Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download ""

Transcript

1 DNA

2

3

4 DNA

5 DNA

6 Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile sempre ricostruire la sequenza di un filamento a partire dalla sequenza del suo complementare. C G A G T C

7 IL DNA: natura ed informazione Come detto in precedenza il DNA è una sequenza di 4 diversi nucleotidi. Lo zucchero ed il fosfato di ogni nucleotide costituisco l ossatura costante del filamento di DNA mentre le diverse basi azotate sporgono permettendo l interazione con altro filamento di DNA Le basi azotate, infatti, sono particolarmente predisposte ad interagire tra loro attraverso legami ad idrogeno (legami deboli) altamente specifici. Le Adenine possono interagire solo con le Timine e le Guanine possono interagire solo con le Citosine.

8 Struttura del DNA: la doppia elica La molecola di DNA consiste di due catene polinucleotidiche unite mediante le basi azotate e avvolte l una sull altra a formare una doppia elica destrorsa. Le due catene sono antiparallele cioe i due filamenti sono orientati in direzione opposta: uno orientato in 5-3 e l altro in 3-5. Gli scheletri di zucchero fosfato si trovano all esterno della doppia elica, mentre le basi sono orientate verso l asse centrale.

9 Termini chiave -Il genoma è l insieme completo delle sequenze che costituiscono il materiale genetico di un organismo. Negli eucarioti comprende le sequenze di DNA cromosomico più qualunque sequenza di DNA presente negli organelli -Il gene è una porzione del genoma che contiene l informazione trasmessa nella cellula. Esso rappresenta l unità funzionale del genoma. -Il genoma è suddiviso, da un punto di vista fisico, in cromosomi. Ogni cromosoma è una unità fisica indipendente che comprende molti geni.

10

11 Nucleo Il nucleo è delimitato da una doppia membrana, chiamata involucro nucleare, che presenta numerosi pori. Nel nucleoplasma, sostanza fondamentale del nucleo, si trova la cromatina (DNA + proteine) Il nucleolo contiene principalmente RNA e proteine, oltre che DNA

12 Nucleo: funzioni - Centro di controllo attività cellulare (determinazione delle proteine da sintetizzare) - Sede del DNA e della trascrizione (mantenimento e trasmissione delle informazioni genetiche

13

14

15 I cromosomi E stato calcolato che la lunghezza totale di tutte le molecole di DNA che costituiscono il genoma di UNA cellula è di circa 2 metri. Il problema di spazio occupato dal materiale genetico è stato superato mediante meccanismi recursivi di superavvolgimento che permettono di compattare il DNA in strutture più dense. La presenza di alcune proteine, chamate ISTONI, legate al DNA permette di raggiungere un elevato grado di compattamento. Esistono diversi gradi di compattamento del DNA che sono dipendenti da necessità funzionali: tanto più compatto è un tratto di DNA tanto meno verrà utilizzata la sua informazione. Prima di essere utilizzato un segmento genico deve essere decompresso, quando non serve più può essere compresso di nuovo. Questa situazione è estremamente dinamica. La massa totale di DNA presente nel nucleo viene chiamata CROMATINA La cromatina più compatta (e funzionalmente non attiva) viene chiamata ETEROCROMATINA La cromatina meno compatta (è più attiva) viene chiamata EUCROMATINA

16 Condensazione del DNA

17

18 Trascrizione del DNA Gene A

19

20 Replicazione del DNA

21

22 La DNA polimerasi commettono degli errori La DNA polimerasi sintetizza un nuovo filamento di DNA sulla base di un filamento STAMPO. Ma la riproduzione della informazione è sempre affidabile al 100%? In realtà la polimerasi genera un errore con una frequenza di Ogni tanto inserisce un nucleotide sbagliato (non complementare allo stampo) generando una MUTAZIONE. La impossibilità di generare un corretto appaiamento tra nucleotidi non complemantari genera nell elica nascente una deformazione spaziale. Questa deformazione può essere riconosciuta della polimerasi che può tornare indietro e correggere l errore. Grazie a questa attivita di correzione di bozze (proof reading) la frequenza di errore scende a Le mutazioni che sfuggono alla correzione si stabiliscono nel DNA e diventano ereditabili. Le mutazioni non sono sempre brutte e cattive: sono alla base delle VARIABILITA GENETICA e quindi della EVOLUZIONE PER SELEZIONE NATURALE.

