REPLICAZIONE DEI GENOMI A DNA

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "REPLICAZIONE DEI GENOMI A DNA"

Transcript

1 REPLICAZIONE DEI GENOMI A DNA

2 LA REPLICAZIONE DEL DNA SERVE A PERPETUARE L INFORMAZIONE GENICA

3 FIGURA GENES VII

4 FIGURA 13.1 GENOMI II

5

6 FIGURA 13.2 GENOMI II

7 NEL 1958 MESELSON E STAHL DIMOSTRANO CHE LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA

8 FIGURA 13.3A GENOMI II

9 FIGURA 13.3B GENOMI II

10 NEL 1958 MESELSON E STAHL PUBBLICARONO I RISULTATI DELLE LORO RICERCHE SULLA PRESTIGIOSA RIVISTA PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA (PNAS USA)

11 FIGURA 13.1 GENOMI II

12 LA REPLICAZIONE DI UNA MOLECOLA DI DNA NON INIZIA MAI ALLE SUE ESTREMITA MA IN UNA O PIU REGIONI INTERNE ED E PER QUESTO BIDIREZIONALE.

13 L INIZIO DELLA REPLICAZIONE NON E UN PROCESSO CASUALE MA AVVIENE SEMPRE NELLA STESSA POSIZIONE (O POSIZIONI) DEL GENOMA DEFINITA ORIGINE DI REPLICAZIONE.

14 FIGURA 13.7 GENOMI II

15 LO SVOLGIMENTO DELLA DOPPIA ELICA E OPERATO DALLE ELICASI, ENZIMI IN GRADO DI UTILIZZARE L ENERGIA DERIVANTE DALL IDROLISI DELL ATP PER ROMPERE I LEGAMI AD IDROGENO TRA LE BASI AZOTATE.

16 LO SVOLGIMENTO DELLA DOPPIA ELICA AD OPERA DELLE ELICASI GENERA SUPERAVVOLGIMENTI E QUINDI TENSIONI TORSIONALI A MONTE DELLA FORCINA DI REPLICAZIONE. QUESTE TENSIONI SONO SCARICATE DALLE DNA TOPOISOMERASI.

17 FIGURA GENOMI II

18 FIGURA 13.5 GENOMI II

19 FIGURA 13.4 GENOMI II

20

21 NELLA FORCINA DI REPLICAZIONE IL RIAPPAIAMENTO DEI DUE FILAMENTI POLINUCLEOTIDICI E IMPEDITO DA PROTEINE CHE LEGANO IL DNA A SINGOLO FILAMENTO, LE SSB.

22 FIGURA GENOMI II

23 LA COPIA DEI FILAMENTI POLINUCLEOTIDICI PARENTALI E LA CONSEGUENTE NEOSINTESI DI DNA E OPERATA DALLE DNA POLIMERASI.

24 TUTTE LE DNA POLIMERASI CONDIVIDONO LE SEGUENTI CARATTERISTICHE: POLIMERIZZANO IN DIREZIONE 5 ->3 UTILIZZANO DEOSSINUCLEOSIDI TRIFOSFATO NECESSITANO DI UN INNESCO SONO SPESSO DOTATE DI ATTIVITA DI CORREZIONE DI BOZZE (ATTIVITA ESONUCLEASICA 3-5 )

25 FIGURA 4.7A GENOMI II

26 FIGURA GENOMI II

27 FIGURA 4.7B-C GENOMI II

28 FIGURA 4.4A GENOMI II

29 ANCHE SE DOTATE DI ATTIVITA DI CORREZIONE DI BOZZE, LE DNA POLIMERASI NON SEMPRE RICONOSCONO L ERRONEA INCORPORAZIONE DI UN NUCLEOTIDE. CONSEGUENTEMENTE, LA REPLICAZIONE DEL DNA PUO GENERARE MUTAZIONI, CIOE ALTERAZIONI DELLA SEQUENZA NUCLEOTIDICA. LA DNA POLIMERASI I DI E.COLI INCORPORA UN NUCLEOTIDE SBAGLIATO OGNI NUCLEOTIDI AGGIUNTI MA CORREGGE L ERRORE NEL 99 % DEI CASI. CONSEGUENTEMENTE, IL TASSO DI ERRORE E 1/

30 NEL 1969 OKAZAKI DIMOSTRA CHE LA REPLICAZIONE DEL DNA E SEMIDISCONTINUA. TALE FENOMENO E CONSEGUENZA DELLA DIREZIONALITA DI SINTESI DEL DNA DA PARTE DELLE DNA POLIMERASI.

