Replicazione e ricombinazione del DNA

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Replicazione e ricombinazione del DNA"

Transcript

1 DNA Replication

2 DNA Replication II

3 Replicazione e ricombinazione del DNA La replicazione semiconservativa Tre modelli proposti per la replicazione del DNA La replicazione è semiconservativa: ogni frammento di DNA serve da stampo per la sintesi di una nuova molecola di DNA

4 Esperimento di Meselson e Stahl - centrifugazione in gradiente di densità all equilibrio per distinguere DNA contenente 14N pesante e DNA 15N più leggero

5

6

7

8 DEFINIZIONI e TERMINOLOGIA: Replicone= unità di replicazione con propria origine di replicazione. Origine di replicazione=zona specifica del cromosoma dove le doppia elica si denatura in singoli filamenti, esponendo le basi per la sintesi di nuove eliche. Bolla di replicazione:regione del cromosoma dove il DNA è a singole elica e dal quale la replicazione procede in modo bidirezionale.

9 Le modalità di replicazione 1. La replicazione teta Comune in E.Coli e in altri organismi con DNA circolare

10 2. La replicazione a circolo rotante Comune in alcuni virus e nel fattore F di E.coli

11 3. La replicazione lineare negli eucarioti Requisiti per la replicazione: -stampo di DNA a singolo filamento -substrati da assemblare nel filamento di neoformazione -enzimi e altre proteine che leggono lo stampo e assemblano i substrati

12

13

14 La direzione della replicazione

15 La sintesi del DNA è continua su un filamento di DNA stampo e discontinua sull altro

16

17 Modello teta Modello circolo rotante Replicazione lineare

18 La replicazione del DNA batterico - L INIZIO In E.coli la replicazione ha inizio quando le proteine iniziatrici si legano a oric, l origine di replicazione, provocando lo svolgimento di un breve tratto di DNA.

19 - LO SVOLGIMENTO La DNA elicasi svolge il DNA legandosi al filamento ritardato che funge da stampo a livello di ogni forcella di replicazione e muovendosi in direzione 5 3 lungo il filamento.

20 - GLI INNESCHI e L ALLUNGAMENTO La primasi sintetizza brevi tratti nucleotidici di RNA, fornendo un gruppo 3 -OH a cui la DNA polimerasi può aggiungere nucleotidi di DNA.

21

22

23 DNA Polymerase III The "real" polymerase in E. coli At least 10 different subunits "Core" enzyme has three subunits - α, ε, and θ Alpha subunit is polymerase Epsilon subunit is 3'-exonuclease Theta function is unknown The beta subunit dimer forms a ring around DNA Enormous processivity - 5 million bases!

24 DNA Polymerase I Replication occurs 5' to 3' Nucleotides are added at the 3'-end of the strand Pol I catalyzes about 20 cycles of polymerization before the new strand dissociates from template 20 cycles constitutes moderate "processivity" Pol I from E. coli is 928 aa (109 kd) monomer In addition to 5'-3' polymerase, it also has 3'-5' exonuclease and 5'-3' exonuclease activities

25 - La DNA LIGASI La DNA ligasi chiude l interruzione lasciata dalla DNA polimerasi I nello scheletro di zucchero-fosfato dopo che quest ultima ha aggiunto il nucleotide finale.

26 - LA FORCELLA DI REPLICAZIONE Modello di replicazione del DNA in E.coli: le due unità della DNA pol III sono connesse e il filamento ritardato che funge da stampo forma un anello tale che la replicazione possa avere luogo sui due filamenti di DNA antiparalleli.

27 - LA FEDELTA DELLA REPLICAZIONE DEL DNA -selezione dei nucleotidi -correzione di bozze -riparazione dei malappaiamenti

28 Other Proteins That Assist DNA Replication Helicase, topoisomerase, single-strand binding protein Table 16.1

29

30 La replicazione del DNA negli eucarioti Microfotografia elettronica di DNA eucariotico durante il processo della replicazione: il DNA neosintetizzato è già coperto da nucleosomi

31 Polimerasi nei Procarioti I Procarioti possiedono cinque tipi di DNA Polimerasi: DNA Polimerasi I: implicata nella riparazione del DNA e nella rimozione degli inneschi dei frammenti di Okazaki. Possiede attività esonucleasica sia in direzione 5'->3', sia in direzione 3'->5' DNA Polimerasi II: indotta da danni al DNA per riparazione incline all'errore (error-prone). Ha attività polimerasica 5'->3' ed esonucleasica 3'->5' DNA Polimerasi III: l'enzima principale per la replicazione, con attività polimerasica 5'->3' ed esonucleasica (nella correzione di bozze, o proofreading) 3'->5'. Attiva sia nella sintesi del filamento leading, sia in quella dei frammenti di Okazaki. DNA Polimerasi IV-V: anch'esse coinvolte nella riparazione incline all'errore

32 Polimerasi negli Eucarioti Le Polimerasi degli Eucarioti sono costituite invece da: DNA Polimerasi α: è una primasi (enzima che sintetizza i primer di RNA) e procede inoltre all'allungamento dei primer con alcune centinaia di deossiribonucleotidi. DNA Polimerasi δ: l'enzima principale della replicazione eucariotica. Sintetizza sia il filamento leading, sia il filamento lagging. Riempie inoltre le interruzioni tra i frammenti di Okazaki. DNA Polimerasi β: coinvolta nella riparazione del DNA DNA Polimerasi γ: replica il DNA mitocondriale DNA Polimerasi ε: stessa funzione della Polimerasi δ.

33

34

35 Prokaryotes Eukaryotes 5 polymerases (I, II, III, IV,V) 5 polymerases--α,β,γ,δ,ε I--excision repair, removal of RNA primers II-repair III-main enzyme IV,V-repair, special conditions polymerases also exonucleases α--polymerization β--repair γ--mitochondrial δ-main enzyme ε--unknown not all exonucleases 1 Origin of replication many origins Okazaki fragments nuc. no proteins on DNA Okazaki fragments nuc. histones

36

37

38 Tipo di organismo Nome scientifico Ripetizione telomerica (direzione 5' -> 3') Vertebrati Homo sapiens, Mus musculus, Xenopus laevis TTAGGG Funghi Neurospora crassa, Physarum, Didymium TTAGGG Protisti Dictyostelium discoideum AG(1-8) Kinetoplastea (protozoi) Trypanosoma, Crithidia TTAGGG protozoi ciliati Tetrahymena, Glaucoma Paramecium Oxytricha, Stylonychia, Euplotes TTGGGG TTGGG(T/G) TTTTGGGG Apicomplexa Plasmodium TTAGGG(T/C) Piante superiori Arabidopsis thaliana TTTAGGG Alghe verdi Chlamydomonas TTTTAGGG Insetti Bombyx mori TTAGG Anellidi Ascaris lumbricoides TTAGGC Lieviti a scissione binaria Schizosaccharomyces pombe TTAC(A)(C)G(1-8) Lieviti gemmanti Saccharomyces cerevisiae Candida glabrata Candida albicans Candida tropicalis Candida maltosa Candida guillermondii Candida pseudotropicalis Kluyveromyces lactis TGTGGGTGTGGTG (da stampo RNA) o G(2-3)(TG)(1-6)T (sequenza consenso) GGGGTCTGGGTGCTG GGTGTACGGATGTCTAACTTCTT GGTGTA[C/ A]GGATGTCACGATCATT GGTGTACGGATGCAGACTCGCTT GGTGTAC GGTGTACGGATTTGATTAGTTATG T GGTGTACGGATTTGATTAGGTATG T

39

40

41

42 Modello di Holliday:rottura singolo filamento

43 Rottura doppio filamento

44

45

46

47

48

49

50

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

DNA e replicazione del DNA

DNA e replicazione del DNA DNA e replicazione del DNA 1928: EXP di Griffith Scoperto il fattore trasformante Struttura elicoidale del DNA Struttura del DNA Subunità nucleotidiche Struttura del DNA Subunità nucleotidiche La replicazione

Dettagli

LA REPLICAZIONE DEL DNA

LA REPLICAZIONE DEL DNA www.fisiokinesiterapia.biz LA REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA Durante il processo di replicazione la doppia elica del DNA si srotola e ciascuno dei due filamenti funziona da stampo per un nuovo

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

Biologia Molecolare. CDLM in CTF La Replicazione del DNA

Biologia Molecolare. CDLM in CTF La Replicazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La Replicazione del DNA Prospettiva Storica La replicazione semidiscontinua Differenze tra procarioti ed eucarioti E fondamentale che ad ogni divisione cellulare