23 Le mutazioni sono variazioni della sequenza nucleotidica del DNA. Possono essere causate da: - errori durante la duplicazione del DNA - esposizione delle cellule ad agenti fisici o chimici (agenti mutageni) Se la mutazione avviene all interno di una regione di DNA implicata nella produzione di una proteina, possiamo avere una alterazione nella proteina corrispondente e di conseguenza nella funzione svolta dalla proteina in questione Effetti delle mutazioni Alterazione della funzione di una proteina Nessun effetto sulla proteina Un miglioramento della funzione

24 Ciò determina una inestimabile capacità di originare forme e funzioni diverse, a livello molecolare e cellulare in organismi uni e pluricellulari questi ultimi tessuti e organi estremamente differenti Dando luogo a popolazioni variabili e comunita eterogenee

25

26

27

28

29 Contenuto informativo del DNA La struttura del DNA è costante. Il DNA è sempre una doppia elica INDIPENDENTEMENTE dalla sequenza di nucleotidi che lo compone. L ossatura di zucchero e fosfato è costante. La parte variabile, e quindi più informativa, è rappresentata dalla sequenza di BASI AZOTATE. Per questo motivo, in bioinformatica, l informazione contenuta nel DNA è rappresentata da una stringa composta da un alternanza 4 caratteri che rappresentano le basi azotate del DNA. GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGG AGCTGAGGAGCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGG TCGCACACATCCACCGGCGCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCG CCGCTCAGGGGCGGGAAGAGGAGGCGGTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGG ATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCTCTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTA CTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGATCCAGGCTACCAACGAGACCAATGT TAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGGGTGGTTGTGTTTAAG GCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTCTAGAAATA CACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAA

30 Il massimo grado di compattamento del DNA si raggiunge durante i processi di divisione cellulare. Durante questo processo il DNA deve essere diviso in maniera eguale alle 2 cellule figlie che si originano dalla cellula progenitrice: è necessario che sia compatto e resistente per evitare rotture e facilitare un equa distribuzione (processo meccanico). E in questa fase che i cromosomi assumono la forma ad X che tutti conosciamo. Nell uomo esistono 23 coppie di cromosomi, 22 delle quali sono delle coppie di cromosomi identici tra loro (AUTOSOMI) mentre 1 è costituita da una coppia che può essere eterogenea e definisce il sesso dell individuo (ETEROSOMI o CROMOSOMI SESSUALI) Nella donna gli eterosomi sono due cromosomi chiamati X Nell uomo gli eterosomi sono un cromosoma X ed un cromosoma più piccolo chiamato Y

31 Ciclo cellulare in tessuti meristematici crescita divisione Cellula meristematica crescita e differenziamento divisione Cellula meristematica Tracheide crescita divisione crescita e differenziamento Cellula meristematica Cellula parenchimatica

32

33

34

35

36 Numero cromosomico I differenti tipi di organismi variano per il numero di cromosomi presenti nelle loro cellule somatiche. Corredo doppio numero diploide 2n Le cellule riproduttive invece sono caratterizzate dalla metà del numero di cromosomi caratteristico delle cellule somatiche di ciascun organismo. Corredo semplice numero aploide n

37 Dal DNA ai cromosomi Duplicazione del DNA

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA

Il Codice Gene,co. Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del DNA Corso di Laurea in Chimica e Tecnologie Farmaceu,che a.a. 2014-2015 Università di Catania Il Codice Gene,co Il dogma centrale, il flusso dell informazione genica e la decifrazione della informazione del

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi Il DNA Il DNA è una sostanza che si trova in ogni cellula e contiene tutte le informazioni sulla forma e sulle funzioni di ogni essere vivente: eppure è una molecola incredibilmente semplice. COME È FATTO?