31 FIGURA GENOMI II

32 NEL 1969 OKAZAKI PUBBLICO I RISULTATI DELLE SUE RICERCHE SULLA PRESTIGIOSA RIVISTA PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA (PNAS USA)

33 PER CONVENZIONE SI CONSIDERA CHE LA REPLICAZIONE DI UNA MOLECOLA DI DNA SIA COMPOSTA DA 3 FASI: INIZIO, ALLUNGAMENTO E TERMINAZIONE.

34 FIGURA 13.7A GENOMI II

35 FIGURA 13.8 GENOMI II (245 bp) GATCTNTTNTTTT TT(A/T)T(A/C)CA(A/C)A

36 COSA ACCOMUNA QUESTE SEQUENZE NUCLEOTIDICHE? GAAGATTTCAGATGATCATTGGAGTGATC AGTCTGAGCAGAAGACCATCTTGCACCCT CTCTCCCACAGACGATCATAAACTTGGGG AGTCTGAGCAGAAGACCATCTTGCACCCT

37 COSA ACCOMUNA QUESTE SEQUENZE NUCLEOTIDICHE? GAAGATTTCAGATGATCATTGGAGTGATC AGTCTGAGCAGAAGACCATCTTGCACCCT CTCTCCCACAGACGATCATAAACTTGGGG AGTCTGAGCAGAAGACCATCTTGCACCCT MOTIVO: CAGANGAYCAT

38 RIPETIZIONI DIRETTE ED INVERTITE 5 CATGCGGAAATGCAAATGCGGAGCATAC3 3 GTACGCCTTTACGTTTACGCCTCGTATG5

39 FIGURA 13.12A GENOMI II

40 TABELLA 13.2 GENOMI

41 FIGURA GENOMI II

42 LA DNA POLIMERASI III DI E. COLI OPERA IN FORMA DIMERICA, COPIANDO CONTEMPORANEAMENTE SIA IL FILAMENTO GUIDA CHE IL FILAMENTO TARDIVO.

43 FIGURA GENOMI II

44 FIGURA GENOMI II

45 FIGURA 13.7A GENOMI II

46 FIGURA GENOMI II

47 LA REPLICAZIONE DEL DNA CIRCOLARE DI E. COLI SI CONCLUDE SEMPRE IN UNA REGIONE DEFINITA CARATTERIZZATA DALLA PRESENZA DI SEQUENZE DI TERMINAZIONE.

48 FIGURA GENOMI III

49 FIGURA 13.7B GENOMI II

50 FIGURA GENOMI II

51 FIGURA 13.12B GENOMI II

52 NESSUNA DNA POLIMERASI EUCARIOTICA HA ATTIVITA ESONUCLEASICA 5-3 : LA RIMOZIONE DELLA COMPONENTE DI RNA DEI FRAMMENTI DI OKAZAKI RICHIEDE L INTERVENTO DI ALTRI ENZIMI.

53 TABELLA 13.2 GENOMI II

54 FIGURA GENOMI II

55 PROCARIOTI: PRIMASI - DNA POLIMERASI III - DNA POLIMERASI I - LIGASI EUCARIOTI: DNA POLIMERASI ALFA - DNA POLIMERASI DELTA (RIBONUCLEASI H) - NUCLEASI FEN1 - LIGASI

56 NEGLI EUCARIOTI NON SONO NOTE SEQUENZE DI TERMINAZIONE EQUIVALENTI AI TERMINATORI BATTERICI. MOLTO PROBABILMENTE LE FORCINE DI REPLICAZIONE SI INCONTRANO IN PUNTI CASUALI.

