Il SAC, sistema di controllo nella divisione cellulare

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il SAC, sistema di controllo nella divisione cellulare"

Transcript

1 Il SAC, sistema di controllo nella divisione cellulare IFOM per la scuola Lo Studente Ricercatore 2011 Villani Yuri Liceo Scientifico Tecnologico Chimico-Biologico IIS A. Maserati - Voghera(PV) Gruppo: Biologia cellulare computazionale Tutor: Luca Mariani, Elena Chiroli

2 La scelta del lievito per lo studio Perché scegliere il lievito? Sceglierlo ha diversi vantaggi: 1) Ciclo cellulare molto veloce; 2) Facilità di mantenimento; 3) Dimensioni molto ridotte, quindi colture poco ingombranti; 4) Genoma conosciuto; 5) Facilità nel bioingegnerizzarlo; 6) Nessun problema etico. Tratto da:

3 Il ciclo cellulare Tratto da: Il ciclo cellulare comprende tutta la vita di una cellula. Alcuni passaggi sono critici per il successo della divisione. Il primo è la duplicazione del DNA in fase S(ci è utile per le analisi al FACS perché in base alla quantità di DNA capiamo qual è la fase cellulare, il secondo è la connessione microtubulicentromero in fase G2.

4 Un po' di teoria: la mitosi La mitosi è il processo che permette alla cellula singola la divisione in due cellule figlie. È una fase delicata perché qui avviene la separazione dei cromatidi fratelli, con un'alta probabilità di incorrere in errori che potrebbero portare a mutazioni nel corredo genetico. Processo schematizzato della mitosi Tratto e modificato da

5 Prima e dopo il punto critico: Tratto da: metafase e anafase Nella metafase avviene il collegamento tra i microtubuli e i centromeri. Centrosoma In anafase, i centrosomi creano una tensione sui microtubuli che fa separare e migrare nei rispettivi poli i cromatidi fratelli. T Tratto da:www.bassilo.it

6 Cos'è il SAC? Il SAC(Spindle Assembly Checkpoint) è un meccanismo che permette alla cellula di arrestare la divisione prima dell'anafase in caso di anomalie nella struttura del fuso mitotico o, in assenza di errori, fino a che tutti i microtubuli si sono uniti correttamente ai centromeri. Tratto da:

7 Perché avviene l'arresto? L'arresto in metafase avviene nel caso in cui un microtubulo non è correttamente legato al centromero. In mancanza dell'arresto, durante la migrazione dei cromatidi verso i poli, il microtubulo opposto a quello non collegato trainerebbe due cromatidi al posto di uno. Tratto e modificato da:

8 Come avviene l'arresto? La mancata connessione dei microtubuli con i centromeri, induce la formazione di un complesso con Mad2 scatenando una cascata di eventi che portano alla inibizione della separasi e al blocco del fuso mitotico impedendo così la divisione dei cromatidi in modo errato. Tratto da:

9 In laboratorio Ricreare il SAC in laboratorio ci permette di studiarlo. Come attivarlo? 2 metodi principali: Sovraespressione della proteina Mad2 grazie ad una inserzione Gal-Mad2. Distruggendo fisicamente il fuso mitotico con il nocodazolo. Noi utilizzeremo la sovraespressione di Mad2.

10 Inserzione Gal-Mad2 Il gene Gal-Mad2 viene inserito per trasformazione all'interno del corredo genetico del lievito. Permette alla cellula, in presenza di galattosio(gal), una produzione di Mad2 circa 20 volte quella naturale. Si possono fare più inserzioni(gal-mad2 1x, 2x, 3x, cioè 20, 40, 60 volte l'endogeno).

11 Primo passo: la coltura Si prepara una coltura con il ceppo che ci interessa e dopo il rilascio da alpha-factor(un ormone che ci permette di avere le cellule tutte alla stessa fase del ciclo)si tratta con sostanze diverse in base allo studio da fare e si prendono campioni ad intervalli regolari. Cellule ciclanti, prima del trattamento con alpha-factor.

12 Ceppo Gal-Mad2 in galattosio Dopo il rilascio, nella coltura si aggiunge del galattosio. Questo zucchero attiva il promotore Gal-Mad2 che sovraesprime la produzione della proteina Mad2 causando l'arresto. Cellule bloccate in metafase, si può dedurre dalla grandezza delle gemme.