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B2 Il linguaggio della vita 3 Le basi molecolari dell ereditarietà Prima

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

Gli Acidi Nucleici DNA RNA

Gli Acidi Nucleici DNA RNA Gli Acidi Nucleici DNA RNA Gli Acidi nucleici Gli acidi nucleici sono il: DNA (acido desossiribonucleico) RNA (acido ribonucleico) Essi sono formati dai polimeri (molecole molto grosse) i cui monomeri

Dettagli

Malattie genetiche. Dott. Giovanni LONGO

Malattie genetiche. Dott. Giovanni LONGO Malattie genetiche Dott. Giovanni LONGO Il ruolo della ricerca scientifica Esistono una quantità quasi infinita di rimedi o cure contro un'altrettanta quantità di malattie. La ricerca scientifica si occupa

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

DNA. simile ad una scala a chiocciola. I pioli della scala corrispondono

DNA. simile ad una scala a chiocciola. I pioli della scala corrispondono DNA Il DNA o acido desossiribonucleico è una grossa molecola chimica contenuta nel nucleo della cellula. Il DNA può essere paragonato ad un importante libro delle istruzioni che contiene l informazione

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

Riproduzione e sessualità sono inscindibili?

Riproduzione e sessualità sono inscindibili? Riproduzione e sessualità sono inscindibili? Per biologia la risposta è NO Riproduzione: formazione di nuovi organismi da organismi pre-esistenti da cui ereditano i geni Sessualità: scambio o mescolamento

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

L ACQUA E LE SUE PROPRIETÀ

L ACQUA E LE SUE PROPRIETÀ L ACQUA E LE SUE PROPRIETÀ L acqua è una sostanza indispensabile per tutte le forme di vita. Ogni molecola di acqua (H2O) è formata da due atomi di idrogeno e un atomo di ossigeno, uniti tramite due legami

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

REPLICAZIONE DEI GENOMI A DNA

REPLICAZIONE DEI GENOMI A DNA REPLICAZIONE DEI GENOMI A DNA LA REPLICAZIONE DEL DNA SERVE A PERPETUARE L INFORMAZIONE GENICA FIGURA 12.26 GENES VII FIGURA 13.1 GENOMI II FIGURA 13.2 GENOMI II NEL 1958 MESELSON E STAHL DIMOSTRANO CHE

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei.

Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. DNA e RNA Composizione e proprietà Struttura Analisi 1 STRUTTURA DAGLI ACIDI NUCLEICI Nel DNA e nell RNA i nucleotidi sono legati covalentemente da legami fosfodiesterei. I gruppi fosforici hanno pka vicino

Dettagli

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S CONOSCERE IL CORPO UMANO PARTE 1 DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S. 2007-2008 1 CONOSCERE IL CORPO UMANO: GLOSSARIO ANATOMIA Scienza che studia e illustra la forma, l architettura e la

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

LA REPLICAZIONE DEL DNA

LA REPLICAZIONE DEL DNA www.fisiokinesiterapia.biz LA REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA Durante il processo di replicazione la doppia elica del DNA si srotola e ciascuno dei due filamenti funziona da stampo per un nuovo

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

Ciclo cellulare, suddiviso in 3 fasi principali:

Ciclo cellulare, suddiviso in 3 fasi principali: Ciclo cellulare, suddiviso in 3 fasi principali: Interfase Fase S (fase di sintesi) vengono sintetizzate proteine associate al DNA; Fase G1 la cellula raddoppia le sue dimensioni; Fase G2 si duplicano

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

LE MUTAZIONI E L EVOLUZIONE

LE MUTAZIONI E L EVOLUZIONE UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE LE MUTAZIONI E L EVOLUZIONE Roberto Giacominelli Stuffler LE MUTAZIONI 2 LE MUTAZIONI LE SOSTITUZIONI LE DELEZIONI LE INSERZIONI 3 LE MUTAZIONI

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Corso integrato di Biologia e Genetica

Corso integrato di Biologia e Genetica Corso integrato di Biologia e Genetica Coordinatore: Prof.ssa Giovanna Bianchi Scarrà Genetica Generale e Molecolare (testo: vedi Biologia) Genetica Medica (testo: Genetica Medica Essenziale, Dalla Piccola,