57 ALCUNE DIFFERENZE SOSTANZIALI TRA REPLICAZIONE DEL DNA GENOMICO IN PROCARIOTI ED EUCARIOTI: NEI PROCARIOTI ESISTE UN UNICA ORIGINE DI REPLICAZIONE, NEGLI EUCARIOTI VE NE SONO MOLTE NEI PROCARIOTI ESISTONO SEQUENZE DI TERMINAZIONE DELLA REPLICAZIONE MENTRE NEGLI EUCARIOTI LE FORCINE DI

58 REPLICAZIONE SI INCONTRANO IN PUNTI CASUALI I FRAMMENTI DI OKAZAKI PROCARIOTICI SONO LUNGHI MIGLIAIA DI BASI, QUELLI EUCARIOTICI CENTINAIA DI BASI NEI PROCARIOTI GLI INNESCHI SONO SINTETIZZATI DALLA PRIMASI, NEGLI EUCARIOTI DA UNA DELLE SUBUNITA DELLA DNA POLIMERASI ALFA

59 NEI PROCARIOTI LE DUE MOLECOLE DI DNA POLIMERASI CHE COPIANO IL FILAMENTO GUIDA E TARDIVO SONO ASSOCIATE IN UN COMPLESSO DIMERICO, NEGLI EUCARIOTI SONO INVECE SEPARATE LA RIMOZIONE DELLA COMPONENTE DI RNA DEI FRAMMENTI DI OKAZAKI E OPERATA DALLA DNA POLIMERASI I NEI PROCARIOTI DALL ENDONUCLEASI FEN1 E/O LA RIBONUCLEASI H NEGLI EUCARIOTI

60 LA REPLICAZIONE DEL DNA MITOCONDRIALE UMANO AVVIENE SECONDO MODALITA CHE DIVERGONO DALLO SCHEMA DI SINTESI SEMIDISCONTINUA: REPLICAZIONE PER SPOSTAMENTO OPERATA DALLA DNA POLIMERASI GAMMA.

61 FIGURA 13.6A GENOMI II

62 LA TELOMERASI E UN ENZIMA CHE HA IL COMPITO DI PRESERVARE L INTEGRITA DEI TELOMERI

63 FIGURA 2.7 GENOMI II

64 I TELOMERI SONO FORMATI DA CIRCA UN MIGLIAIO DI COPIE IN TANDEM DI UNA BREVE SEQUENZA RICCA IN G. NELL UOMO LA SEQUENZA TELOMERICA E 5 -TTAGGG-3

65 FIGURA 2.10 GENOMI II

66 TABELLA 13.3 GENOMI II

67 LE SEQUENZE TELOMERICHE SONO RICONOSCIUTE DA PROTEINE SPECIFICHE, RAPPRESENTATE NELL UOMO DA TRF2. LE PROTEINE TELOMERICHE PROTEGGONO LE ESTREMITA LIBERE DEL DNA CROMOSOMALE DA UN INDEBITA RIPARAZIONE.

68 FIGURA 14.26A GENOMI II

69 LE SEQUENZE TELOMERICHE SONO PER QUESTO MOLTO IMPORTANTI AI FINI DELLA STABILITA DEI CROMOSOMI.

70 LA REPLICAZIONE SEMIDISCONTINUA DEL DNA CROMOSOMALE EUCARIOTICO PRODUCE UN PROGRESSIVO ACCORCIAMENTO DEI TELOMERI.

71 FIGURA 13.24A GENOMI II

72 L ACCORCIAMENTO DEI TELOMERI NELLE CELLULE SOMATICHE NE LIMITA LA CAPACITA PROLIFERATIVA.

73 FIGURA GENOMI II

74 LE CELLULE DI TOPO ENTRANO IN SENESCENZA DOPO 12 MITOSI, QUELLE UMANE DOPO 40 MITOSI. QUESTO LIMITE NON INFLUENZA LO STATO FUNZIONALE DI ORGANI E TESSUTI PER L ESISTENZA DI CELLULE STAMINALI. QUESTE ULTIME SONO CELLULE PROGENITRICI INDIFFERENZIATE CHE CONTINUANO A DIVIDERSI PER TUTTA LA VITA DI UN ORGANISMO MANTENENDO L INTEGRITA STRUTTURALE E FUNZIONALE DI ORGANI E TESSUTI.

75 LE CELLULE STAMINALI NON INVECCHIANO ANCHE PERCHE PROVVISTE DI UN ENZIMA, LA TELOMERASI, CHE OPERA IL RIPRISTINO DELLE SEQUENZE TELOMERICHE.

76 FIGURA GENOMI II

77 FIGURA GENOMI II

78 LE TELOMERASI SONO ANCHE ATTIVE NELLE CELLULE RIPRODUTTIVE PER EVITARE CHE LA PROGENIE EREDITI CROMOSOMI GIA INVECCHIATI. IN DEFINITIVA, LE TELOMERASI SONO ESPRESSE DURANTE LO SVILUPPO EMBRIONALE E, DOPO LA NASCITA, NELLE CELLULE STAMINALI E RIPRODUTTIVE. INFINE, LE TELOMERASI RISULTANO ATTIVE IN MOLTE CELLULE TUMORALI CHE IN QUESTO MODO POSSONO SUPERARE IL LIMITE DELLE 40 MITOSI.