13 Il FACS Il FACS è uno strumento che permette la misurazione della quantità di DNA in una cellula. Come? I campioni prelevati vanno trattati con ioduro propidio che si lega al DNA. Il propidio emana una fluorescenza letta dal FACS. In base alla quantità di fluorescenza rilevata si capisce se la cellula è in fase G1 oppure in fase G2. Se tutte le cellule di un campione sono in fase G2 vuol dire che siamo riusciti a creare un blocco efficace.

14 Leggere i dati del FACS Il FACS invia al computer collegato dei grafici che sta al ricercatore interpretare. N di cellule Quantità di DNA rilevata; fase G1 o fase G2. Se va oltre si è in presenza di cellule lisate, cioè distrutte.

15 Risultati dell'esperimento Nel caso di 3 inserzioni di Gal-Mad2 il blocco dura per oltre 7 ore.

16 In ultimo ma non meno importante Ma alla fine, cosa serve conoscere il SAC alla ricerca sul cancro? Conoscere in modo perfetto il checkpoint, ci farebbe capire come alcune cellule possano proliferare in modo anomalo, quindi cercare soluzioni più mirate in una eventuale nuova terapia.

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

CICLO CELLULARE EUCARIOTICO

CICLO CELLULARE EUCARIOTICO CICLO CELLULARE EUCARIOTICO COMPESSO SISTEMA DI CONTROLLO OMEOSTASI ORGANISMO NORMALE G 0 CANCRO DNA marcato con molecole intercalanti fluorescenti Fluorescence Activated Cell Sorting (FACS) Rilevazione

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

L endocitosi dell EGFR

L endocitosi dell EGFR L endocitosi dell EGFR IFOM per la scuola Lo Studente Ricercatore 2011 Muzio Giulia Istituto d Istruzione Superiore Maserati Voghera Gruppo di lavoro: Determinanti della trasformazione neoplastica e della

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

mammifero onorario Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105

mammifero onorario Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 LIEVITO mammifero onorario Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 Indice 1. Conoscenze preliminari p.3 1.1 Terminologia e concetti di base della genetica

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

COLTURE DI CELLULE LEUCEMICHE ESPOSTE A CAMPI ELETTROMAGNETICI, VALUTAZIONE DEGLI INDICI DI PROLIFERAZIONE E DEI PROFILI DI ESPRESSIONE GENICA

COLTURE DI CELLULE LEUCEMICHE ESPOSTE A CAMPI ELETTROMAGNETICI, VALUTAZIONE DEGLI INDICI DI PROLIFERAZIONE E DEI PROFILI DI ESPRESSIONE GENICA PROGETTO ISPESL/CNR: COLTURE DI CELLULE LEUCEMICHE ESPOSTE A CAMPI ELETTROMAGNETICI, VALUTAZIONE DEGLI INDICI DI PROLIFERAZIONE E DEI PROFILI DI ESPRESSIONE GENICA - INTRODUZIONE 2 - MATERIALI E METODI:..

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi Ciclo Cellulare M --> G1--> S --> G2 --> M S, G2 e M hanno durata sempre uguale mentre la fase G1 (in media 10 ore) può subire enormi variazioni da tessuto a tessuto (fino a migliaia di ore per i neuroni).

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Screening Preimpianto delle alterazioni cromosomiche numeriche mediante array-cgh La sottoscritta (partner femmile).. Data

Dettagli

Citoscheletro Microtubuli

Citoscheletro Microtubuli PROPRIETA DEI MICROTUBULI, FILAMENTI INTERMEDI E FILAMENTI DI ACTINA Citoscheletro Microtubuli Biotec _ 2011 Da G. Karp, BIOLOGIA CELLULARE E MOLECOLARE, 3a ed, CORRETTA Microtubuli Microfilamenti Filamenti

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Diagnosi Preimpianto delle alterazioni cromosomiche mediante array-cgh La sottoscritta (partner femmiile).. Data

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

Rai e migrazione delle NSCs

Rai e migrazione delle NSCs Rai e migrazione delle NSCs IFOM per la scuola Lo Studente Ricercatore 2009 Lucrezia Bertino Liceo scientifico E. Amaldi Biology and signal trasduction of normal and cancer neural stem cells Daniela Osti

Dettagli

Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5

Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5 Metodi per l analisi morfo-funzionale delle cellule Prof. Marisa Levi Parte 5 Colture cellulari Un organismo è un sistema molto complesso, costituito da organi, che a loro volta sono costituiti da diversi

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY Laboratorio di Citogenetica Laboratorio di Biologia Molecolare LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY MODENA, 09 MARZO 2013 Dott.ssa Patrizia Caggiati

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

FARMACOLOGIA Oncologica. www.baveno.net by G.B.