Dettagli

MODALITA DI REPLICAZIONE

MODALITA DI REPLICAZIONE MODALITA DI REPLICAZIONE In teoria è ipotizzabile che il DNA possa duplicarsi con modalità: 1) semi-conservativa se alla generazione successiva passano due doppie eliche entrambi costituite da un'elica

Dettagli

REPLICAZIONE DEI GENOMI A DNA

REPLICAZIONE DEI GENOMI A DNA REPLICAZIONE DEI GENOMI A DNA LA REPLICAZIONE DEL DNA SERVE A PERPETUARE L INFORMAZIONE GENICA FIGURA 12.26 GENES VII FIGURA 13.1 GENOMI II FIGURA 13.2 GENOMI II NEL 1958 MESELSON E STAHL DIMOSTRANO CHE

Dettagli

Quanto DNA è contenuto in una cellula?...

Quanto DNA è contenuto in una cellula?... Quanto DNA è contenuto in una cellula?... bp = Base Pair (coppie di basi) lungh DNA/lungh struttura ospitante E. coli: 4,6x10 6 bp (1,7 mm) 850 (unica molecola circolare) Cellula umana: 3,2x10 9 bp (~2

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE

IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 Esperimento di Meselson e Stahl, 1958 La replicazione del DNA e semiconservativa

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

Legami idrogeno tra le coppie di basi

Legami idrogeno tra le coppie di basi Legami idrogeno tra le coppie di basi 4 3 6 1 4 3 2 6 1 2 Interazioni elettrostatiche deboli che si stabiliscono tra un atomo elettronegativo (es.ossigeno o azoto) e un atomo di idrogeno legato ad un secondo

Dettagli

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958

LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA. Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 LA REPLICAZIONE DEL DNA E SEMICONSERVATIVA Esperimenti di Taylor in eucarioti 1957 Esperimento di Meselson e Stahl in procarioti, 1958 Esperimento di Meselson e Stahl, 1958 La replicazione del DNA e semiconservativa

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi.

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Ogni cellula contiene un organello, il NUCLEO, all interno

Dettagli

Interfase. La REPLICAZIONE del DNA

Interfase. La REPLICAZIONE del DNA Interfase La REPLICAZIONE del DNA REPLICAZIONE del DNA Doppia elica parentale Il modello di replicazione del DNA ipotizzato da Watson e Crick è basato sulla complementarietà delle basi dei due filamenti

Dettagli

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006

Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Replicazione Ciclo cellulare Lewin, IL GENE VIII, Zanichelli editore S.p.A. Copyright 2006 Arthur Kornberg, 1970 Replicazione

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare.

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. Nelle cellule in proliferazione le 4 fasi impiegano dalle 10 20 ore in dipendenza

Dettagli

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 4. Watson e Crick. Rosalind Franklin Watson e Crick Rosalind Franklin Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare. citochinesi: o citodieresi. Divisione del citoplasma

Dettagli

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio

LEZIONE III DUPLICAZIONE DEL DNA. Dott. Paolo Cascio LEZIONE III DUPLICAZIONE DEL DNA Dott. Paolo Cascio DUPLICAZIONE DEL DNA NEI PROCARIOTI LA DUPLICAZIONE DEL CROMOSOMA BATTERICO CIRCOLARE INIZIA IN UN UNICO PUNTO E PROCEDE BIDIREZIONALMENTE FINO A QUANDO

Dettagli

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI

CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI CERCATE SU YOU TUBE I FILMATI DI BIOLOGIA CE NE SONO DI TUTTI I TIPI IL MATERIALE GENETICO Fino agli anni 40 si credeva che le proteine fossero le molecole della informazione ereditaria. C erano comunque

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Mappa del cromosoma di E. coli in cui sono indicate le posizioni dei geni che codificano proteine importanti per il metabolismo del DNA L esperimento di Meselson e Stahl (1957):

Dettagli

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti?