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

DNA e replicazione del DNA

DNA e replicazione del DNA DNA e replicazione del DNA 1928: EXP di Griffith Scoperto il fattore trasformante Struttura elicoidale del DNA Struttura del DNA Subunità nucleotidiche Struttura del DNA Subunità nucleotidiche La replicazione

Dettagli

Quanto DNA è contenuto in una cellula?...

Quanto DNA è contenuto in una cellula?... Quanto DNA è contenuto in una cellula?... bp = Base Pair (coppie di basi) lungh DNA/lungh struttura ospitante E. coli: 4,6x10 6 bp (1,7 mm) 850 (unica molecola circolare) Cellula umana: 3,2x10 9 bp (~2

Dettagli

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

LA REPLICAZIONE DEL DNA

LA REPLICAZIONE DEL DNA www.fisiokinesiterapia.biz LA REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA Durante il processo di replicazione la doppia elica del DNA si srotola e ciascuno dei due filamenti funziona da stampo per un nuovo

Dettagli

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Ciclo cellulare Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Arthur Kornberg, 1970 Replicazione

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

MODALITA DI REPLICAZIONE

MODALITA DI REPLICAZIONE MODALITA DI REPLICAZIONE In teoria è ipotizzabile che il DNA possa duplicarsi con modalità: 1) semi-conservativa se alla generazione successiva passano due doppie eliche entrambi costituite da un'elica

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

Legami idrogeno tra le coppie di basi

Legami idrogeno tra le coppie di basi Legami idrogeno tra le coppie di basi 4 3 6 1 4 3 2 6 1 2 Interazioni elettrostatiche deboli che si stabiliscono tra un atomo elettronegativo (es.ossigeno o azoto) e un atomo di idrogeno legato ad un secondo

Dettagli

Il modello del Replicone

Il modello del Replicone Il modello del Replicone Il replicone copre l intera regione di DNA replicata a partire da una singola origine di replicazione (es. il genoma di E.coli corrisponde ad un singolo replicone). Il replicone

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B2 Il linguaggio della vita 3 Le basi molecolari dell ereditarietà Prima

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

Il processo di ricopiatura, detto replicazione del DNA, deve avvenire perché da una cellula si possano formare 2 cellule figlie geneticamente

Il processo di ricopiatura, detto replicazione del DNA, deve avvenire perché da una cellula si possano formare 2 cellule figlie geneticamente Lezione 5 - La replicazione del DNA 1. Introduzione 2. Modelli ed esperimenti 3. Replicazione nei procarioti 4. Complesso enzimatico 5. Svolgimento del DNA 6. Forcella replicativa 7. Primasi e innesco

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA La chimica della sintesi del DNA DNA polimerasi III La forca replicativa La fase di inizio della replicazione Selezione delle origini replicative La terminazione della replicazione

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 21 La replicazione del DNA Concetti chiave: La DNA polimerasi necessita di uno stampo e di inneschi (i primer) per sintetizzare

Dettagli

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze LA TRASCRIZIONE processo nel quale il DNA stampo viene copiato in una molecola di RNA La molecola di RNA è identica in sequenza all elica codificante e complementare a quella stampo. La trascrizione è

Dettagli

Biologia Molecolare. CDLM in CTF La Replicazione del DNA

Biologia Molecolare. CDLM in CTF La Replicazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La Replicazione del DNA Prospettiva Storica La replicazione semidiscontinua Differenze tra procarioti ed eucarioti E fondamentale che ad ogni divisione cellulare

Dettagli

Come si replica il DNA

Come si replica il DNA Come si replica il DNA Filamenti figli Replicazione semiconservativa Filamento parentale Un emielica di DNA funziona da stampo per la sintesi di un nuovo filamento Filamento parentale L enzima DNA polimerasi

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA CORSO DI GENETICA REPLICAZIONE E COMPOSIZIONE DEL DNA La struttura del DNA La replicazione del DNA Iduefilamenti della doppia elica parentale si srotolano generando ciascuno un filamento figlio secondo

Dettagli

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina DNA e CROMOSOMI Come il DNA si replica, si ripara e ricombina Nel 1928 venne dimostrato che il DNA è il materiale genetico dei batteri (Griffith) Alcune proprietà dei batteri S morti possono trasformare

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Mappa del cromosoma di E. coli in cui sono indicate le posizioni dei geni che codificano proteine importanti per il metabolismo del DNA L esperimento di Meselson e Stahl (1957):

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare.