FARMACOLOGIA Oncologica. www.baveno.net by G.B. Oncologica www.baveno.net by G.B. Agg: settembre 2015 AVVERTENZE 2 I contenuti della presentazione sono estrapolati da materiale esistente, redatti e verificati da personale sanitario Le informazioni fornite

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

La biostimolazione, alcuni passaggi obbligati. Durante l invecchiamento

La biostimolazione, alcuni passaggi obbligati. Durante l invecchiamento La biostimolazione, alcuni passaggi obbligati Durante l invecchiamento L invecchiamento è l incapacità di organi, tessuti, cellule e molecole a mantenere la propria integrità funzionale e strutturale perturbata

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Indirizzo Telefono Fax E-mail CARRERA PAOLA Nazionalità Data di nascita Codice fiscale italiana CRR PLA 57T45

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

Summer School/Corso Estivo 2014

Summer School/Corso Estivo 2014 Summer School/Corso Estivo 2014 La Fondazione Marino Golinelli per il sesto anno consecutivo organizza presso il proprio Centro di formazione e didattica (Bologna, Via della Beverara 123) la Summer School

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

SBOBBINATURE DI GENETICA prof. Varriale a.a. 2012/2013. Olivetta Michelangelo/Fonticelli Mariano. scaricato da www.sunhope.it

SBOBBINATURE DI GENETICA prof. Varriale a.a. 2012/2013. Olivetta Michelangelo/Fonticelli Mariano. scaricato da www.sunhope.it SBOBBINATURE DI GENETICA prof. Varriale a.a. 2012/2013 Olivetta Michelangelo/Fonticelli Mariano 16.10.2012 GENETICA N 1 Perché studiare la genetica? A parte un semplice interesse, lo studio di questa materia

Dettagli

Introduzione. Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito

Introduzione. Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito Colture Cellulari Introduzione Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito strumento fondamentale per studi biochimici,

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

LICEO DI STATO C. RINALDINI

LICEO DI STATO C. RINALDINI c.f. 93020970427 LICEO DI STATO C. RINALDINI Liceo Classico - Liceo Musicale - Liceo delle Scienze Umane con opzione Economico Sociale Via Canale, 1-60122 ANCONA - 071/204723 fax 071/2072014 e-mail: segreteria@rinaldini.org

Dettagli

Evasione apoptosi. Angiogenesi

Evasione apoptosi. Angiogenesi Il cancro rappresenta un gruppo d malaae che comprende almeno 100 Bpi differenb di tumori. A secondo del tessuto di origne si classificano tre Bpi principali di tumori: in tessub epiteliali: Carcinoma

Dettagli

Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015

Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 Progetto scuola-lavoro Consiglio Nazionale delle Ricerche Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 1 Vaccini a Dna Sono costituiti da un plasmide, cioè un anello di dna, di origine

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie http://www.cusmibio.unimi.it/ I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

Affidabilità nella diagnostica

Affidabilità nella diagnostica Affidabilità nella diagnostica Passione per la ricerca Research & Innovation è un laboratorio di medicina molecolare che esegue test genetici avanzati al servizio dei medici e delle strutture di diagnosi

Dettagli

INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE. - malattie cardiovascolari - cancro

INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE. - malattie cardiovascolari - cancro INVECCHIAMENTO come PROCESSO FISIOLOGICO INVECCHIAMENTO DOVUTO ALL INSORGENZA DI PATOLOGIE - malattie cardiovascolari - cancro Il processo di BIOSENESCENZA implica le caratteristiche seguenti: 1. è deleterio

Dettagli

Il termine deriva dal greco antico κλών(klōn, ramo", "ramoscello"), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o

Il termine deriva dal greco antico κλών(klōn, ramo, ramoscello), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o Il termine deriva dal greco antico κλών(klōn, ramo", "ramoscello"), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o artificiale, di un intero organismo vivente o anche di una

Dettagli

Progetto di divulgazione scientifica per le scuole a.s. 2015-2016

Progetto di divulgazione scientifica per le scuole a.s. 2015-2016 Progetto di divulgazione scientifica per le scuole a.s. 2015-2016 Proposte per gli studenti Esperienze della durata di una mattinata, con la possibilità di tornare dopo 15 giorni o un mese per le attività

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Le chinasi ATM e ATR sono coordinatrici di un fine meccanismo di controllo noto come checkpoint del

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Cosa sono i Macatori Tumorali?

Cosa sono i Macatori Tumorali? Marcatori tumorali Cosa sono i Macatori Tumorali? Sostanze biologiche sintetizzate e rilasciate dalle cellule tumorali o prodotte dall ospite in risposta alla presenza del tumore Assenti o presenti in

Dettagli

ELETTRONICA ED ELETTROTECNICA

ELETTRONICA ED ELETTROTECNICA Istituto di Istruzione Secondaria Superiore Statale «Via Silvestri 301» Programma di BIOLOGIA Classe 2 a A Indirizzo ELETTRONICA ED ELETTROTECNICA n.1 Titolo La cellula La struttura della cellula La teoria

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle cellule staminali Elena Comoglio Jacobacci & Partners S.p.A. Disposizioni della

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Tecnologie per lo studio. delle cellule staminali

Tecnologie per lo studio. delle cellule staminali Tecnologie per lo studio delle cellule staminali Dr.ssa Annalisa Buffo Università degli Studi di Torino Dipartimento di Neuroscienze Introduzione: come smascherare le cellule staminali Le cellule staminali

Dettagli

Il Programma ISTSCUOLA

Il Programma ISTSCUOLA esercitazioni pratiche guidate per insegnanti anno scolastico 2009/2010 Il Programma ISTSCUOLA L IST, Istituto nazionale per la ricerca sul cancro di Genova è un ente di diritto pubblico riconosciuto dal

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

La vita si basa su composti di carbonio immersi in acqua. Esso inoltre è capace di formare legami forti con gli altri atomi.

La vita si basa su composti di carbonio immersi in acqua. Esso inoltre è capace di formare legami forti con gli altri atomi. Il carbonio La vita si basa su composti di carbonio immersi in acqua. Esso inoltre è capace di formare legami forti con gli altri atomi. Classi principali di molecole biologiche (Pag. 39). Carboidrati

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Nuclear size control in C. elegans

Nuclear size control in C. elegans Nuclear size control in C. elegans Chiara Knecht (Liceo Lugano 2) e Justin-Aurel Ulbrich (Liceo Lugano 1) Sotto la supervisione di Christian Gentili, Swiss Institute for Experimental Cancer Research (ISREC),

Dettagli

cenni di anatomia del testicolo

cenni di anatomia del testicolo cenni di anatomia del testicolo Il gamete maschile è rappresentato della spermatozoo la produzione e maturazione del gamete maschile avviene nel testicolo Il testicolo fa parte dell apparato riproduttivo

Dettagli

Personale coinvolto: Prof. A. Arcangeli, Dr. A Fortunato, Dr. A Gurriero, Dr. M. Ristori. Riassunto

Personale coinvolto: Prof. A. Arcangeli, Dr. A Fortunato, Dr. A Gurriero, Dr. M. Ristori. Riassunto Relazione progetto dal titolo Uso di vettori lentivirali per il silenziamento genico del complesso CXCR4/hERG1: una nuova strategia terapeutica nei tumori pediatrici chemio resistenti Personale coinvolto:

Dettagli

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità

Dettagli

Progetto della classe II C

Progetto della classe II C Progetto della classe II C Preparazione allo svolgimento dell esperienza La II C è preparata all esperienza presso il centro di ricerca E.B.R.I. iniziando un intenso lavoro di approfondimento sulla genetica

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

Farmaci Antineoplastici Generalità

Farmaci Antineoplastici Generalità Farmaci Antineoplastici Generalità Con il termine chemioterapia, si intende in una terapia medica capace di distruggere una popolazione cellulare. Le probabilità di successo di una chemioterapia, saranno

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

Ricerca di bersagli per la terapia sistemica del mesotelioma

Ricerca di bersagli per la terapia sistemica del mesotelioma Ricerca di bersagli per la terapia sistemica del mesotelioma Searching for targets for the systemic therapy of mesothelioma Stahel RA, Weder W, Felley- Bosco E, Petrausch U, Curioni-Fontecedro A, Schmitt-Opitz

Dettagli

PIANO DIDATTICO CLASSE II BIOLOGIA ANNO SCOLASTICO 2010 2011 PERCORSO FORMATIVO

PIANO DIDATTICO CLASSE II BIOLOGIA ANNO SCOLASTICO 2010 2011 PERCORSO FORMATIVO Liceo Scientifico Statale Vito Volterra - Ciampino PIANO DIDATTICO CLASSE II BIOLOGIA ANNO SCOLASTICO 2010 2011 Finalità - Comprensione del testo e sua utilizzazione come strumento conoscitivo - Sviluppo

Dettagli

Source: Florida Institute for Reproductive Science and Technologies

Source: Florida Institute for Reproductive Science and Technologies Staminali: concetti, risultati ti e problemi Lo zigote La prima divisione cellulare Source: Florida Institute for Reproductive Science and Technologies Blastula 5 giorni dopo la fertilizzazione Source:

Dettagli

PIANO DI LAVORO DEL PROFESSORE

PIANO DI LAVORO DEL PROFESSORE ISTITUTO DI ISTRUZIONE SUPERIORE STATALE IRIS VERSARI - Cesano Maderno (MB) PIANO DI LAVORO DEL PROFESSORE Indirizzo: LICEO SCIENTIFICO LICEO SCIENTIFICO Scienze Applicate LICEO TECNICO ISTITUTO TECNICO

Dettagli

Istituto F. Algarotti. Programma di Scienze. Classe 1 A FM

Istituto F. Algarotti. Programma di Scienze. Classe 1 A FM Istituto F. Algarotti Programma di Scienze Classe 1 A FM L Universo Caratteristiche delle stelle Le galassie La nascita delle stelle L origine dell universo Il sistema solare Il sole I pianeti terrestri

Dettagli

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA

Dettagli

Paola Bonizzoni. Università degli Studi di Milano-Bicocca

Paola Bonizzoni. Università degli Studi di Milano-Bicocca Paola Bonizzoni Università degli Studi di Milano-Bicocca Biologia Bioinformatica: Ricostruzione evoluzione Analisi di sequenze Folding di Proteine Simulazione di processi biologici Informatica 2 In un

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

Grant 2015 il nostro sostegno alla ricerca scientifica

Grant 2015 il nostro sostegno alla ricerca scientifica Grant 2015 il nostro sostegno alla ricerca scientifica grant 2015 Lettera di Umberto Veronesi Lettera del Comitato Etico Lettera di Chiara Tonelli In cosa crediamo I numeri del 2015 Borse di ricerca 2015

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Che significa animale transgenico o animale Knockout???

Che significa animale transgenico o animale Knockout??? Che significa animale transgenico o animale Knockout??? ORGANISMI TRANSGENICI Gli animali che sono stati ingegnerizzati per inserzione di un gene, delezione di un gene o sostituzione di un gene si chiamano

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Her-2 nel carcinoma mammario

Her-2 nel carcinoma mammario Her-2 nel carcinoma mammario Piera Balzarini U.O. Anatomia Patologica Università degli Studi di Brescia Spedali Civili di Brescia Il gene ERBB2 dà origine ad un recettore tirosin-chinasico appartenente

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

Pt. 2. Dipartimento di Specialità Medico-Chirurgiche. (Sez. Sanità Pubblica) Dr. Massimo Moretti

Pt. 2. Dipartimento di Specialità Medico-Chirurgiche. (Sez. Sanità Pubblica) Dr. Massimo Moretti EPIDEMIOLOGIA MOLECOLARE Pt. 2 - BIOMARCATORI - Dr. Massimo Moretti Università degli Studi di Perugia Dipartimento di Specialità Medico-Chirurgiche e Sanità Pubblica (Sez. Sanità Pubblica) PREMESSA Esposizione

Dettagli

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Indice IX X Prefazione Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Capitolo 1 LA MANIPOLAZIONE GENICA, UNA TECNICA DALLE VASTE 1 APPLICAZIONI 1 Introduzione 1 Sequenziamento

Dettagli