La riproduzione cellulare

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La riproduzione cellulare"


1 La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita. La riproduzione cellulare permette di ottenere: la riproduzione degli organismi la crescita e lo sviluppo degli organismi pluricellulari la riparazione dei tessuti e il ricambio cellulare Tipi di riproduzione La riproduzione di un organismo può avvenire attraverso la moltiplicazione di sue cellule indifferenziate (cellule staminali totipotenti) che successivamente portano allo sviluppo di un nuovo individuo. Questa modalità di riproduzione è detta riproduzione asessuata e genera organismi geneticamente identici all organismo genitore (cloni). La riproduzione asessuata è relativamente comune nei vegetali e negli animali strutturalmente più semplici (invertebrati). Ha il vantaggio di essere semplice, quindi favorisce la rapida espansione di una specie in condizioni ambientali favorevoli. Ha lo svantaggio di produrre organismi geneticamente identici, quindi ugualmente vulnerabili rispetto ad agenti patogeni o a condizioni ambientali sfavorevoli. La riproduzione sessuata comporta la formazione di un nuovo organismo a partire dalla fusione (fecondazione) di due cellule specializzate e geneticamente diverse (gameti), prodotte da due individui della stessa specie. Il prodotto della fecondazione è detto zigote ed è la prima cellula del nuovo individuo. Lo zigote, per divisione cellulare, si moltiplica, formando l embrione. Con il procedere dello sviluppo, le cellule si differenziano nei vari tipi e si organizzano in tessuti ed organi sino a formare un individuo adulto. La riproduzione sessuata origina una discendenza varia, avente una combinazione delle caratteristiche genetiche dei genitori. Pertanto, ogni individuo è geneticamente unico. Il DNA nelle cellule eucariotiche Nelle cellule eucariotiche, il DNA è costituito da numerose molecole lineari associate a proteine, il cui numero varia a seconda delle specie. Le molecole di DNA contengono l informazione genetica, in base alla quale la cellula si struttura ed attiva le sue funzioni. Le molecole di DNA, lunghe alcuni cm, sono avvolte attorno a proteine cromosomiche (istoni) per potersi ripiegare ordinatamente all interno del nucleo e per permettere all informazione genetica di esprimersi. L insieme di proteine cromosomiche e DNA prende il nome di cromatina. Durante la divisione cellulare, le molecole di DNA si avvolgono ulteriormente per formare strutture più compatte chiamate cromosomi; ciò ne faciliterà la ripartizione nelle cellule figlie ma l informazione genetica non potrà essere utilizzata. All inizio della divisione cellulare, ogni cromosoma appare duplicato, ovvero costituito da due metà identiche, i cromatidi fratelli, ciascuno costituito da una delle due copie di DNA, ed uniti in un punto detto centromero. Il numero di cromosomi presenti nel nucleo delle cellule dipende dalla specie; nella specie umana ogni cellula contiene 46 cromosomi. Quando la cellula si divide, i cromatidi fratelli di uno stesso cromosoma duplicato si separano l uno dall altro. Ciascun cromatide diviene un cromosoma indipendente e migra in una delle due cellule figlie. Il risultato è che ogni cellula figlia riceve una serie completa e identica di cromosomi.

2 Il ciclo cellulare Il ciclo cellulare è la sequenza di eventi che caratterizzano la vita di una cellula, da quando inizia la sua esistenza a quando si divide. Nelle cellule eucariotiche il ciclo cellulare avviene attraverso due fasi principali: l interfase e la fase mitotica. M G 0 G 2 G 1 S INTERFASE Durante l interfase, il DNA si presenta in forma di cromatina, la cellula svolge le sue normali funzioni metaboliche e si accresce. La fase G 1 (gap 1) è un primo periodo di attività. Segue la fase S (sintesi del DNA) durante la quale i cromosomi si duplicano formando una copia di ogni molecola di DNA. Nella fase G 2 (gap 2) la cellula prosegue le sue normali attività. FASE MITOTICA Durante la fase mitotica (M) la cellula si divide riproducendosi. La fase mitotica si compone di due processi: la mitosi e la citodieresi. Durante la mitosi avviene la separazione delle due copie identiche di ciascun cromosoma (i cromatidi fratelli). Durante la citodieresi, si divide anche il citoplasma della cellula. Al termine si avranno due cellule figlie geneticamente identiche. DIFFERENZIAMENTO Alcune cellule escono dal ciclo cellulare e permangono per tutta la loro vita nella fase G 0 (senza duplicazione del DNA). Esse si differenziano per assumere specifiche funzioni e perdono la capacità di dividersi. La loro vita potrà essere più o meno lunga a seconda del tipo cellulare. Solo le cellule indifferenziate (cellule staminali) riprenderanno il ciclo cellulare dividendosi. La mitosi Con il termine mitosi si indica la separazione del nucleo delle cellule eucariote in due nuclei geneticamente identici. La separazione del citoplasma, che completa la divisione cellulare, è detta citodieresi. Per comodità di descrizione, la mitosi viene suddivisa in una sequenza di quattro fasi: PROFASE, METAFASE, ANAFASE, TELOFASE.

3 PROFASE iniziale le fibre del citoscheletro si riorganizzano per formare il fuso mitotico i cromosomi iniziano a compattarsi scompare il nucleolo PROFASE intermedia i cromosomi appaiono ben distinti la membrana nucleare si disgrega le estremità del fuso migrano verso poli opposti PROFASE avanzata si completa la formazione del fuso mitotico i cromosomi si legano attraverso il centromero alle fibre del fuso METAFASE i cromosomi si allineano sul piano equatoriale ANAFASE i cromatidi fratelli si separano migrando verso i poli opposti TELOFASE e CITODIERESI si ricostituiscono i nuclei si disgrega il fuso mitotico i cromosomi si allungano si divide il citoplasma (citodieresi) La citodieresi Nelle cellule animali, la separazione del citoplasma avviene mediante la formazione di una strozzatura mediana (solco di divisione) che si approfondisce progressivamente dividendo le due cellule dall esterno. Gli organuli citoplasmatici si ripartiscono a caso tra le due cellule figlie. Nelle cellule vegetali, la presenza della parete cellulare impedisce la formazione del solco di divisione.

4 Quindi, la divisione del citoplasma avviene mediante la formazione di una piastra cellulare, costituita da strati di membrana e di parete cellulare, che si accresce dall interno verso l esterno sino a separare completamente le due cellule. Riproduzione sessuata e cromosomi La riproduzione sessuale, dipende dalla ricombinazione del materiale genetico di due genitori. All atto della fecondazione, una serie di cromosomi materni si combina con un analoga serie di cromosomi paterni. Il numero risultante di cromosomi e la loro tipologia, variano da specie a specie. Si definisce cariotipo l insieme dei cromosomi di un individuo ordinati in base alla forma e alle dimensioni. In tutte le cellule del corpo, tranne i gameti, i cromosomi si presentano a due a due identici per forma e dimensione (cromosomi omologhi). Fa eccezione una coppia di cromosomi (cromosomi sessuali) che nel maschio si presentano in due forme diverse, indicate con X e Y, mentre nella femmina sono ancora omologhi e di tipo X. Queste differenze nei cromosomi sessuali, vi sono in quasi tutte le specie animali. I cromosomi omologhi Su ciascun cromosoma sono posizionati migliaia di geni, ovvero porzioni di DNA che recano l informazione per uno specifico carattere. Ogni gene è posizionato su un determinato cromosoma ed è collocato in una particolare posizione. I geni dei due cromatidi fratelli sono identici perché sono copie della stessa molecola di DNA. Nelle coppie di omologhi, vi sono gli stessi geni, collocati nelle stesse posizioni, ma tali geni possono avere una informazione genetica che controlla il carattere in modo diverso. Infatti, di ogni coppia di omologhi, uno è di derivazione materna e l altro è di derivazione paterna. A: gene per il colore marrone degli occhi A A a a a: gene per il colore azzurro degli occhi B: gene per il fattore Rh positivo B B b b b: gene per il fattore Rh negativo C: gene per la forma sottile delle labbra C: gene per la forma sottile delle labbra C C C C d: gene per la forma liscia dei capelli d d d d d: gene per la forma liscia dei capelli e: gene per il lobo dell orecchio attaccato e e E E E: gene per il lobo dell orecchio staccato Il ciclo vitale I gameti hanno una serie completa di cromosomi, il cui numero, tipico della specie, è definito aploide (n). Durante la fecondazione, i gameti si fondono; pertanto, lo zigote e tutte le cellule che da esso si formeranno per mitosi, avranno due serie complete di cromosomi (una materna ed una paterna), e saranno definiti diploidi (2n). La meiosi è il processo di divisione cellulare che permette di produrre gameti aploidi a partire da una cellula germinale diploide.

5 meiosi individuo adulto diploide (2n) differenziazione e sviluppo spermatozoo aploide (n) mitosi embrione diploide (2n) cellula uovo aploide (n) fecondazione zigote diploide (2n) La meiosi La meiosi è un processo che si verifica in speciali organi chiamati gonadi (ovaie nelle femmine e testicoli nei maschi) e che permette di formare gameti aploidi (n) a partire da una cellula germinale diploide (2n). Per ottenere tale risultato, è necessario che si verifichino due successive divisioni cellulari: Meiosi I: si separano le coppie omologhi e la coppia di cromosomi sessuali, producendo due cellule aploidi. Meiosi II: si separano i cromatidi di ciascun cromosoma duplicato, producendo quattro cellule aploidi. cellula germinale diploide (2n) MEIOSI I cellule germinali aploidi (n) MEIOSI II Gameti aploidi (n)

6 Meiosi I In profase I i cromosomi omologhi si appaiano per poi separarsi in anafase I. Ciò consente di ottenere due cellule figlie aploidi e con cromosomi già duplicati. Interfase Profase I iniziale i cromosomi omologhi si condensano e si appaiano Profase I intermedia i cromosomi omologhi si scambiano segmenti corrispondenti (crossing-over) Profase I avanzata il nucleo si disgrega e le coppie di omologhi si legano alle fibre del fuso Metafase I le coppie di omologhi migrano all equatore della cellula Anafase I i cromosomi omologhi si separano Telofase I si riformano i nuclei e si ha la citodieresi; ciascun nucleo conterrà un numero aploide di cromosomi già duplicati Meiosi II La meiosi II avviene come una normale mitosi, ma con una sostanziale differenza: i cromatidi di ciascun cromosoma non sono più identici a causa dello scambio tra omologhi avvenuto in profase I. Ne consegue che si otterranno quattro cellule geneticamente diverse. Profase II Metafase II Anafase II Telofase II

7 Mitosi e meiosi a confronto LA MITOSI: una sola divisione nucleare le cellule figlie hanno lo stesso numero di cromosomi della cellula madre le cellule figlie sono geneticamente identiche tra di loro nei pluricellulari consente la crescita dell individuo, il ricambio cellulare e la riparazione di tessuti o organi lesionati LA MEIOSI: due divisioni nucleari le cellule figlie hanno la metà dei cromosomi della cellula madre le cellule figlie sono geneticamente diverse tra di loro consente la formazione dei gameti e quindi permette la riproduzione sessuale dell individuo Formazione dei gameti La meiosi avviene con le stesse modalità sia nel maschio che nella femmina, ma la citodieresi avviene in modo diverso. Nel maschio la meiosi produce quattro cellule aploidi che matureranno in altrettanti spermatozoi (spermatogenesi). La spermatogenesi è un processo continuo. Nella femmina, ad ogni divisione meiotica, il citoplasma resta quasi totalmente ad una delle due cellule; solo la cellula più ricca di citoplasma e di sostanze di riserva maturerà in una cellula uovo (ovogenesi) mentre le altre tre cellule (globuli polari) moriranno. L ovogenesi avviene meno frequentemente della spermatogenesi (circa ogni 28 giorni nella donna). L eredità del sesso Poiché i gameti sono cellule aploidi, nel caso della specie umana, nelle cellule uovo saranno presenti 22 cromosomi più un cromosoma sessuale di tipo X; negli spermatozoi saranno presenti 22 cromosomi più un cromosoma sessuale di tipo X o di tipo Y. Al momento della fecondazione, se lo spermatozoo contiene il cromosoma X, si formerà un individuo femmina; se invece lo spermatozoo contiene il cromosoma Y, si formerà un individuo maschio. Le probabilità di generare un maschio o una femmina, sono rispettivamente del 50% XX meiosi 22+X 44+XX 22+X meiosi 44 + XY 22+X 22+Y 44+XX 44+XY 44+XY

8 Diversità genetica dei gameti La diversità genetica dei gameti si deve a due fattori coinvolti nella meiosi: ASSORTIMENTO INDIPENDENTE DEI CROMOSOMI OMOLOGHI Comporta un numero di possibili combinazioni pari a 2 n. RICOMBINAZIONE TRA CROMOSOMOSOMI OMOLOGHI (crossing over) Comporta la formazione di cromosomi misti (materno-paterno) ed il un numero di possibili combinazioni è praticamente illimitato. Assortimento indipendente Ciascuna cellula figlia potrà avere un numero di cromosomi materni variabile tra 0 ed n ed un numero di cromosomi paterni ad esso complementare. Per n=2: numero di combinazioni = 2 n = 2 2 = 4 Per n=23: numero di combinazioni = 2 n = 2 23 = meiosi cellula germinale diploide Gameti aploidi Ricombinazione tra omologhi (crossing over) Le coppie di omologhi sono formate da un cromosoma materno ed un cromosoma paterno con la stessa sequenza di geni ma con informazione genetica diversa. Durante la profase I, gli omologhi si appaiano unendosi in punti corrispondenti dei cromatidi. Dopo lo scambio di segmenti omologhi (crossing over), i cromatidi coinvolti non sono più interamente materni o paterni, ma presentano una combinazione diversa di geni materni e paterni. La diversità genetica degli organismi La fecondazione riunisce gameti sempre diversi determinando l unicità genetica di ogni organismo. La diversità genetica tra gli individui della stessa specie, non garantisce la sopravvivenza del singolo, ma conferisce alla specie maggiori possibilità di sopravvivere alle mutazioni ambientali. Inoltre, la diversità genetica pone le basi per l evoluzione delle specie.

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla


La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule


Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con


Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,


La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,


La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte


Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche


La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione



LA MEIOSI E LA RIPRODUZIONE LA MEIOSI E LA RIPRODUZIONE Gli organismi eucarioti si riproducono asessualmente o sessualmente. Nella riproduzione asessuata (o agamica o vegetativa), un singolo individuo si riproduce mediante mitosi


La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland


unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie


Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA


1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili


Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che


La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare


Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano


Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.


La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il


La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula


La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare


Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e


La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo


La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione


Corso integrato di Biologia e Genetica

Corso integrato di Biologia e Genetica Corso integrato di Biologia e Genetica Coordinatore: Prof.ssa Giovanna Bianchi Scarrà Genetica Generale e Molecolare (testo: vedi Biologia) Genetica Medica (testo: Genetica Medica Essenziale, Dalla Piccola,


La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi


Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione


La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata.

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata. La riproduzione La riproduzione La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. Riguarda tutti gli esseri viventi, può essere Riguarda tutti gli esseri viventi,



VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano


Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di


Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,


L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi


Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.



OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata


Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo


Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando


TEST BIOLOGIA 1 ANNO ABEI Da inviare a entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi


Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT






CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa


Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23


Seminario di BIOLOGIA APPLICATA Zannotti maria

Seminario di BIOLOGIA APPLICATA Zannotti maria Seminario di BIOLOGIA APPLICATA Zannotti maria Testi Quelli dello scorso anno Programma 1 LA RIPRODUZIONE DEI VIVENTI Cellule (mitosi) Organismi (meiosi) Gametogenesi fecondazione: barbieri carinci. Cap


Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi


IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare


VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23








SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE


VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la


Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione


Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio


Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti


Cellule e DNA. Per saperne di più. Nella terra e nello spazio

Cellule e DNA. Per saperne di più. Nella terra e nello spazio Nella terra e nello spazio ellule e DN utti i viventi sono fatti di cellule. Nelle cellule ci sono dei corpuscoli che hanno compiti diversi: nutrire la cellula, farla respirare, trasmettere informazioni,


MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA


Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.



GENI, GENOMI E CROMOSOMI GENI, GENOMI E CROMOSOMI GENOMA E il DNA che contiene l intera informazione genetica di un organismo Le dimensioni e la sequenza nucleotidica del genoma sono tipiche di ciascuna


Prove associate al percorso UGUALI EPPUR DIVERSI

Prove associate al percorso UGUALI EPPUR DIVERSI Titolo: Prove associate al percorso UGUALI EPPUR DIVERSI Autore: Laura Cassata Percorsi didattici associati: A- Uguali eppur diversi AVVERTENZA: Le domande che seguono si ispirano al percorso o ai percorsi





LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione.

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. Gregor Jhoann Mendel (1822-1884) Mendel viveva nel monastero di Brum, a Brno in Repubblica Ceca, studiò


La riproduzione e lo sviluppo

La riproduzione e lo sviluppo La riproduzione e lo sviluppo La riproduzione umana In biologia si definisce riproduzione il processo attraverso il quale vengono generati nuovi individui della stessa specie. La riproduzione umana è caratterizzata


La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula


La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo


LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione



SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione



PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice


Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente



27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori


Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami


Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,


Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia



TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE Tutti i tipi cellulari presenti sul nostro pianeta appartengono ad uno di due gruppi fondamentali: procarioti ed eucarioti. I termini procariota (dal greco pro


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati


Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente


CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine.

CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. CAP.8 Concetti relativi a riproduzione ed ereditarietà; DNA e geni, codice genetico, duplicazione del DNA, sintesi delle proteine. 8.1 LA RIPRODUZIONE La riproduzione è il processo con cui la specie si





Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo


Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE


Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva


LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi Vie genitali maschili e ghiandole accessorie FECONDAZIONE


CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti.

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. 5.1 La divisione cellulare La divisione cellulare è il processo in seguito al quale una cellula si divide in due cellule figlie; generalmente


- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione


Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)


Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente


GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà GENETICA... lessico Genetica: studio dei geni e dell'ereditarietà Geni: porzioni di DNA contenenti un'informazione che permette di decodificare una certa proteina. Es: gene che determina il colore dei


La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per






MITOSI 09/11/16 CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C 4C MITOSI CELLULA MADRE E CELLULE FIGLIE SONO DIPLOIDI 2C (il valore C indica la quantità di DNA contenuto delle cellule, dove C è il contenuto aploide della specie). Dopo la replicazione C è raddoppiato



LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.


I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni


Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC Genetica umana Ramón Lucas Lucas, LC P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:


Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del


Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento


La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti


La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo