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Nelle cellule in proliferazione le 4 fasi impiegano dalle 10 20 ore in dipendenza

Dettagli

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin Watson e Crick Rosalind Franklin Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. citochinesi: o citodieresi. Divisione del citoplasma

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 Esperimento di Meselson e Stahl, 1958 La replicazione del DNA e semiconservativa

Dettagli

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio LEZIONE III DUPLICAZIONE DEL DNA Dott. Paolo Cascio DUPLICAZIONE DEL DNA NEI PROCARIOTI LA DUPLICAZIONE DEL CROMOSOMA BATTERICO CIRCOLARE INIZIA IN UN UNICO PUNTO E PROCEDE BIDIREZIONALMENTE FINO A QUANDO

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Interfase. La REPLICAZIONE del DNA

Interfase. La REPLICAZIONE del DNA Interfase La REPLICAZIONE del DNA REPLICAZIONE del DNA Doppia elica parentale Il modello di replicazione del DNA ipotizzato da Watson e Crick è basato sulla complementarietà delle basi dei due filamenti

Dettagli

Telomeri e Telomerasi:

Telomeri e Telomerasi: Telomeri e Telomerasi: 1 I cromosomi eucariotici sono molecole lineari, a doppio filamento, che terminano generalmente con un segmento di 10000 coppie di basi, costituito da piccole sequenze nucleotidiche

Dettagli

C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC.

C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC. SOLUZIONI AI PROBLEMI DEL CAPITOLO 11 Domande concettuali C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC. C2. Per replicazione bidirezionale si intende la replicazione

Dettagli

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI IL MATERIALE GENETICO Fino agli anni 40 si credeva che le proteine fossero le molecole della informazione ereditaria. C erano comunque

Dettagli

Replicazione e ricombinazione del DNA

Replicazione e ricombinazione del DNA DNA Replication DNA Replication II Replicazione e ricombinazione del DNA La replicazione semiconservativa Tre modelli proposti per la replicazione del DNA La replicazione è semiconservativa: ogni frammento

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 Esperimento di Meselson e Stahl, 1958 La replicazione del DNA e semiconservativa

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti?

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Domande Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Tre modelli di replicazione del DNA Meselson e Stahl 1958 http://www.youtube.com/watch?v=kybdh8vpigk

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi.

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Ogni cellula contiene un organello, il NUCLEO, all interno

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

Gli Acidi Nucleici DNA RNA

Gli Acidi Nucleici DNA RNA Gli Acidi Nucleici DNA RNA Gli Acidi nucleici Gli acidi nucleici sono il: DNA (acido desossiribonucleico) RNA (acido ribonucleico) Essi sono formati dai polimeri (molecole molto grosse) i cui monomeri

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie Lezione 1 Il clonaggio 2 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

La sua struttura è stata determinata da Watson e Crick nel 1953.

La sua struttura è stata determinata da Watson e Crick nel 1953. DNA La sua struttura è stata determinata da Watson e Crick nel 1953. NUCLEOTIDI Componenti fondamentali degli acidi nucleici. Costituiti da 3 parti: 1. Uno zucchero a 5 atomi di C: nel DNA è il deossiribosio;

Dettagli

Il DNA è il materiale ereditario e non le proteine

Il DNA è il materiale ereditario e non le proteine DNA -Come è stato scoperto -Quali sono le sue funzioni Il DNA è il materiale ereditario e non le proteine Esperimento di Griffith 1928 Streptococcus pneumoniae S(smooth) capsulato virulento R(rough) acapsulato

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A LICEO SCIENTIFICO STATALE «GALILEO GALILEI» Via Ceresina 17 - Tel. 049 8974487 Fax 049 8975750 35030 SELVAZZANO DENTRO (PD) ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc.

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc. estremità 5' 5 3 - P N 5 2 C 3 ponte fosfodiestere P A 1 2 C 5 P 3 G N 1 2 C 5 3 P T N 1 5 2 C 3 etc. DNA C N 1 estremità 3' zucchero N 1 C 3 4 3 timina N adenina N N 1 6 N N 9 N zucchero N zucchero citosina

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich.

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich. I cromosomi I cromosomi 1400 nm Modello di Saitoh and Laemmli Anse di cromatina piccole o lunghe G loops R loops G loops R loops Protein scaffold SARs AT-rich Scaffold AT-queue Chromatid fibers Anse piccole

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Corso di Genetica per Scienze per l Ambiente e la Natura Alberto Pallavicini La replicazione semiconservativa del DNA Quando Watson e Crick proposero il loro modello della doppia

Dettagli

Struttura e replicazione del DNA

Struttura e replicazione del DNA Struttura e replicazione del DNA La struttura del DNA e stata chiarita nel 1953 ad opera di Watson e Crick A quel tempo si sapeva che: - I geni erano fattori ereditari (Mendel) - I geni controllano la

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

La Terminazione della Trascrizione

La Terminazione della Trascrizione La Terminazione della Trascrizione I geni batterici possiedono dei terminatori della trascrizione. I Terminatori sono sequenze dell RNA che promuovono il distacco dell RNA polimerasi dal templato Ne esistono

Dettagli

Principi di biologia molecolare dei microrganismi

Principi di biologia molecolare dei microrganismi Principi di biologia molecolare dei microrganismi I genomi microbici La conoscenza della sequenza completa del genoma di un organismo è importante per comprendere: 1. come l organismo funzioni 2. quale

Dettagli

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Basi biologiche delle malattie Genetica delle neoplasie Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Samantha Messina 2017 GENETICA DELLE NEOPLASIE Ciclo - alterazione dei meccanismi

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006)

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006) L Era Genomica Il 1995, data della pubblicazione del primo genoma procariotico (Haemophilus influenzae) segna l inizio dell era genomica. A partire da quella data molti altri genomi procariotici ed eucariotici

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

MODELLO SCHEDA INSEGNAMENTO

MODELLO SCHEDA INSEGNAMENTO Corso di Laurea Denominazione insegnamento: Numero di Crediti: Anno: Semestre: Docente Titolare: MODELLO SCHEDA INSEGNAMENTO Triennale in Scienze Biologiche Biologia molecolare 9 CFU II II Lina Sabatino

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente:

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente: Materiale Didattico Titolo modulo: Biologia applicata alla ricerca Biomedica LA TRASCRIZIONE Docente: FLUSSI DI INFORMAZIONE ATTRAVERSO LA CELLULA 1. Accessibilità del genoma 2. Assemblaggio del complesso

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici

Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici T.A. Brown Genomi 3 Capitolo 8: Genomi dei procarioti e degli organelli eucariotici Chapter 2_Genome Anatomies http://www.ncbi.nlm.nih.gov/books/nbk21112/ Copyright Garland Science 2007 Capitolo 8: Genomi

Dettagli

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

Il DNA: struttura e replicazione

Il DNA: struttura e replicazione Il DNA: struttura e replicazione «La fortuna favorisce una mente preparata» L. Pasteur Il cancro al testicolo consiste di divisioni rapide e incontrollate delle cellule germinali. Si diffonde ad altri

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

Numero di CFU Lezioni frontali. Laboratori Esercitazioni Obiettivi formativi del corso

Numero di CFU Lezioni frontali. Laboratori Esercitazioni Obiettivi formativi del corso Corso di Laurea (o Laurea Magistrale): BIOTECNOLOGIE Nome del corso: Biologia Molecolare e Microbiologia Modulo I Biologia Molecolare Modulo II Microbiologia generale ed analitica Responsabile del corso

Dettagli

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,

Dettagli

CORSO DI BIOLOGIA - Programma

CORSO DI BIOLOGIA - Programma CORSO DI BIOLOGIA - Programma 1. Nozioni introduttive: Le macromolecole biologiche: proteine, lipidi, carboidrati ed acidi nucleici Organizzazione cellulare in procarioti ed eucarioti 2. Struttura e funzione

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli

Enzimi di restrizione. di Vittorio Scornaienchi

Enzimi di restrizione. di Vittorio Scornaienchi Enzimi di restrizione di Vittorio Scornaienchi Generalità Nucleasi Le nucleasi sono enzimi che tagliano i legami sui filamenti degli acidi nucleici: 5. Le esonucleasi aggrediscono una delle estremità libere

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli