANTISCE LA CONSERVAZIONE E LA DISTRIBUZIONE DELLO STESSO NUMERO DI CROMOSOMI DA UNA CELLULA MADRE ALLE DUE CELLULE FIGLIE. PROFASE: condensazione della cromatina presente nel nucleo della cellula, seguita dalla formazione dei cromosomi. La membrana nucleare si dissolve e due corpuscoli, i centrioli, cominciano a migrare verso i poli della cellula, formando una struttura a raggiera, il fuso mitotico. METAFASE: completa formazione dei cromosomi. Le fibre de fuso si attaccano al cinetocore Formazione piastra metafasica ANAFASE: I cromatidi dei cromosomi si separano Migrazione al rispettivo polo La cellula si allunga TELOFASE: diminuisce il grado di compattazione dei cromosomi Vengono ricostituiti i nuclei Ricompare il nucleolo Scompare fuso CITODIERESI : Divisione del citoplasma Formazione di un solco in prossimità della zona equatoriale FORMAZIONE DI DUE CELLULE FIGLIE GENETICAMENTE UGUALI ALLA CELLULA MADRE IL CORREDO CROMOSOMICO E DIPLOIDE MA I CROMOSOMI SONO COSTITUITI DA UN SOLO CROMATIDE CHE VIENE DUPLICATO IN S

13 PROFASE-METAFASE

14 METAFASE-ANAFASE-TELOFASE

15 La mitosi produce sempre due cellule geneticamente identiche alla cellula madre e la maggior parte degli organelli citoplasmatici si distribuisce casualmente nelle cellule figlie

16 La riproduzione, in biologia, è l'insieme dei meccanismi mediante i quali gli esseri viventi provvedono alla conservazione della propria specie generando nuovi individui simili a sé e che subentreranno al genitore, o ai genitori, nella popolazione. RIPRODUZIONE ASESSUATA (mitosi) RIPRODUZIONE SESSUATA (meiosi/cariogamia)

17 SCISSIONE : MODALITÀ DI RIPRODUZIONE ASESSUATA, CARATTERIZZATA DALLA DIVISIONE DELL'ORGANISMO IN DUE O PIÙ PARTI, DA CIASCUNA DELLE QUALI SI SVILUPPA UN INDIVIDUO COMPLETO

18 SCISSIONE BINARIA Il cromosomi duplicati si associano alla membrana in punti diversi formazione di un setto Il tempo di duplicazione è 20 min Le cellule figlie sono identiche tra loro e alla cellula madre

19 VARIABILITA GENETICA Variabilità genetica ADATTAMENTO Nei batteri la riproduzione asessuata prevede un processo di duplicazione MUTAZIONI Per ricombinazione genetica si intende ogni processo attraverso il quale, a partire da un genotipo, si ottengono nuove combinazioni di alleli rispetto a quelle iniziali BATTERI: TRASFORMAZIONE TRASDUZIONE CONIUGAZIONE

20 TRASDUZIONE Il trasferimento del materiale genetico è mediato da un virus dei batteri chiamato batteriofago. 1. Le fimbrie del batteriofago si legano alla parete del batterio, grazie a degli antirecettori che riconoscono specifici siti di adesione sulla parete cellulare. 2. La piastra aderisce alla parete del batterio. Viene liberato un enzima, detto lisozima, che va a ledere il peptidoglicano che costituisce la parete batterica. 3. La coda si contrae ed il DNA del virus viene spinto all'interno del DNA batterico. CICLO LITICO: il DNA si replica, vengono sintetizzati RNA e proteine virali; queste ultime si uniscono fra loro (si assemblano) per formare nuovi virus, nella cui testa si inserisce il genoma virale neoformato. Al termine del processo, il batterio va incontro a lisi e a liberazione dei virus, che vanno poi ad infettare altri batteri. CICLO LISOGENO: il DNA virale va ad integrarsi nel DNA batterico. I fagi che hanno un ciclo lisogeno vengono chiamati virus temperati, perché il loro DNA si integra nel cromosoma batterico e come esso si comporta; di conseguenza, viene trasferito alle nuove generazioni senza determinare alcun danno per il batterio. Questo stato di quiescenza può essere tuttavia spezzato da stimoli opportuni (raggi UV, stress ecc.); in queste situazioni il DNA virale si può staccare, passando dal ciclo lisogeno a quello litico.

21 TRASFORMAZIONE Passaggio di frammenti di DNA libero, originati dalla lisi batterica, ad un batterio ricevente 1) legame tra DNA e cellula 2) ingresso del DNA nella cellula 3) ricombinazione del DNA libero che entra nel batterio ricevente 4) espressione fenotipica Un DNA per essere trasformante deve essere: 1) a doppia elica 2) con peso molecolare superiore a 106 Dalton 3) avere un'elevata analogia col DNA della cellula ricevente La cellula ricettrice, da parte sua, deve essere in uno stato fisiologico chiamato di competenza. Una cellula è competente quando è al termine della sua crescita esponenziale o logaritmica; in questa fase, infatti, la sintesi proteica è massima e vengono espressi fattori di competenza (proteine che permettono al DNA di entrare).

22 I batteri contengono frequentemente anche una o più copie di molecole di DNA, per lo più circolari, di dimensioni molto più piccole di quelle del cromosoma batterico, chiamate plasmidi. Di solito i plasmidi non sono essenziali per la vitalità e la crescita dei batteri, ma conferiscono ad essi delle particolari caratteristiche, quali, ad esempio, la resistenza ad un antibiotico. I plasmidi sono tra gli elementi genetici più utilizzati nelle procedure di clonaggio di geni

23 CONIUGAZIONE Trasferimento genico attraverso il contatto fisico tra due batteri, di cui il donatore è denominato F+ (fertilità positivo) e possiede un pilo di coniugazione, mentre il ricevente F-. Alcuni batteri contengono un plasmide, detto fattore F, che codifica per delle proteine che formano il pilo di coniugazione. Questo plasmide, dotato di replicazione autonoma, possiede dei geni che gli consentono di replicarsi e trasferirsi da un batterio F+ all'altro (F-). 1. un batterio F+ incontra un batterio F- e si forma un ponte di unione. 2. A questo punto il plasmide comincia a replicarsi con un meccanismo detto rolling circle (in direzione 5' - 3'), durante il quale una delle due emieliche passa attraverso il pilo. 3. Alla fine della replicazione e del trasferimento, abbiamo due F+, poiché il primo mantiene la copia del plasmide, mentre l'f- riceve la seconda emielica, che poi si duplica e forma il plasmide.

24 RIPRODUZIONE SESSUATA Contributo di individui di sesso diverso Aumento variabilità genetica Ogni individuo produce le cellule germinali (GAMETI) con corredo cromosomico aploide MASCHIO FEMMINA MEIOSI SPERMATOZOI (aploide) OVOCITI (aploide) FECONDAZIONE ZIGOTE (diploide) SVILUPPO DELL INDIVIDUO

25 MEIOSI La meiosi è un processo di divisione mediante il quale una cellula eucariotica con corredo cromosomico diploide dà origine a quattro cellule con corredo cromosomico aploide. Consiste in due divisioni nucleari e citoplasmatiche successive, precedute da una sola duplicazione del corredo genetico. E UN PROCESSO FONDAMENTALE PER GARANTIRE LA CONSERVAZIONE DELLO STESSO NUMERO DI CROMOSOMI ALL INTERNO DI OGNI SPECIE. Meiosi I (divisione riduzionale) Profase: la cromatina si condensa formando i cromosomi metafasici i cromosomi omologhi si appaiano lungo tutta la loro lunghezza formando delle strutture dette tetradi. Quindi cominciano ad allontanarsi rimanendo uniti in punti detti chiasmi. A livello di questi chiasmi avviene il crossing-over scambio di materiale genetico tra cromosomi omologhi. Il crossing-over aumenta la variabilità genetica, ricombinando casualmente il materiale genetico. Sempre in questa fase si dissolve la membrana nucleare, i centrioli migrano ai poli e iniziano a formare il fuso. Metafase: le tetradi si allineano in piastra equatoriale longitudinalmente i centromeri si fissano al fuso e gli interi cromosomi migrano ai poli della cellula. Anafase: si completa la migrazione dei cromosomi. Telofase: avviene la divisione delle 2 cellule e la riformazione della membrana nucleare. Al termine della meiosi I si sono formate 2 cellule aploidi. La meiosi II E sostanzialmente uguale alla mitosi, ma con un corredo cromosomico dimezzato. Inoltre la profase è molto più rapida perché la cromatina è già spiralizzata. Alla fine della meiosi II si formano 4 cellule figlie, tutte diverse tra loro e aploidi, cioè con un patrimonio genetico dimezzato rispetto alla cellula madre. Quindi nella meiosi a partire da una cellula diploide si formano 4 cellule aploidi, tutte diverse fra loro. Nelle regioni in cui si verifica il crossing over vengono spezzati dei cromatidi di un omologo e questi segmenti vengono scambiati con le porzioni corrispondenti dei cromatidi dell'altro omologo.i cromatidi di ogni omologo non contengono più un materiale genetico identico: il cromosoma di origine materna ora contiene porzioni del cromosoma omologo di origine paterna, e viceversa. Come risultato, il figlio eredita una mescolanza casuale degli alleli dei due genitori per i diversi caratteri. 23 cromosomi con 1cromatide

26

27 DIVISIONE RIDUTTIVA PROFASE I 1. leptotene 2. zigotene (sinapsi) 3. pachitene (crossing-over; tetrade) 4. diplotene (chiasmi) 5. Diacinesi METAFASE I ANAFASE I: i componenti di una coppia di cromosomi omologhi si dirigono verso i poli opposti; i centromeri non si sono divisi quindi i cromosomi sono composti da due cromatidi e sono detti diade TELOFASE I: 2 cellule figlie con meta dei cromosomi formati ciascuno da due cromatidi DIVISIONE MEIOTICA PROFASE II METAFASE II ANAFASE II: si dividono i cromatidi di ciascun cromosoma TELOFASE II: citocinesi 4 cellule con metà numero dei cromosomi formati ciascuno da un cromatide

28

29 Meiosi 1: i membri di ogni coppia di cromosomi omologhi prima si uniscono, poi si separano e vengono distribuiti in nuclei distinti. Meiosi 2: i cromatidi che costituiscono ciascun cromosoma omologo si separano e vengono distribuiti ai nuclei delle cellule figlie

30 PUNTI IMPORTANTI NELLA MEIOSI: 1. Produzione di cellule aploidi 2. CROSSING-OVER: nella profase I durante l appaiamento tra i cromosomi omologhi (tetradi) può avvenire uno scambio reciproco di parti tra cromosomi omologhi 3. ASSORTIMENTO CASUALE dei cromosomi omologhi (I divisione) e dei cromatidi fratelli (II divisione) con formazione di nuove combinazioni. All anafase I gli omologhi si disgiungono e migrano ai due poli della cellula in modo indipendente per ogni paio, allo stesso modo si comportano i cromatidi fratelli all anafase II 2+3 RIMESCOLAMENTO DEL PATRIMONIO GENETICO

31 ERRORI DURANTE LA MEIOSI ALTERAZIONI NUMERICHE L'aneuploidia è una variazione nel numero dei cromosomi, rispetto a quello che normalmente caratterizza le cellule di un individuo della stessa specie. TRISOMIA 21 (sindrome di Down): presenza di 3 cromosomi 21 invece che 2. le cellule del individuo hanno quindi 47 cromosomi. Ritardo mentale-disturbi cardiocircolatori-maggiore suscettibilità alle infezioni. SINDROME DI TURNER: presenza di un solo cromosoma X. Femmine con caratteri sessuali poco sviluppatibassa statura -ritardi nel processo di ossificazione dello scheletro La formazione di uno zigote con un solo cromosoma sessuale X, da cui si sviluppa un individuo portatore di sindrome di Turner, avviene se una cellula uovo normale, con corredo cromosomico X, viene fecondata da uno spermatozoo privo di cromosoma sessuale; oppure se uno spermatozoo portatore del cromosoma X si fonde con una cellula uovo priva di cromosoma sessuale. ALTERAZIONI STRUTTURALI invertito DELEZIONI: perdita di un frammento da un cromosoma DUPLICAZIONI: inserimento di un frammento di un cromosoma nel cromosoma omologo INVERSIONI: reinserimento di un frammento di cromosoma nel cromosoma originario, ma con orientamento TRASLOCAZIONE: spostamento di un frammento di un cromosoma su un cromosoma non omologo SINDROME CRI DU CHAT: è una malattia genetica rara causata dalla delezione di parte del cromosoma 5 ritado mentale-cranio piccolo-pianto/miaglolio Le alterazioni cromosimiche che si verificano nelle cellule somatiche sono rsponsabili della possibile insorgenza di forme tumorali. LEUCEMIA MIELOIDE CRONICA: traslocazione di una porzione del cromosoma 22 che si scambia con una porzione del cromosoma 9, con conseguente attivazione di un gene che causa l insorgenza di questa forma tumorale

32 GAMETOGENESI (OOGENESI-SPERMATOGENESI) SPERMATOGENESI: Le cellule germinali maschili si formano nei testicoli. Gli spermatogoni sono cellule diploidi che subiscono diversi cicli mitotici nei tubuli seminiferi. 1 spermatogonio 4 spermatozoi OOGENESI: Le cellule germinali femminili si formano nell ovaio con un processo di maturazione ciclica. Gli ovogoni si riproducono per mitosi in epoca prenatale e sono contenute nei follicoli. Al momento della nascita sono bloccati in profase I. quando l organismo raggiunge la maturità sessuale, ogni mese un ovocita e il suo follicolo maturano. 1 ovogonio 1 ovocita

33

34

35 I processi di base della meiosi sono simili a quelli della mitosi, ma presentano 4 importanti differenze: 1. La meiosi comporta 2 successive divisioni nucleari e citoplasmatiche con potenziale produzione di 4 cellule. 2. Nonostante le due divisioni il DNA subiscono una sola duplicazione durante l interfase che precede la div. meiotica 3. Ognuna delle 4 cellule prodotte contiene un n ap loide di cromosomi, cioè solo un esemplare di ogni coppia di omologhi. 4. Durante la meiosi l informazione genetica che proviene da entrambi i genitori viene mescolata, così che ogni cellula possiede una combinazione di geni potenzialmente unica.

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

LA MEIOSI E LA RIPRODUZIONE

LA MEIOSI E LA RIPRODUZIONE LA MEIOSI E LA RIPRODUZIONE Gli organismi eucarioti si riproducono asessualmente o sessualmente. Nella riproduzione asessuata (o agamica o vegetativa), un singolo individuo si riproduce mediante mitosi

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

Seminario di BIOLOGIA APPLICATA Zannotti maria

Seminario di BIOLOGIA APPLICATA Zannotti maria Seminario di BIOLOGIA APPLICATA Zannotti maria Testi Quelli dello scorso anno Programma 1 LA RIPRODUZIONE DEI VIVENTI Cellule (mitosi) Organismi (meiosi) Gametogenesi fecondazione: barbieri carinci. Cap

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed anche la maggiore dipendenza dalle proteine policomb per

Dettagli

Cromosomi MITOSI MEIOSI

Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a connesso@alice.it entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi

Dettagli

Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

La riproduzione e lo sviluppo

La riproduzione e lo sviluppo La riproduzione e lo sviluppo La riproduzione umana In biologia si definisce riproduzione il processo attraverso il quale vengono generati nuovi individui della stessa specie. La riproduzione umana è caratterizzata

Dettagli

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi Vie genitali maschili e ghiandole accessorie FECONDAZIONE

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Tel

Tel silvia.bonaccorsi@uniroma1.it Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I LA MEIOSI Una coppia di cromosomi omologhi, presenti nel nucleo di una cellula diploide, è costituita da un primo cromosoma isolato di derivazione paterna e da un secondo cromosoma isolato di derivazione

Dettagli

Programma Didattico Annuale

Programma Didattico Annuale LICEO SCIENTIFICO STATALE GALILEO GALILEI PdQ - 7.06 Ediz.: 1 Rev.: 0 Data 02/09/05 Alleg.: D01 PROG. M2 PROCEDURA della QUALITA' Programma Didattico Annuale Anno Scolastico 2012/2013 MATERIA : Scienze

Dettagli

Le mutazioni Quando le informazioni sono errate

Le mutazioni Quando le informazioni sono errate Le mutazioni Quando le informazioni sono errate Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Storia delle mutazioni Dal 1927 viene usato il concetto di mutazione così come è inteso oggi Il primo

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

Ciclo Cellulare 18/01/2015

Ciclo Cellulare 18/01/2015 Ciclo Cellulare Biotecnologie http://upload.wikimedia.org/wikipedia/commons/e/e3/mitosis_%28261_13%29_pressed%3b_root_meristem_of_onion_%28cells_in_ prophase,_metaphase,_anaphase,_telophase%29.jpg http://270c81.medialib.glogster.com/media/3b/3b966af047cca0605f106aa1a34dd3451287c5e41a0c7ce8ce537f74bbb795eb/main

Dettagli

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI La Fecondazione Processo con cui due cellule sessuali (gameti) si uniscono per formare un nuovo individuo cha ha un genoma

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

cenni di anatomia del testicolo

cenni di anatomia del testicolo cenni di anatomia del testicolo Il gamete maschile è rappresentato della spermatozoo la produzione e maturazione del gamete maschile avviene nel testicolo Il testicolo fa parte dell apparato riproduttivo

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si

Dettagli

CLASSE I classico A e B

CLASSE I classico A e B LICEO SCIENTIFICO "A. APROSIO" VENTIMIGLIA CLASSE I classico A e B Anno scolastico 2011-2012 UNITA' DIDATTICA N 1 METODI ED ORGANIZZAZIONE DEI CONCETTI IN BIOLOGIA 1.1 LE CARATTERISTICHE COMUNI A TUTTI

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

Trasmissione della informazione: livello cellulare

Trasmissione della informazione: livello cellulare Trasmissione della informazione: livello cellulare Prof.ssa Flavia Frabetti aa.2010-11 ACCRESCIMENTO E DIVISIONE DIVISIONE CELLULARE CRESCITA CELLULARE E DUPLICAZIONE DEI CROMOSOMI SEGREGAZIONE DEI CROMOSOMI

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed.

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015 CHIMICA Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. Tramontana S. Passannanti C. Sbriziolo Noi e la chimica agli atomi

Dettagli

LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie Nullisomia: 2n-2 (morte preimpianto) Monosomia: : 2n-1 (generalmente morte embrionale) Trisomia: :

Dettagli

Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

GAMETOGENESI Dove avviene la meiosi nel nostro corpo?

GAMETOGENESI Dove avviene la meiosi nel nostro corpo? GAMETOGENESI Dove avviene la meiosi nel nostro corpo? gametogenesi nella femmina e nel maschio prima divisione meiotica globulo polare seconda divisione meiotica gametogenesi nella femmina e nel maschio

Dettagli

TEST Lo Studente Ricercatore edizione 2011

TEST Lo Studente Ricercatore edizione 2011 TEST Lo Studente Ricercatore edizione 2011 1. A chi soffre di colesterolo elevato è sconsigliato mangiare i crostacei, che ne contengono una quantità elevata. Dovrà pertanto eliminare dal suo menù soprattutto

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

La meiosi

La meiosi www.fisiokinesiterapia.biz La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni

Dettagli

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare)

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare) Il checkpoint del fuso mitotico (Pietro Perini-gruppo ciclo cellulare) 1) Prima di approfondire la funzione del checkpoint del fuso mitotico, è opportuno ricordare quali sono le caratteristiche e le funzioni

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

testicolo dotto deferente

testicolo dotto deferente LA SPERMATOGENESI Struttura del testicolo epididimo testicolo dotto deferente Funzioni del testicolo: esporta spermatozoi ed ormoni androgeni Struttura del testicolo LA SPERMATOGENESI Per testicolo ci

Dettagli