Domande. Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Domande Come avviene la replicazione del DNA? Quali enzimi sono necessari? Quali sono le differenze fra procarioti ed Eucarioti? Tre modelli di replicazione del DNA Meselson e Stahl 1958 http://www.youtube.com/watch?v=kybdh8vpigk

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

Il processo di ricopiatura, detto replicazione del DNA, deve avvenire perché da una cellula si possano formare 2 cellule figlie geneticamente

Il processo di ricopiatura, detto replicazione del DNA, deve avvenire perché da una cellula si possano formare 2 cellule figlie geneticamente Lezione 5 - La replicazione del DNA 1. Introduzione 2. Modelli ed esperimenti 3. Replicazione nei procarioti 4. Complesso enzimatico 5. Svolgimento del DNA 6. Forcella replicativa 7. Primasi e innesco

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 21 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 21 La replicazione del DNA Concetti chiave: La DNA polimerasi necessita di uno stampo e di inneschi (i primer) per sintetizzare

Dettagli

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina DNA e CROMOSOMI Come il DNA si replica, si ripara e ricombina Nel 1928 venne dimostrato che il DNA è il materiale genetico dei batteri (Griffith) Alcune proprietà dei batteri S morti possono trasformare

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA CORSO DI GENETICA REPLICAZIONE E COMPOSIZIONE DEL DNA La struttura del DNA La replicazione del DNA Iduefilamenti della doppia elica parentale si srotolano generando ciascuno un filamento figlio secondo

Dettagli

Acidi Nucleici. Contenuto:

Acidi Nucleici. Contenuto: Acidi Nucleici Contenuto: Il DNA e' l'unica molecola depositaria dell'informazione genetica, ossia del progetto nel quale sono immagazzinate istruzioni precise per tutte le caratteristiche ereditarie autoduplicazione

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B2 Il linguaggio della vita 3 Le basi molecolari dell ereditarietà Prima

Dettagli

C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC.

C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC. SOLUZIONI AI PROBLEMI DEL CAPITOLO 11 Domande concettuali C1. E' una struttura a doppio filamento che segue la regola dell'appaiamento AT/GC. C2. Per replicazione bidirezionale si intende la replicazione

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

Il modello del Replicone

Il modello del Replicone Il modello del Replicone Il replicone copre l intera regione di DNA replicata a partire da una singola origine di replicazione (es. il genoma di E.coli corrisponde ad un singolo replicone). Il replicone

Dettagli

Il DNA è il materiale ereditario e non le proteine

Il DNA è il materiale ereditario e non le proteine DNA -Come è stato scoperto -Quali sono le sue funzioni Il DNA è il materiale ereditario e non le proteine Esperimento di Griffith 1928 Streptococcus pneumoniae S(smooth) capsulato virulento R(rough) acapsulato

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

La sua struttura è stata determinata da Watson e Crick nel 1953.

La sua struttura è stata determinata da Watson e Crick nel 1953. DNA La sua struttura è stata determinata da Watson e Crick nel 1953. NUCLEOTIDI Componenti fondamentali degli acidi nucleici. Costituiti da 3 parti: 1. Uno zucchero a 5 atomi di C: nel DNA è il deossiribosio;

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA La chimica della sintesi del DNA DNA polimerasi III La forca replicativa La fase di inizio della replicazione Selezione delle origini replicative La terminazione della replicazione

Dettagli

Gli Acidi Nucleici DNA RNA

Gli Acidi Nucleici DNA RNA Gli Acidi Nucleici DNA RNA Gli Acidi nucleici Gli acidi nucleici sono il: DNA (acido desossiribonucleico) RNA (acido ribonucleico) Essi sono formati dai polimeri (molecole molto grosse) i cui monomeri

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Corso di Genetica per Scienze per l Ambiente e la Natura Alberto Pallavicini La replicazione semiconservativa del DNA Quando Watson e Crick proposero il loro modello della doppia

Dettagli

Come si replica il DNA

Come si replica il DNA Come si replica il DNA Filamenti figli Replicazione semiconservativa Filamento parentale Un emielica di DNA funziona da stampo per la sintesi di un nuovo filamento Filamento parentale L enzima DNA polimerasi

Dettagli

3 Acidi Nucleici : Il RNA può essere catalitico

3 Acidi Nucleici : Il RNA può essere catalitico Caratteristiche Distintive del DNA e del RNA ACIDI NUCLEICI http://www.genome.gov/dmd/img.cfm?node=photos/graphics&id=85209 3 DNA RNA Proteina Il DNA è una molecola informativa. L informazione è immagazzinata

Dettagli

Struttura e replicazione del DNA

Struttura e replicazione del DNA Struttura e replicazione del DNA La struttura del DNA e stata chiarita nel 1953 ad opera di Watson e Crick A quel tempo si sapeva che: - I geni erano fattori ereditari (Mendel) - I geni controllano la

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze LA TRASCRIZIONE processo nel quale il DNA stampo viene copiato in una molecola di RNA La molecola di RNA è identica in sequenza all elica codificante e complementare a quella stampo. La trascrizione è

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

ACIDI NUCLEICI.

ACIDI NUCLEICI. ACIDI NUCLEICI http://www.link2universe.net/wp-content/uploads/2012/11/dna-rna.jpgics&id=85209 3 DNA RNA Proteina Il DNA è una molecola informativa. L informazione è immagazzinata nell ordine in cui sono

Dettagli

Indice. Prefazione MODULO A DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1

Indice. Prefazione MODULO A DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 Indice Prefazione V MODULO A DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2

Dettagli

CAPITOLO 10. La biosintesi degli acidi nucleici: la replicazione. 10.1 Il flusso dell informazione genetica nella cellula

CAPITOLO 10. La biosintesi degli acidi nucleici: la replicazione. 10.1 Il flusso dell informazione genetica nella cellula La biosintesi degli acidi nucleici: la replicazione CAPITL 10 10.1 Il flusso dell informazione genetica nella cellula La sequenza di basi nel DNA codifica l informazione genetica. La duplicazione del DNA,

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

DNA Replication Direction of replication New strands are always synthesized in the 5' to 3' direction. The 5' triphosphate can only be added to a free 3'OH of deoxyribose There is a major difference between

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

Telomeri e Telomerasi:

Telomeri e Telomerasi: Telomeri e Telomerasi: 1 I cromosomi eucariotici sono molecole lineari, a doppio filamento, che terminano generalmente con un segmento di 10000 coppie di basi, costituito da piccole sequenze nucleotidiche

Dettagli

LE BASI AZOTATE PIRIMIDINE PURINE

LE BASI AZOTATE PIRIMIDINE PURINE LE BASI AZTATE PURIE PIRIMIDIE Le basi azotate sono composti eterociclici aromatici con azoti portanti doppietti basici. Possono avere un solo anello (pirimidine) o due (purine). Le basi adenina, guanina

Dettagli

Metabolismo, crescita e riproduzione batterica

Metabolismo, crescita e riproduzione batterica Metabolismo, crescita e riproduzione batterica 1 Ossigeno (presente o assente) Nutrienti (energia) Temperatura ottimale ph ottimale 2 OSSIGENO 1. Aerobi obbligati 2. Anaerobi obbligati 3. Aerobi/Anaerobi

Dettagli

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc.

estremità 5' DNA O - P O H 2 C O H H H H G N H O H 2 C P O H H T N ponte fosfodiestere O 3 P O estremità 3' etc. estremità 5' 5 3 - P N 5 2 C 3 ponte fosfodiestere P A 1 2 C 5 P 3 G N 1 2 C 5 3 P T N 1 5 2 C 3 etc. DNA C N 1 estremità 3' zucchero N 1 C 3 4 3 timina N adenina N N 1 6 N N 9 N zucchero N zucchero citosina

Dettagli

Interazioni DNA-proteina

Interazioni DNA-proteina Interazioni DNA-proteina Leucine Zipper - YouTube [freecorder.com].flv Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione

Dettagli

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006)

L Era Genomica. Da: Binnewies et et al. (Funct. Integr. Genomics 6: , 2006) L Era Genomica Il 1995, data della pubblicazione del primo genoma procariotico (Haemophilus influenzae) segna l inizio dell era genomica. A partire da quella data molti altri genomi procariotici ed eucariotici

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

CARIOLOGIA. 4.1 Introduzione. 4.2 Cromatina e cromosomi

CARIOLOGIA. 4.1 Introduzione. 4.2 Cromatina e cromosomi 4 CARIOLOGIA 4.1 Introduzione Nel capitolo precedente abbiamo visto che il progetto biologico di ogni organismo vivente è contenuto nel suo DNA, un composto organico la cui molecola è dotata di proprietà

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

La replicazione del DNA

La replicazione del DNA La replicazione del DNA Modelli proposti per la replicazione del DNA Alla fine degli anni 1950 erano stati proposti tre modelli per la replicazione del DNA Modello Conservativo Entrambe le eliche parentali

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

La velocità di crescita è influenzata anche dai fattori abiotici. Ci vogliono anche le condizioni fisiche o chimiche adatte

La velocità di crescita è influenzata anche dai fattori abiotici. Ci vogliono anche le condizioni fisiche o chimiche adatte La velocità di crescita è influenzata anche dai fattori abiotici Anche per i microrganismi il cibo non è tutto... Ci vogliono anche le condizioni fisiche o chimiche adatte... temperatura ph Terreno disidratato

Dettagli

Principi di biologia molecolare dei microrganismi

Principi di biologia molecolare dei microrganismi Principi di biologia molecolare dei microrganismi I genomi microbici La conoscenza della sequenza completa del genoma di un organismo è importante per comprendere: 1. come l organismo funzioni 2. quale

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

CORSO DI BIOLOGIA - Programma

CORSO DI BIOLOGIA - Programma CORSO DI BIOLOGIA - Programma 1. Nozioni introduttive: Le macromolecole biologiche: proteine, lipidi, carboidrati ed acidi nucleici Organizzazione cellulare in procarioti ed eucarioti 2. Struttura e funzione

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE BIOLOGIA MOLECOLARE DEGLI EUCARIOTI Roberto Giacominelli Stuffler 1. I geni ed il DNA degli eucarioti 2. La replicazione, la trascrizione e la

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi Il DNA Il DNA è una sostanza che si trova in ogni cellula e contiene tutte le informazioni sulla forma e sulle funzioni di ogni essere vivente: eppure è una molecola incredibilmente semplice. COME È FATTO?

Dettagli

DNA batterico. Nei batteri le mutazioni possono essere indotte e/o spontanee

DNA batterico. Nei batteri le mutazioni possono essere indotte e/o spontanee DNA batterico Il DNA batterico si replica in modo semiconservativo, utilizzando entrambi i filamenti come stampo e richiede l intervento di numerosi enzimi. Nei batteri le mutazioni possono essere indotte

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Telomere terminal transferase: telomerase

Telomere terminal transferase: telomerase Telomere terminal transferase: telomerase UNO DEI MAGGIORI QUESITI DI BIOLOGIA DEGLI ULTIMI 25 ANNI: come i cromosomi possono essere copiati completamente durante le divisioni cellulari e come vengono

Dettagli

Lezione 1: Atomi e molecole:

Lezione 1: Atomi e molecole: Lezione 1: Atomi e molecole: La materia è costituita da elementi chimici in forma pura o in combinazioni dette composti. La vita richiede circa 25 elementi chimici. La struttura atomica determina il comportamento

Dettagli

ACIDI NUCLEICI ESPERIMENTI

ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto.

GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto. ceppo S 1 Griffith and Avery 1930 deceduto ceppo R 2 vivo ceppo S ucciso al calore 3 ceppo R 4 vivo ceppo S ucciso al calore deceduto Riproduzione del ceppo S Preparazione del fattore trasformante lisi

Dettagli

Regolazione dell espressione genica nei procarioti: OPERONI

Regolazione dell espressione genica nei procarioti: OPERONI Regolazione dell espressione genica nei procarioti: OPERONI LA REGOLAZIONE DELL ESPRESSIONE GENICA HA LUOGO A LIVELLO DELLA TRASCRIZIONE OPERONE: insieme di geni che vengono trascritti contemporaneamente

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

LA REAZIONE A CATENA DELLA POLIMERASI PCR

LA REAZIONE A CATENA DELLA POLIMERASI PCR LA REAZIONE A CATENA DELLA POLIMERASI PCR INTRODUZIONE Tecnica ideata da Mullis e collaboratori nel 1984 La possibilita' di disporre di quantità virtualmente illimitate di un determinato frammento di DNA,

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

Studio della subunità ε della DNA polimerasi III di Escherichia coli: stabilità e interazione con la subunità polimerasica

Studio della subunità ε della DNA polimerasi III di Escherichia coli: stabilità e interazione con la subunità polimerasica Alma Mater Studiorum Università di Bologna DOTTORATO DI RICERCA Biocatalisi Applicata e Microbiologia Industriale Ciclo XXI Settore scientifico disciplinare di afferenza: CHIM 11 Studio della subunità

Dettagli