MITOSI. Fasi della mitosi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "MITOSI. Fasi della mitosi"


1 MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla cellula madre. La mitosi è preceduta dalla interfase durante la quale si ha la duplicazione del DNA e dei cromosomi che da 2n divengono quindi 4n. La duplicazione avviene a metà dell'interfase, nel corso della cosiddetta fase S. La fase S è preceduta dalla fase G 1, in cui la cellula si accresce e si prepara alla sintesi del DNA, ed è seguita dalla fase G 2, durante la quale la cellula continua ad accrescersi e si prepara ad entrare in mitosi. L'insieme dei fenomeni che avvengono durante la divisione cellulare prende il nome di ciclo cellulare. Esso dura dalle 10 alle 24 ore circa a seconda degli organismi. Fasi della mitosi

2 Il processo di mitosi consiste nella suddivisione di una cellula in due cellule figlie geneticamente e morfologicamente identiche tra loro e alla cellula originaria. Nel corso del ciclo cellulare, la mitosi si alterna all'interfase, periodo in cui la cellula compie le reazioni metaboliche che ne permettono il mantenimento; avviene successivamente allo stadio S (in cui si verifica la duplicazione del DNA). L'immagine schematizza le 4 fasi della divisione cellulare; è di facile intuizione la forte somiglianza tra lo schema della metafase e l'immagine rappresentata in foto, dove appare una cellula durante la divisione cellulare.

3 Allo stadio S seguono le quattro fasi tipiche della mitosi. Occorre precisare che nelle alghe e nei funghi non si verifica la disgregazione della membrana nucleare che, invece, si riscontra nelle piante e negli animali; nel primo caso si parla di "mitosi chiusa", nel secondo di "mitosi aperta". PROFASE : I filamenti di DNA si organizzano in strutture dall aspetto di bastoncelli, i cromosomi. Ogni cromosoma possiede una strozzatura, che viene detta centromero. La duplicazione del DNA è già avvenuta. Nella tarda profase (prometafase) il nucleolo scompare. METAFASE : La membrana nucleare gradualmente scompare e i cromosomi restano liberi nel citoplasma, mentre i centrioli si sdoppiano e migrano in direzione opposta, formando un fascio di fibre che assume la forma di un "fuso", il cosiddetto fuso mitotico. Le coppie di cromatidi si muovono su un piano immaginario che taglia a metà la cellula detto piano equatoriale. In questa fase i cromosomi raggiungono il massimo grado di visibilità al microscopio, a causa della loro forte spiralizzazione. Ciò ne facilita l'osservazione. ANAFASE : Nell anafase i due cromatidi di ciascun cromosoma si separano e si spostano uno verso un polo della cellula e l altro verso il polo opposto. In questo modo ciascuna metà cellula riceve un uguale numero di cromatidi. TELOFASE : Ciascun gruppo di cromatidi viene circondato da una nuova membrana nucleare, quindi i cromatidi cominciano a decondensarsi e a formare i due nuclei figli. In ciascuna cellula figlia compare anche il nucleolo. Alla fine di questa fase ciascuna cellula figlia avrà una copia di ciascun cromosoma e, quindi, un patrimonio cromosomico completo. Alla fine del ciclo cellulare si ha la separazione delle cellule figlie per mezzo del processo chiamato citodieresi. In genere, questo stadio segue le quattro fasi della mitosi; se essa non avviene, dopo successive mitosi si forma una cellula plurinucleata. Nelle cellule animali la separazione avviene per strozzatura delle cellule madri; nelle piante, mediante frapposizione di un setto di separazione. Mitosi come modalità di riproduzione Una volta raggiunta una dimensione opportuna, ogni batterio si divide in due cellule identiche, di massa pari a circa la metà di quella originaria. A loro volta, le due cellule figlie si accrescono fino a dividersi ulteriormente. Un batterio si può riprodurre ogni venti minuti circa, proliferando in colonie abbastanza grandi da essere visibili a occhio nudo. In molti organismi pluricellulari e negli unicellulari, la mitosi rappresenta anche una strategia riproduttiva. Infatti, sistemi di riproduzione asessuata, come la scissione, operata da molti microrganismi, la gemmazione (o divisione ineguale), presente in protozoi che vivono fissi al substrato (come molti peritrichi e suttori, appartenenti ai ciliati), la strobilazione delle meduse, la rigenerazione, si basano su processi mitotici. Per mitosi si formano anche particolari tipi di spore, dette mitospore, cioè cellule che rappresentano forme di resistenza della specie, dalle quali può svilupparsi un nuovo individuo solo quando le condizioni ambientali sono favorevoli.

4 MEIOSI La meiosi è un processo caratteristico delle cellule eucariote, essa riguarda unicamente la produzione delle cellule sessuali o gameti degli organismi pluricellulari. Con la meiosi, attraverso un processo piuttosto complesso, una singola cellula diploide, dopo aver replicato una sola volta il suo DNA, da origine a quattro cellule figlie, i gameti appunto, dotate di un patrimonio dimezzato di cromosomi e dette perciò aploidi. La meiosi si differenzia dall'altro processo di divisione cellulare, la mitosi, nella quale si formano due cellule figlie aventi lo stesso patrimonio genetico della cellula madre. Spermatogenesi e ovogenesi La produzione dei gameti avviene, nelle specie con riproduzione sessuale, attraverso un processo detto gametogenesi. Si parla più propriamente di spermatogenesi e di ovogenesi per indicare il processo di formazione degli spermatozoi e delle cellule uovo. Mediante la meiosi si ottengono, a partire da una cellula madre (spermatogonio e oogonio) diploide, quattro cellule aploidi. In realtà, mentre nel maschio si formano quattro spermatociti, nella femmina si ottiene un ovocita e tre globuli polari, destinati a degenerare. Spermatociti e ovociti, quindi, subiscono un processo di maturazione che rende queste cellule atte a svolgere la propria funzione riproduttiva. Fasi della meiosi

5 La meiosi avviene secondo due fasi principali, dette rispettivamente prima e seconda divisione meiotica, o meiosi I e meiosi II. PRIMA DIVISIONE MEIOTICA In sintesi, nella prima divisione meiotica si evidenziano i cromosomi, ciascuno costituito da due cromatidi. Questi cromosomi (metà di origine paterna e metà di origine materna), dopo aver subito alcuni processi durante la profase (in particolare il crossing-over, di cui parleremo successivamente), si portano al piano equatoriale della cellula. Qui, senza dividersi nei due cromatidi, si attaccano alle fibre del fuso per migrare verso i due poli in modo tale che, di ogni coppia di cromosomi omologhi, una si dirige verso un polo e l'altra al polo opposto. A conclusione della prima divisione meiotica, si hanno così due cellule, ciascuna con la metà esatta dei cromosomi omologhi. PROFASE I : La cromatina visibile nel nucleo cellulare, che rappresenta la massa del DNA quando la cellula svolge le sue normali attività metaboliche, si condensa, in modo che si formano strutture bastoncellari, i cromosomi. Ciascun cromosoma appare a forma di X, poiché è formato da due cromatidi fratelli, uniti in un punto detto centromero. I cromatidi derivano da un processo di duplicazione del DNA; pertanto, ciascuno è geneticamente identico all altro. In questa fase, una volta che i due cromosomi omologhi sono uniti tra di loro, possono avvenire scambi incrociati di parti più o meno lunghe di cromatidi omologhi (fenomeno di crossing-over). La membrana che avvolge il nucleo si disgrega. Si forma un fascio di microtubuli proteici, che si estende da un polo all altro della cellula e le cui due estremità fanno capo a due coppie di organuli, detti centrioli.

6 METAFASE I : Le tetradi omologhe si dispongono simmetricamente lundo una linea immaginaria, trasversale rispetto al fuso. In tal modo, ognuna è rivolta verso uno dei due poli della cellula. ANAFASE I : Le fibre del fuso prendono contatto con i centromeri; ciascuna tetrade migra verso un polo della cellula. TELOFASE I : Ai due poli della cellula madre si formano due agglomerati di cromosomi aploidi, in cui è presente un solo cromosoma per ciascun tipo. I cromosomi sono ancora allo stadio della tetrade. Il citoplasma delle due cellule si ripartisce e avviene la citodieresi, ossia la vera e propria divisione della cellula originaria in due cellule figlie distinte (in alcuni casi, la ripartizione può essere incompleta). Le fibre del fuso si disgregano; i cromosomi si despiralizzano. SECONDA DIVISIONE MEIOTICA La seconda divisione meiotica non è preceduta da alcuna duplicazione del DNA. I cromosomi, costituiti da due cromatidi, si portano all'equatore e si attaccano alle fibre del fuso; i due cromatidi di ciascun cromosoma si separano migrando ai poli. Si formano così quattro cellule, ciascuna con un corredo aploide di cromosomi e con un diverso assortimento dei cromosomi di origine materna e paterna. Durante questa separazione vi è una distribuzione indipendente dei cromosomi paterni e materni per cui, alla fine, vi sarà un diverso assortimento dei cromosomi nelle quattro cellule figlie. PROFASE II : La cromatina si condensa nuovamente, in modo che si possono osservare i cromosomi, formati da due cromatidi uniti dal centromero. Si forma nuovamente il fuso di microtubuli. METAFASE II : I cromosomi si dispongono su una linea equatoriale, trasversale rispetto alle fibre del fuso, in modo che ciascun cromatidio sia rivolto verso uno dei due poli della cellula. I centromeri prendono contatto con le fibre. ANAFASE II : I cromatidi migrano ciascuno verso un polo della cellula, spostandosi verso le fibre del fuso. In tal modo, ciascun cromatidio diviene un nuovo cromosoma. TELOFASE II : Ai poli della cellula, si formano due aggregati di cromosomi, le fibre del fuso si disgregano, i cromosomi cominciano a decondensarsi, e si forma infine una membrana nucleare. Il citoplasma della cellula si divide in due, cosi da portare alla formazione di due cellule figlie aploidi.


8 Da un punto di vista genetico, la meiosi assume una grande importanza perché rappresenta il modo in cui possono formarsi nuove combinazioni di geni e, quindi, rende possibile la variabilità genetica tra individui della stessa specie. Infatti, già con il crossing-over, ovvero con lo scambio di porzioni di DNA tra cromatidi di due cromosomi omologhi, al momento della profase I, avviene una prima

9 modificazione dell assortimento di geni rispetto a quello della cellula madre. Inoltre, occorre considerare che la divisione dei due cromosomi omologhi durante la fase di anafase I avviene in modo casuale: ciò significa che non è prestabilito il polo della cellula verso cui migrerà ciascun cromosoma. Dunque, a partire da una cellula madre, si formano con la prima divisione meiotica due cellule aploidi che sono geneticamente differenti tra loro e diverse da qualsiasi altra coppia di cellule che derivano dalla stessa cellula madre. La variabilità genetica, assicurata anche dai meccanismi di mutazione spontanea, assume un ruolo essenziale nei processi evolutivi, sottoposti al vaglio della selezione naturale. CONFRONTO TRA MITOSI E MEIOSI

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.


La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.


Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,


La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule


La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte



LA MEIOSI E LA RIPRODUZIONE LA MEIOSI E LA RIPRODUZIONE Gli organismi eucarioti si riproducono asessualmente o sessualmente. Nella riproduzione asessuata (o agamica o vegetativa), un singolo individuo si riproduce mediante mitosi


11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,


Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche


La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare


unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie


La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare


Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI

Corso di Genetica. Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Corso di Genetica Docente: Prof. Alberto Pallavicini MITOSI E MEIOSI Il materiale genetico deve essere trasmesso di generazione in generazione in modo pressoché perfetto. Analizziamo


La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione


La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland


Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e


Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.


Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.


1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili


Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che


Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano


Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA


La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula





Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi


La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione


IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare


Seminario di BIOLOGIA APPLICATA Zannotti maria

Seminario di BIOLOGIA APPLICATA Zannotti maria Seminario di BIOLOGIA APPLICATA Zannotti maria Testi Quelli dello scorso anno Programma 1 LA RIPRODUZIONE DEI VIVENTI Cellule (mitosi) Organismi (meiosi) Gametogenesi fecondazione: barbieri carinci. Cap


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23


Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di


La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo






CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa


MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA


SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE


La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il


Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente


La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi


L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi


Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione



TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE Tutti i tipi cellulari presenti sul nostro pianeta appartengono ad uno di due gruppi fondamentali: procarioti ed eucarioti. I termini procariota (dal greco pro


Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori


CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti.

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. 5.1 La divisione cellulare La divisione cellulare è il processo in seguito al quale una cellula si divide in due cellule figlie; generalmente


Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva


Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti


Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio


Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,


Trasmissione della informazione: livello cellulare

Trasmissione della informazione: livello cellulare Trasmissione della informazione: livello cellulare Prof.ssa Flavia Frabetti aa.2010-11 ACCRESCIMENTO E DIVISIONE DIVISIONE CELLULARE CRESCITA CELLULARE E DUPLICAZIONE DEI CROMOSOMI SEGREGAZIONE DEI CROMOSOMI


Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando


Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia



VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano



PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice


- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione


VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione



MOLTIPLICAZIONE CELLULARE MOLTIPLICAZIONE CELLULARE by Alfio Francesco e Maria Cannone La moltiplicazione cellulare è il processo attraverso il quale piante e animali generano nuove cellule o individui e rappresenta una delle funzioni


Prove associate al percorso UGUALI EPPUR DIVERSI

Prove associate al percorso UGUALI EPPUR DIVERSI Titolo: Prove associate al percorso UGUALI EPPUR DIVERSI Autore: Laura Cassata Percorsi didattici associati: A- Uguali eppur diversi AVVERTENZA: Le domande che seguono si ispirano al percorso o ai percorsi






27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di


LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi Vie genitali maschili e ghiandole accessorie FECONDAZIONE


La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula


Ciclo Cellulare 18/01/2015

Ciclo Cellulare 18/01/2015 Ciclo Cellulare Biotecnologie prophase,_metaphase,_anaphase,_telophase%29.jpg


Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente


Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di


Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione



OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata



SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione



LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I LA MEIOSI Una coppia di cromosomi omologhi, presenti nel nucleo di una cellula diploide, è costituita da un primo cromosoma isolato di derivazione paterna e da un secondo cromosoma isolato di derivazione


TEST BIOLOGIA 1 ANNO ABEI Da inviare a entro e non oltre il 6 novembre 2015

TEST BIOLOGIA 1 ANNO ABEI Da inviare a entro e non oltre il 6 novembre 2015 1) I batteri sono organismi: a- bicellulari b- monocellulari c- pluricellulari 2) I virus: a- possono riprodursi solo nell acqua b- possono riprodursi solo sulla superficie di una cellula c- possono riprodursi


La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati


MERISTEMI APICALI. Apice del germoglio. Apice radicale

MERISTEMI APICALI. Apice del germoglio. Apice radicale MERISTEMI APICALI Apice del germoglio Apice radicale CICLO CELLULARE CHECK POINT 3 CHECK POINT 2 CHECK POINT 1 Le cellule vegetali differentemente da quelle animali possono abbandonare il ciclo di divisione


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT



Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad


VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la





Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione


Scuola Media Piancavallo 2

Scuola Media Piancavallo 2 LA CELLULA Una caratteristica di quasi tutti gli esseri viventi è quella di possedere una struttura più o meno complessa in cui parti diverse, gli organi, sono adatte a svolgere funzioni specifiche. Il



DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione


Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il


La riproduzione e lo sviluppo

La riproduzione e lo sviluppo La riproduzione e lo sviluppo La riproduzione umana In biologia si definisce riproduzione il processo attraverso il quale vengono generati nuovi individui della stessa specie. La riproduzione umana è caratterizzata


Le basi cellulari della riproduzione e dell ereditarietà

Le basi cellulari della riproduzione e dell ereditarietà Le basi cellulari della riproduzione e dell ereditarietà riproduzione e divisione cellulare Negli organismi in cui avviene la riproduzione asessuata, la progenie è la copia genetica esatta dell unico genitore


Protocollo dei saperi imprescindibili

Protocollo dei saperi imprescindibili Protocollo dei saperi imprescindibili Ordine di scuola:professionale DISCIPLINA: Scienze integrate( Scienze della Terra e Biologia) RESPONSABILE: Meri Teti CLASSI SECONDE SEZIONE B INDIRIZZO: Grafico CONOSCENZE/CONTENUTI:


Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del


Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE


Cap. 12 La cellula. Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5

Cap. 12 La cellula. Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5 ( Cap. 12 La cellula 12.1 Le cellule Con l invenzione del microscopio l uomo ha potuto esplorare il ondo degli organismi molto piccoli il cui studio ha permesso di sviluppare la Teoria Cellulare. Questa


La meiosi

La meiosi La meiosi Suddivisione del patrimonio genetico tra le cellule figlie: confronto tra mitosi e meiosi Nella mitosi, le cellule restano sempre diploidi 1 sola fase S, ma 2 divisioni


Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.


ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI


Il SAC, sistema di controllo nella divisione cellulare

Il SAC, sistema di controllo nella divisione cellulare Il SAC, sistema di controllo nella divisione cellulare IFOM per la scuola Lo Studente Ricercatore 2011 Villani Yuri Liceo Scientifico Tecnologico Chimico-Biologico IIS A. Maserati - Voghera(PV) Gruppo:


Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo


LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione.

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. Gregor Jhoann Mendel (1822-1884) Mendel viveva nel monastero di Brum, a Brno in Repubblica Ceca, studiò



Tel Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni



LA DIVISIONE CELLULARE E LA RIPRODUZIONE 5 LA DIVISIONE CELLULARE E LA RIPRODUZIONE 5.1 La divisione cellulare La divisione cellulare è il processo fondamentale attraverso il quale una cellula termina il suo ciclo vitale e produce due o più nuove


Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)


Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami


La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti



CLASSIFICAZIONE A 6 REGNI organismi eucariotici, unicellulari o pluricellulari, che si nutrono per assorbimento CLASSIFICAZIONE A 6 REGNI Biologia generale 2015 regno Mycota o Fungi Sono organismi eucarioti caratterizzati da :



LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia