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A LICEO SCIENTIFICO STATALE «GALILEO GALILEI» Via Ceresina 17 - Tel. 049 8974487 Fax 049 8975750 35030 SELVAZZANO DENTRO (PD) ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

ACIDI NUCLEICI ESPERIMENTI

ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

Dimensioni di Genomi

Dimensioni di Genomi Dimensioni di Genomi plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni pari a circa

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri

Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri Agli inizi del Novecento studi condotti su modelli animali hanno indicato che alcune sostanze sono in grado

Dettagli

Principi di biologia Introduzione alla biologia

Principi di biologia Introduzione alla biologia Principi di biologia Introduzione alla biologia Prof.ssa Flavia Frabetti BIOLOGIA è la scienza della vita, che indaga le caratteristiche dei sistemi viventi biologia animale biologia cellulare biologia

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

Elementi di genetica forense

Elementi di genetica forense www.aifo-italia.it Elementi di genetica forense Dr.ssa Sandra von Borries Dove si trova il DNA? Ogni organismo vivente è costituito da cellule. Ogni cellula presenta un NUCLEO. All interno del nucleo si

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Bioinformatica. Analisi del genoma

Bioinformatica. Analisi del genoma Bioinformatica Analisi del genoma GABRIELLA TRUCCO CREMA, 5 APRILE 2017 Cosa è il genoma? Insieme delle informazioni biologiche, depositate nella sequenza di DNA, necessarie alla costruzione e mantenimento

Dettagli

Percorsi di chimica organica - Soluzioni degli esercizi del testo

Percorsi di chimica organica - Soluzioni degli esercizi del testo ercorsi di chimica organica - Soluzioni degli esercizi del testo AITL 14 1. Il prefisso α negli α-amminoacidi sta ad indicare che il gruppo amminico, - 2, si trova sul carbonio alfa (carbonio legato al

Dettagli

CICLO CELLULARE MITOSI MEIOSI

CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa

Dettagli

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata.

La riproduzione. La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. asessuata o sessuata. La riproduzione La riproduzione La riproduzione è il processo mediante il quale si assicura la sopravvivenza della specie. Riguarda tutti gli esseri viventi, può essere Riguarda tutti gli esseri viventi,

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi.

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Ogni cellula contiene un organello, il NUCLEO, all interno

Dettagli

Biologia. Lezione 09/11/2010

Biologia. Lezione 09/11/2010 Biologia Lezione 09/11/2010 Tutte le molecole contenute nelle cellule sono costituite da composti del carbonio Zuccheri Lipidi Proteine Acidi nucleici Polimeri Sono macromolecole formate da unità (MONOMERI)

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

LA RIPRODUZIONE. Prima di iniziare questo percorso tuttavia è necessario ripassare alcune nozioni di biologia apprese gli anni scorsi

LA RIPRODUZIONE. Prima di iniziare questo percorso tuttavia è necessario ripassare alcune nozioni di biologia apprese gli anni scorsi LA RIPRODUZIONE Caratteristica fondamentale che distingue i viventi dai non viventi è la riproduzione, che permette di generare nuovi individui mantenendo e diffondendo la specie nel tempo e nello spazio.

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita Costituita da proteine, acidi nucleici, carboidrati e lipidi Si differenzia tra eucarioti e procarioti E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la

Dettagli

Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri).

Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri). Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri). Un nucleotide è formato da: uno zucchero: (Ribosio o Deossiribosio), a 5 atomi di carbonio in forma ciclica

Dettagli

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si LA CELLULA Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si nutre, respira, scambia sostanze con l ambiente

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule.

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. LA CELLULA CELLULA La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. CELLULA La teoria cellulare Le cellule furono

Dettagli

ACIDI GRASSI INSATURI

ACIDI GRASSI INSATURI LIPIDI ACIDI GRASSI SATURI ACIDI GRASSI INSATURI TRIGLICERIDI TRIGLICERIDI Grassi neutri o lipidi semplici glicerolo + 1 acido grasso monogliceride glicerolo + 2 acidi grassi digliceride glicerolo + 3

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

VERIFICA La cellalula si divide, gli organismi si riproducono

VERIFICA La cellalula si divide, gli organismi si riproducono ERIICA La cellalula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o falso? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli