Il SAC, sistema di controllo nella divisione cellulare

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il SAC, sistema di controllo nella divisione cellulare"

Transcript

1 Il SAC, sistema di controllo nella divisione cellulare IFOM per la scuola Lo Studente Ricercatore 2011 Villani Yuri Liceo Scientifico Tecnologico Chimico-Biologico IIS A. Maserati - Voghera(PV) Gruppo: Biologia cellulare computazionale Tutor: Luca Mariani, Elena Chiroli

2 La scelta del lievito per lo studio Perché scegliere il lievito? Sceglierlo ha diversi vantaggi: 1) Ciclo cellulare molto veloce; 2) Facilità di mantenimento; 3) Dimensioni molto ridotte, quindi colture poco ingombranti; 4) Genoma conosciuto; 5) Facilità nel bioingegnerizzarlo; 6) Nessun problema etico. Tratto da:

3 Il ciclo cellulare Tratto da: Il ciclo cellulare comprende tutta la vita di una cellula. Alcuni passaggi sono critici per il successo della divisione. Il primo è la duplicazione del DNA in fase S(ci è utile per le analisi al FACS perché in base alla quantità di DNA capiamo qual è la fase cellulare, il secondo è la connessione microtubulicentromero in fase G2.

4 Un po' di teoria: la mitosi La mitosi è il processo che permette alla cellula singola la divisione in due cellule figlie. È una fase delicata perché qui avviene la separazione dei cromatidi fratelli, con un'alta probabilità di incorrere in errori che potrebbero portare a mutazioni nel corredo genetico. Processo schematizzato della mitosi Tratto e modificato da

5 Prima e dopo il punto critico: Tratto da: metafase e anafase Nella metafase avviene il collegamento tra i microtubuli e i centromeri. Centrosoma In anafase, i centrosomi creano una tensione sui microtubuli che fa separare e migrare nei rispettivi poli i cromatidi fratelli. T Tratto da:www.bassilo.it

6 Cos'è il SAC? Il SAC(Spindle Assembly Checkpoint) è un meccanismo che permette alla cellula di arrestare la divisione prima dell'anafase in caso di anomalie nella struttura del fuso mitotico o, in assenza di errori, fino a che tutti i microtubuli si sono uniti correttamente ai centromeri. Tratto da:

7 Perché avviene l'arresto? L'arresto in metafase avviene nel caso in cui un microtubulo non è correttamente legato al centromero. In mancanza dell'arresto, durante la migrazione dei cromatidi verso i poli, il microtubulo opposto a quello non collegato trainerebbe due cromatidi al posto di uno. Tratto e modificato da:

8 Come avviene l'arresto? La mancata connessione dei microtubuli con i centromeri, induce la formazione di un complesso con Mad2 scatenando una cascata di eventi che portano alla inibizione della separasi e al blocco del fuso mitotico impedendo così la divisione dei cromatidi in modo errato. Tratto da:

9 In laboratorio Ricreare il SAC in laboratorio ci permette di studiarlo. Come attivarlo? 2 metodi principali: Sovraespressione della proteina Mad2 grazie ad una inserzione Gal-Mad2. Distruggendo fisicamente il fuso mitotico con il nocodazolo. Noi utilizzeremo la sovraespressione di Mad2.

10 Inserzione Gal-Mad2 Il gene Gal-Mad2 viene inserito per trasformazione all'interno del corredo genetico del lievito. Permette alla cellula, in presenza di galattosio(gal), una produzione di Mad2 circa 20 volte quella naturale. Si possono fare più inserzioni(gal-mad2 1x, 2x, 3x, cioè 20, 40, 60 volte l'endogeno).

11 Primo passo: la coltura Si prepara una coltura con il ceppo che ci interessa e dopo il rilascio da alpha-factor(un ormone che ci permette di avere le cellule tutte alla stessa fase del ciclo)si tratta con sostanze diverse in base allo studio da fare e si prendono campioni ad intervalli regolari. Cellule ciclanti, prima del trattamento con alpha-factor.

12 Ceppo Gal-Mad2 in galattosio Dopo il rilascio, nella coltura si aggiunge del galattosio. Questo zucchero attiva il promotore Gal-Mad2 che sovraesprime la produzione della proteina Mad2 causando l'arresto. Cellule bloccate in metafase, si può dedurre dalla grandezza delle gemme.

13 Il FACS Il FACS è uno strumento che permette la misurazione della quantità di DNA in una cellula. Come? I campioni prelevati vanno trattati con ioduro propidio che si lega al DNA. Il propidio emana una fluorescenza letta dal FACS. In base alla quantità di fluorescenza rilevata si capisce se la cellula è in fase G1 oppure in fase G2. Se tutte le cellule di un campione sono in fase G2 vuol dire che siamo riusciti a creare un blocco efficace.

14 Leggere i dati del FACS Il FACS invia al computer collegato dei grafici che sta al ricercatore interpretare. N di cellule Quantità di DNA rilevata; fase G1 o fase G2. Se va oltre si è in presenza di cellule lisate, cioè distrutte.

15 Risultati dell'esperimento Nel caso di 3 inserzioni di Gal-Mad2 il blocco dura per oltre 7 ore.

16 In ultimo ma non meno importante Ma alla fine, cosa serve conoscere il SAC alla ricerca sul cancro? Conoscere in modo perfetto il checkpoint, ci farebbe capire come alcune cellule possano proliferare in modo anomalo, quindi cercare soluzioni più mirate in una eventuale nuova terapia.

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare)

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare) Il checkpoint del fuso mitotico (Pietro Perini-gruppo ciclo cellulare) 1) Prima di approfondire la funzione del checkpoint del fuso mitotico, è opportuno ricordare quali sono le caratteristiche e le funzioni

Dettagli

CICLO CELLULARE EUCARIOTICO

CICLO CELLULARE EUCARIOTICO CICLO CELLULARE EUCARIOTICO COMPESSO SISTEMA DI CONTROLLO OMEOSTASI ORGANISMO NORMALE G 0 CANCRO DNA marcato con molecole intercalanti fluorescenti Fluorescence Activated Cell Sorting (FACS) Rilevazione

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Ciclo Cellulare 18/01/2015

Ciclo Cellulare 18/01/2015 Ciclo Cellulare Biotecnologie http://upload.wikimedia.org/wikipedia/commons/e/e3/mitosis_%28261_13%29_pressed%3b_root_meristem_of_onion_%28cells_in_ prophase,_metaphase,_anaphase,_telophase%29.jpg http://270c81.medialib.glogster.com/media/3b/3b966af047cca0605f106aa1a34dd3451287c5e41a0c7ce8ce537f74bbb795eb/main

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

Indice. Introduzione 1

Indice. Introduzione 1 Indice Introduzione 1 1 Segregazione cromosomica 4 1.1 Cicli di divisione cellulare............................ 4 1.1.1 Mitosi................................... 4 1.1.2 Meiosi..................................

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

LA MEIOSI E LA RIPRODUZIONE

LA MEIOSI E LA RIPRODUZIONE LA MEIOSI E LA RIPRODUZIONE Gli organismi eucarioti si riproducono asessualmente o sessualmente. Nella riproduzione asessuata (o agamica o vegetativa), un singolo individuo si riproduce mediante mitosi

Dettagli

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare Riproduzione e ciclo cellulare La capacità di riprodursi è carattere fondamentale dei viventi. Gli organismi unicellulari più semplici (es batteri ma anche eucarioti unicellulari) si riproducono per divisione

Dettagli

L essenziale di biologia molecolare della cellula

L essenziale di biologia molecolare della cellula Bruce ALBERTS et al. L essenziale di biologia molecolare della cellula Seconda edizione Capitolo 7: Dal DNA alle proteine: come la cellula legge il genoma Alberts et al., L ESSENZIALE DI BIOLOGIA MOLECOLARE

Dettagli

L endocitosi dell EGFR

L endocitosi dell EGFR L endocitosi dell EGFR IFOM per la scuola Lo Studente Ricercatore 2011 Muzio Giulia Istituto d Istruzione Superiore Maserati Voghera Gruppo di lavoro: Determinanti della trasformazione neoplastica e della

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Imparare dagli errori: metodi scientifici senza l'utilizzo di animali nella ricerca medica e nelle prove di tossicità. Dott.

Imparare dagli errori: metodi scientifici senza l'utilizzo di animali nella ricerca medica e nelle prove di tossicità. Dott. Imparare dagli errori: metodi scientifici senza l'utilizzo di animali nella ricerca medica e nelle prove di tossicità Dott.ssa Lidia Armati Imparare dai disastri: Talidomide (10000 focomelici), TGN1412,

Dettagli

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula

Dettagli

mammifero onorario Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105

mammifero onorario Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 LIEVITO mammifero onorario Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 Indice 1. Conoscenze preliminari p.3 1.1 Terminologia e concetti di base della genetica

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi

LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi LA FECONDAZIONE Si attua in 4 fasi: 1) Avvicinamento dei gameti 2) Penetrazione delle barriere dell uovo 3) Reazioni dell uovo 4) Unione dei cromosomi Vie genitali maschili e ghiandole accessorie FECONDAZIONE

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

La Cancerogenesi Chimica. Dr. Giuseppe Caruso

La Cancerogenesi Chimica. Dr. Giuseppe Caruso La Cancerogenesi Chimica Dr. Giuseppe Caruso Meccanismi cellulari, molecolari e biochimici che determinano l insorgenza dei tumori nei mammiferi; in particolare quei meccanismi alterati dagli agenti chimici

Dettagli

MFN0366-A1 (I. Perroteau) - Meiosi. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Meiosi. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cellule somatiche Cellule germinali meiosi I mitosi meiosi II 2 Nella meiosi I i cinetocori dei cromatidi fratelli sono dello stesso lato (rotazione di 90 C) e sono agganciati da microtubuli dello stesso

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

TEST Lo Studente Ricercatore edizione 2011

TEST Lo Studente Ricercatore edizione 2011 TEST Lo Studente Ricercatore edizione 2011 1. A chi soffre di colesterolo elevato è sconsigliato mangiare i crostacei, che ne contengono una quantità elevata. Dovrà pertanto eliminare dal suo menù soprattutto

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi Ciclo Cellulare M --> G1--> S --> G2 --> M S, G2 e M hanno durata sempre uguale mentre la fase G1 (in media 10 ore) può subire enormi variazioni da tessuto a tessuto (fino a migliaia di ore per i neuroni).

Dettagli

Biotecnologie e bonifica ambientale

Biotecnologie e bonifica ambientale Biotecnologie e bonifica ambientale Prof. Laura Martinis Liceo Scientifico G. Marinelli Prof. Massimo Vischi e Luca Marchiol - Facoltà di Scienze Agrarie dell Università di Udine Cl. III B Noi studenti

Dettagli

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato

04_12_08. Microscopia confocale. Esempio di analisi con focale: vedi il filmato corrispondente. Vedi filmato Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Microscopia confocale 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - microscopia confocale Esempio di analisi con

Dettagli

MICROBIOLOGIA GENERALE C. Mazzoni 05/18

MICROBIOLOGIA GENERALE C. Mazzoni 05/18 IL LIEVITO La cellula di lievito Caratteristiche generali Fungo unicellulare appartenente alla divisione ascomicete Cresce su substrati semplici Ha un tempo di generazione di circa 2 ore Si possono effettuare

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Trasmissione della informazione: livello cellulare

Trasmissione della informazione: livello cellulare Trasmissione della informazione: livello cellulare Prof.ssa Flavia Frabetti aa.2010-11 ACCRESCIMENTO E DIVISIONE DIVISIONE CELLULARE CRESCITA CELLULARE E DUPLICAZIONE DEI CROMOSOMI SEGREGAZIONE DEI CROMOSOMI

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

Seminario di BIOLOGIA APPLICATA Zannotti maria

Seminario di BIOLOGIA APPLICATA Zannotti maria Seminario di BIOLOGIA APPLICATA Zannotti maria Testi Quelli dello scorso anno Programma 1 LA RIPRODUZIONE DEI VIVENTI Cellule (mitosi) Organismi (meiosi) Gametogenesi fecondazione: barbieri carinci. Cap

Dettagli

Citoscheletro Microtubuli

Citoscheletro Microtubuli PROPRIETA DEI MICROTUBULI, FILAMENTI INTERMEDI E FILAMENTI DI ACTINA Citoscheletro Microtubuli Biotec _ 2011 Da G. Karp, BIOLOGIA CELLULARE E MOLECOLARE, 3a ed, CORRETTA Microtubuli Microfilamenti Filamenti

Dettagli

CLASSE I classico A e B

CLASSE I classico A e B LICEO SCIENTIFICO "A. APROSIO" VENTIMIGLIA CLASSE I classico A e B Anno scolastico 2011-2012 UNITA' DIDATTICA N 1 METODI ED ORGANIZZAZIONE DEI CONCETTI IN BIOLOGIA 1.1 LE CARATTERISTICHE COMUNI A TUTTI

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

Le mutazioni Quando le informazioni sono errate

Le mutazioni Quando le informazioni sono errate Le mutazioni Quando le informazioni sono errate Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Storia delle mutazioni Dal 1927 viene usato il concetto di mutazione così come è inteso oggi Il primo

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Screening Preimpianto delle alterazioni cromosomiche numeriche mediante array-cgh La sottoscritta (partner femmile).. Data

Dettagli

Università degli Studi di Roma Sapienza LE CHINASI AURORA COME TARGET TERAPEUTICO NEI CARCINOMI TIROIDEI

Università degli Studi di Roma Sapienza LE CHINASI AURORA COME TARGET TERAPEUTICO NEI CARCINOMI TIROIDEI Università degli Studi di Roma Sapienza LE CHINASI AURORA COME TARGET TERAPEUTICO NEI CARCINOMI TIROIDEI Relatore Prof. Massimino D Armiento Dip. di Medicina Sperimentale Coordinatore Prof. Andrea Lenzi

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

UNA RISORSA PER LA RICERCA SCIENTIFICA E PER LA SALUTE DELLA COMUNITA

UNA RISORSA PER LA RICERCA SCIENTIFICA E PER LA SALUTE DELLA COMUNITA UNA RISORSA PER LA RICERCA SCIENTIFICA E PER LA SALUTE DELLA COMUNITA Progetto realizzato con il contributo di Cos è Trentino Biobank? Trentino Biobank è una struttura della Azienda Provinciale per i Servizi

Dettagli

Rai e migrazione delle NSCs

Rai e migrazione delle NSCs Rai e migrazione delle NSCs IFOM per la scuola Lo Studente Ricercatore 2009 Lucrezia Bertino Liceo scientifico E. Amaldi Biology and signal trasduction of normal and cancer neural stem cells Daniela Osti

Dettagli

COLTURE DI CELLULE LEUCEMICHE ESPOSTE A CAMPI ELETTROMAGNETICI, VALUTAZIONE DEGLI INDICI DI PROLIFERAZIONE E DEI PROFILI DI ESPRESSIONE GENICA

COLTURE DI CELLULE LEUCEMICHE ESPOSTE A CAMPI ELETTROMAGNETICI, VALUTAZIONE DEGLI INDICI DI PROLIFERAZIONE E DEI PROFILI DI ESPRESSIONE GENICA PROGETTO ISPESL/CNR: COLTURE DI CELLULE LEUCEMICHE ESPOSTE A CAMPI ELETTROMAGNETICI, VALUTAZIONE DEGLI INDICI DI PROLIFERAZIONE E DEI PROFILI DI ESPRESSIONE GENICA - INTRODUZIONE 2 - MATERIALI E METODI:..

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Ruolo della biologia molecolare nel carcinoma ovarico

Ruolo della biologia molecolare nel carcinoma ovarico Carcinoma ovarico avanzato: quali novità per il 2015? Ruolo della biologia molecolare nel carcinoma ovarico Anna Pesci Ospedale SC Don Calabria, Negrar anna.pesci@sacrocuore.it TIPO I TIPO II Basso stadio

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Tumore (gonfiore) o neoplasia (nuova crescita):

Tumore (gonfiore) o neoplasia (nuova crescita): Tumore (gonfiore) o neoplasia (nuova crescita): *popolazione cellulare di nuova formazione che ha preso origine quasi sempre da una sola cellula somatica dell organismo, colpita da una serie sequenziale

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY Laboratorio di Citogenetica Laboratorio di Biologia Molecolare LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY MODENA, 09 MARZO 2013 Dott.ssa Patrizia Caggiati

Dettagli

Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5

Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5 Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5 Colture cellulari Un organismo è un sistema molto complesso, costituito da organi, che a loro volta sono costituiti da diversi

Dettagli

La biostimolazione, alcuni passaggi obbligati. Durante l invecchiamento

La biostimolazione, alcuni passaggi obbligati. Durante l invecchiamento La biostimolazione, alcuni passaggi obbligati Durante l invecchiamento L invecchiamento è l incapacità di organi, tessuti, cellule e molecole a mantenere la propria integrità funzionale e strutturale perturbata

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione MUTAZIONI SPONTANEE MUTAZIONI INDOTTE Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione Tasso di mutazione: probabilità che una mutazione si verifichi nel tempo.

Dettagli

Corso Estivo 2015 Settima edizione

Corso Estivo 2015 Settima edizione Corso Estivo 2015 Settima edizione La Fondazione Golinelli propone per il settimo anno consecutivo la scuola estiva sulle scienze della vita, organizzata nell ambito dell area progettuale Scienze in pratica

Dettagli

Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario

Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Istituto di Biologia e Biotecnologia Agraria (IBBA) Tuesday, October

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

ID55/2005 PROGETTO R&S Lo sviluppo di nuovi inibitori delle istone deacetilasi per un approccio epigenetico alla terapia dei tumori.

ID55/2005 PROGETTO R&S Lo sviluppo di nuovi inibitori delle istone deacetilasi per un approccio epigenetico alla terapia dei tumori. SCHEDE TECNICHE INTERVENTI CONCLUSI ATI CONGENIA - CONGENIA Srl Milano - DAC Srl Milano - NIKEM RESEARCH Srl Bollate MI - ISTITUTO EUROPEO DI ONCOLOGIA Milano - ISTITUTO FIRC DI ONCOLOGIA MOLECOLARE Milano

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria

Dettagli

Diversità nel ciclo cellulare tra cellule dell organismo adulto e cellule embrionali

Diversità nel ciclo cellulare tra cellule dell organismo adulto e cellule embrionali Diversità nel ciclo cellulare tra cellule dell organismo adulto e cellule embrionali La durata del ciclo varia molto, nelle cellule embrionali le fasi G1 e G2 sono quasi inesistenti La durata della fase

Dettagli

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione MUTAZIONI SPONTANEE MUTAZIONI INDOTTE Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione Tasso di mutazione: probabilità che una mutazione si verifichi nel tempo.

Dettagli

Il termine deriva dal greco antico κλών(klōn, ramo", "ramoscello"), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o

Il termine deriva dal greco antico κλών(klōn, ramo, ramoscello), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o Il termine deriva dal greco antico κλών(klōn, ramo", "ramoscello"), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o artificiale, di un intero organismo vivente o anche di una

Dettagli

La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo

Dettagli

FARMACOLOGIA Oncologica. www.baveno.net by G.B.

FARMACOLOGIA Oncologica. www.baveno.net by G.B. Oncologica www.baveno.net by G.B. Agg: settembre 2015 AVVERTENZE 2 I contenuti della presentazione sono estrapolati da materiale esistente, redatti e verificati da personale sanitario Le informazioni fornite

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

Visione della superficie dorsale

Visione della superficie dorsale mappe gastrulazione presuntive Tracciare linee di discendenza cellulare. Mappare la struttura larvale o adulta sulla regione dell embrione dalla quale tale struttura deriverà. Visione della superficie

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Diagnosi Preimpianto delle alterazioni cromosomiche mediante array-cgh La sottoscritta (partner femmiile).. Data

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli