Il DNA conserva l informazione genetica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il DNA conserva l informazione genetica"

Transcript

1 Il DNA conserva l informazione genetica

2 Gli esperimenti di Frederick Griffith (1928)

3 Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi nucleici

4 Gli esperimenti di Alfred Hersey e Martha Chase 1953

5 DNA GENI CROMOSOMI CROMATINA GENOMI

6 LA STRUTTURA DEGLI ACIDI NUCLEICI

7 Gli acidi nucleici sono polimeri in cui i monomeri sono i nucleotidi I componenti dei nucleotidi: lo zucchero pentoso la base azotata Il gruppo fosfato

8 I componenti dei nucleotidi: lo zucchero pentoso

9 I componenti dei nucleotidi: le basi azotate

10 I componenti dei nucleotidi: il gruppo fosfato I gruppi fosfato conferiscono al DNA una carica negativa e lo rendono un acido

11 I nucleotidi La base e lo zucchero sono legati tra loro da un legame N-glicosidico che si forma tra il C1 dello zucchero e -l N in posizione 1 delle pirimidine -l N in posizione 9 delle purine Legame N-glicosidico Il gruppo fosfato è sempre unito all atomo di C in posizione 5 dello zucchero

12 Deossiribonucleotidi Deossiadenilato (deossiadenosina 5 -monofosfato) Deossiguanilato (deossiguanosina 5 -monofosfato) Deossitimidilato (deossitimidina 5 -monofosfato) Deossicitidilato (deossicitidina 5 -monofosfato) Simboli: Deossiadenosina Deossiguanosina Deossitimidina (o timidina) Deossicitidina

13 Ribonucleotidi Adenilato (adenosina 5 -monofosfato) Guanilato (guanosina 5 -monofosfato) Timidilato (timidina 5 -monofosfato) Deossicitidilato (citidina 5 -monofosfato) Simboli: Adenosina Guanosina Uridina Citidina

14 Le strutture del DNA La struttura primaria del DNA è la sequenza di nucleotidi che costituiscono la molecola La struttura secondaria è la configurazione tridimensionale stabile di una molecola di DNA La struttura terziaria è il complesso ripiegamento che il DNA genomico è soggetto all interno di una cellula batterica o eucariotica

15 La catena polinucleotidica degli acidi nucleici Ponte fosfodiestere In una catena polinucleotidica i nucleotidi sono connessi da legami covalenti tra il gruppo fosfato del C5 di un nucleotide e il gruppo ossidrilico del C3 di quello successivo, formando un legame fosfodiestere. Lo scheletro covalente degli acidi nucleici è costituito da un alternanza di gruppi fosforici e di residui di pentosio, mentre le basi azotate possono essere considerate come gruppi laterali uniti allo scheletro. Le due estremità di una catena polinucleotidica sono diverse: l estremità 5 è detta anche 5 fosfato, e l estremità 3 è detta anche 3 OH

16 I legami idrogeno nella doppia elica del DNA Timina Adenina Guanina Citosina

17 Le due catene polinucleotidiche di una molecola di DNA: 1. sono tenute insieme da legami idrogeno tra le basi azotate 2. non sono identiche, ma complementari tra loro 3. sono antiparallele: una ha direzione 5 3, l altra 3 5

18 La struttura secondaria del DNA Il modello della doppia elica del DNA di Watson e Crick Il modello originale proponeva che vi fossero 10 coppie di basi oppure 34 Å per ogni giro dell elica. Misure successive hanno dimostrato che in ogni giro d elica vi sono 10,5 coppie di basi e 36 Å.

19 Il solco maggiore e il solco minore del DNA A causa del fatto che i legami glicosidici non sono diametralmente opposti l uno all altro, ciascuna coppia di basi ha un lato più esteso che delimita la scanalatura maggiore e un lato meno esteso che delimita la scanalatura minore

20 Differenze tra DNA e RNA Nel RNA: 1. lo zucchero ribosio 2. la base uracile 3. Il singolo filamento

21 Le varie strutture secondarie del DNA La struttura proposta da Watson e Crick (forma B del DNA) è quella più stabile per una molecola di DNA con sequenza casuale e in condizioni fisiologiche.

22 Forma A Forma B Forma Z direzione dell elica Destrorsa Destrorsa Sinistrorsa Diametro 2,2 nm 2 nm 1,8 nm Coppie di basi per ogni giro d elica Distanza tra base e base Rotazione per coppia di basi Condizioni necessarie per ottenere la struttura Confronto tra le forme A, B e Z del DNA 11 10,5 12 0,26 nm 0,34 nm 0,37 nm 32, H 2 O 75% H 2 O 92% Basi puriniche che si alternano a basi pirimidiniche Aspetto generale Corto e largo Lungo e stretto Allungato e stretto

23 GENOMI E CROMOSOMI

24 L organizzazione del genoma in cromosomi Virus RNA DNA a singolo filamento a doppio filamento lineare circolare Procarioti DNA a doppio filamento lineare circolare Eucarioti nucleo organelli DNA a doppio filamento lineare DNA a doppio filamento circolare

25 Diversi tipi di genomi

26 Il cromosoma nei procarioti rilassato superavvolto

27 I cromosomi negli eucarioti Numero Dimensione Posizione del centromero Pattern di eterocromatina Bandeggio

28 Il numero di cromosomi negli eucarioti è specie-specifico specifico Organismo Specie N coppie di cromosomi Zanzara Culex pipiens 3 Cipolla Allium cepa 8 Rana Rana pipiens 13 Gatto Felis domesticus 19 Topo Mus musculus 20 Uomo Homo sapiens 23 Patata Solanum tuberosum 24 Cavallo Equus caballus 32 Pollo Gallus domesticus 39 Cane Canis familiaris 39

29 Dimensione dei cromosomi negli eucarioti

30 Posizione del centromero (a) telocentrico (b) acrocentrico (c) metacentrico Braccio corto (p) e braccio lungo (q)

31 Pattern di Eterocromatina

32 Cromosomi degli eucarioti: : il cariotipo Bandeggio G Bandeggio Q Bandeggio R

33 I 3 elementi di un cromosoma eucariotico

34 ...ma da cosa sono costituiti i cromosomi? CROMATINA...e da cosa è costituita la cromatina? DNA PROTEINE ISTONICHE PROTEINE NON ISTONICHE

35 La compattazione della cromatina

36 La compattazione della cromatina

37 Struttura del nucleosoma L avvolgimento del DNA attorno al nucleo di un nucleosoma lo rende più compatto di circa sette volte

38 Il nucleosoma

39 Domande Qual è la struttura e la funzione dei seguenti elementi: DNA Cromosomi Cromatina Genoma

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione Il linguaggio della vita 3 Il materiale genetico

Dettagli

L ACQUA E LE SUE PROPRIETÀ

L ACQUA E LE SUE PROPRIETÀ L ACQUA E LE SUE PROPRIETÀ L acqua è una sostanza indispensabile per tutte le forme di vita. Ogni molecola di acqua (H2O) è formata da due atomi di idrogeno e un atomo di ossigeno, uniti tramite due legami

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B2 Il linguaggio della vita 3 Le basi molecolari dell ereditarietà Prima

Dettagli

Nucleotidi e acidi nucleici

Nucleotidi e acidi nucleici Nucleotidi e acidi nucleici I nucleotidi rappresentano la forma di energia corrente che viene utilizzata nelle attività metaboliche. I nucleotidi sono segnali chimici. I nucleotidi sono i componenti strutturali

Dettagli

ACIDI NUCLEICI Il dogma centrale della biologia

ACIDI NUCLEICI Il dogma centrale della biologia ACIDI NUCLEICI Il dogma centrale della biologia DNA RNA PROTEINE DNA POLINUCLEOTIDI NUCLEOTIDI NUCLEOSIDI ZUCCHERI ACIDO FOSFORICO BASI AZOTATE Ribosio 2 deossiribosio PURINE PIRIMIDINE Adenina Guanina

Dettagli

NUCLEO E GENOMA 26/10/15. Funzioni del Nucleo e Ciclo Cellulare DNA: T = A C G. Acido desossiribonucleico (DNA) Acido ribonucleico (RNA)

NUCLEO E GENOMA 26/10/15. Funzioni del Nucleo e Ciclo Cellulare DNA: T = A C G. Acido desossiribonucleico (DNA) Acido ribonucleico (RNA) NUCLEO E GENOMA Funzioni del Nucleo e Ciclo Cellulare Acido desossiribonucleico (DNA) Acido ribonucleico (RNA) Unità del polimero: nucleotide Ogni nucleotide è composto di 3 elementi : zucchero 5C + base

Dettagli

Biologia. Lezione 09/11/2010

Biologia. Lezione 09/11/2010 Biologia Lezione 09/11/2010 Tutte le molecole contenute nelle cellule sono costituite da composti del carbonio Zuccheri Lipidi Proteine Acidi nucleici Polimeri Sono macromolecole formate da unità (MONOMERI)

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

LA GENETICA MOLECOLARE

LA GENETICA MOLECOLARE LA GENETICA MOLECOLARE Obiettivi del corso Studio del genoma Genomica strutturale Genomica funzionale Genomica comparata Studio del trascrittoma Analisi dei profili di espressione Studio del proteoma Proteomica

Dettagli

Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri).

Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri). Gli acidi nucleici sono eteropolimeri lineari costituiti da subunità nucleotidiche (monomeri). Un nucleotide è formato da: uno zucchero: (Ribosio o Deossiribosio), a 5 atomi di carbonio in forma ciclica

Dettagli

NUCLEOTIDI. Hanno la funzione di conservare, trasmettere e modulare l informazione genetica e di tradurla nella sintesi proteica.

NUCLEOTIDI. Hanno la funzione di conservare, trasmettere e modulare l informazione genetica e di tradurla nella sintesi proteica. NUCLEOTIDI a) Forma di energia utilizzata nel metabolismo cellulare (ATP, GTP) b) Entrano a far parte della struttura di cofattori enzimatici (coenzimi) e intermedi metabolici c) Costituiscono gli ACIDI

Dettagli

Nucleotidi 26/10/2014. Nucleotidi (1)

Nucleotidi 26/10/2014. Nucleotidi (1) I Nucleotidi Hanno Tre Componenti Base azotata Nucleotidi https://www2.chemistry.msu.edu/faculty/reusch/virttxtjml/nucacids.htm Base azotata Qualsiasi composto che manifesta proprietà basiche per via della

Dettagli

ACIDI GRASSI INSATURI

ACIDI GRASSI INSATURI LIPIDI ACIDI GRASSI SATURI ACIDI GRASSI INSATURI TRIGLICERIDI TRIGLICERIDI Grassi neutri o lipidi semplici glicerolo + 1 acido grasso monogliceride glicerolo + 2 acidi grassi digliceride glicerolo + 3

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson

Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Il DNA: istruzioni per la vita Bibliografia I colori della Biologia Gatti- Giusti- Anelli Ed. Pearson Una divisione equa Quando una cellula si divide, si formano due nuove cellule che contengono esattamente

Dettagli

Immagini e concetti della biologia

Immagini e concetti della biologia Sylvia S. Mader Immagini e concetti della biologia 2 A3 Le molecole biologiche 3 Il carbonio è l elemento di base delle biomolecole Una cellula batterica può contenere fino a 5000 tipi diversi di composti

Dettagli

Gli acidi nucleici: dalla cromatina ai nucleotidi

Gli acidi nucleici: dalla cromatina ai nucleotidi chimicare.org http://www.chimicare.org/curiosita/la-chimica-e-la-salute/gli-acidi-nucleici-dalla-cromatina-nucleotidi/ Gli acidi nucleici: dalla cromatina ai nucleotidi chimispiega 21 settembre 2014 di

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

Composti organici. I composti organici. Atomi e molecole di carbonio. Atomi e molecole di carbonio. Gruppi funzionali. Isomeri

Composti organici. I composti organici. Atomi e molecole di carbonio. Atomi e molecole di carbonio. Gruppi funzionali. Isomeri I composti organici Atomi e molecole di carbonio Carboidrati Lipidi Proteine Acidi nucleici Composti organici Materiale composto da biomolecole - Formate in buona parte da legami ed anelli di carbonio.

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 19

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 19 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 19 Acidi nucleici Concetti chiave: Le basi azotate dei nucleotidi comprendono due tipi di purine e tre tipi di pirimidine.

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Corso di Biologia Molecolare I. Elia Ranzato Tel:

Corso di Biologia Molecolare I. Elia Ranzato   Tel: Corso di Biologia Molecolare I Elia Ranzato E-mail: ranzato@unipmn.it Tel: 0131360260 Il campo della biologia molecolare si interseca anche con altre discipline non biologiche: per esempio con l'informatica

Dettagli

Strutture alternative e strutture superiori degli acidi nucleici

Strutture alternative e strutture superiori degli acidi nucleici Strutture alternative e strutture superiori degli acidi nucleici Strutture alternative La struttura a doppia elica proposta da Crick e Watson, e che abbiamo sopra descritto, è quella ottenuta mediante

Dettagli

Valitutti, Falasca, Tifi, Gentile. Chimica. concetti e modelli.blu

Valitutti, Falasca, Tifi, Gentile. Chimica. concetti e modelli.blu Valitutti, Falasca, Tifi, Gentile Chimica concetti e modelli.blu 2 Capitolo 10 Le basi della biochimica 3 Sommario 1. Le molecole biologiche si dividono in quattro classi 2. I carboidrati sono il «carburante»

Dettagli

q In che modo viene conservato il materiale genetico? q Come viene decodificata l informazione contenuta nel materiale genetico?

q In che modo viene conservato il materiale genetico? q Come viene decodificata l informazione contenuta nel materiale genetico? La vita dipende dalla capacità delle cellule di immagazzinare, recuperare e tradurre le informazioni genetiche necessarie per costruire e mantenere un organismo vivente. q L informazione viene trasmessa

Dettagli

Schema di una cellula animale

Schema di una cellula animale Schema di una cellula animale Schema di una cellula vegetale SH2 domain lysozyme catalase hemoglobin myoglobin DNA collagen RNA polymerase Cytochrome C porin calmodulin chymotrypsin aspartate trancarbamoylase

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo LA NATURA CHIMICA DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo LA NATURA CHIMICA DEL DNA CORSO DI GENETICA LA NATURA CHIMICA DEL DNA Le leggi di Mendel (1865) Legge della dominanza e della recessività Legge della segregazione o disgiunzione Legge dell indipendenza dei caratteri Eredità particolata

Dettagli

Buone regole. -nel dubbio, chiedere! LEGGERE BENE IL PROTOCOLLO PRIMA DI INIZIARE

Buone regole. -nel dubbio, chiedere! LEGGERE BENE IL PROTOCOLLO PRIMA DI INIZIARE Precauzioni da adottare in laboratorio: -non mangiare nè bere -indossare il camice -indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette -nel dubbio, chiedere! Buone regole LEGGERE

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

I materiali della vita

I materiali della vita I materiali della vita I componenti chimici dei viventi Il corpo dei viventi è formato da relativamente pochi elementi chimici e in percentuale diversa da quella del mondo non vivente. Le molecole dei

Dettagli

GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto.

GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto. ceppo S 1 Griffith and Avery 1930 deceduto ceppo R 2 vivo ceppo S ucciso al calore 3 ceppo R 4 vivo ceppo S ucciso al calore deceduto Riproduzione del ceppo S Preparazione del fattore trasformante lisi

Dettagli

CORSO DI BIOCHIMICA PER INGEGNERIA BIOMEDICA I ESERCITAZIONE

CORSO DI BIOCHIMICA PER INGEGNERIA BIOMEDICA I ESERCITAZIONE CORSO DI BIOCHIMICA PER INGEGNERIA BIOMEDICA I ESERCITAZIONE 1) Che tipo di ibridazione ha il carbonio coinvolto nel doppio legame degli alcheni? Descrivi brevemente. Alcheni Ibridazione sp 2 2s p x p

Dettagli

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi.

Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Gli organismi viventi sono formati da tante unità funzionali, le CELLULE; si calcola che in ognuno di noi ne esistano circa 100 mila miliardi. Ogni cellula contiene un organello, il NUCLEO, all interno

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

UNIVERSITÀ DI PISA. Facoltà di Farmacia. Corso di Laurea Specialistica in Chimica e Tecnologia Farmaceutiche

UNIVERSITÀ DI PISA. Facoltà di Farmacia. Corso di Laurea Specialistica in Chimica e Tecnologia Farmaceutiche UNIVERSITÀ DI PISA Facoltà di Farmacia Corso di Laurea Specialistica in Chimica e Tecnologia Farmaceutiche Tesi di Laurea: Derivati a struttura 2-fenilftalazinonica: nuovi antagonisti per i recettori A

Dettagli

CARIOLOGIA. 4.1 Introduzione. 4.2 Cromatina e cromosomi

CARIOLOGIA. 4.1 Introduzione. 4.2 Cromatina e cromosomi 4 CARIOLOGIA 4.1 Introduzione Nel capitolo precedente abbiamo visto che il progetto biologico di ogni organismo vivente è contenuto nel suo DNA, un composto organico la cui molecola è dotata di proprietà

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Capitolo 3 Le biomolecole

Capitolo 3 Le biomolecole apitolo 3 Le biomolecole opyright 2006 Zanichelli editore I composti organici e i loro polimeri 3.1 La diversità molecolare della vita è basata sulle proprietà del carbonio Un atomo di carbonio può formare

Dettagli

Introduzione alla biologia della cellula. Lezione 2 Le biomolecole

Introduzione alla biologia della cellula. Lezione 2 Le biomolecole Introduzione alla biologia della cellula Lezione 2 Le biomolecole Tutte le molecole contenute nelle cellule sono costituite da composti del carbonio Zuccheri Lipidi Proteine Acidi nucleici Polimeri Sono

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

Duplicazione del DNA. 6 Dicembre 2007

Duplicazione del DNA. 6 Dicembre 2007 Duplicazione del DNA 6 Dicembre 2007 Duplicazione - Trascrizione - Traduzione DNA Trascrizione DNA - La DUPLICAZIONE è il processo che porta alla formazione di copie delle molecole di DNA ed al trasferimento

Dettagli

Docente: Alessandra Coiana tel

Docente: Alessandra Coiana tel Corso di Biologia Molecolare AA15/16 Docente: Alessandra Coiana acoiana@medicina.unica.it tel 07052965654 Laboratorio di Genetica Molecolare Ospedale Microcitemico riceve gli studenti tutti i giorni previo

Dettagli

Testi x pdf. Nucleotidi, acidi nucleici

Testi x pdf. Nucleotidi, acidi nucleici Testi x pdf Nucleotidi, acidi nucleici I Nucleotidi Hanno Tre Componenti Nucleotidi (1) Un Nucleotide è una molecola costituita da un composto ad anello contenente azoto (N) legato ad uno zucchero con

Dettagli

La chimica della vita: i composti organici. CARBOIDRATI LIPIDI PROTEINE ACIDI NUCLEICI (DNA, RNA)

La chimica della vita: i composti organici. CARBOIDRATI LIPIDI PROTEINE ACIDI NUCLEICI (DNA, RNA) La chimica della vita: i composti organici. CARBOIDRATI LIPIDI PROTEINE ACIDI NUCLEICI (DNA, RNA) POLIMERI Le cellule sintetizzano un enorme numero di grosse molecole a partire da una ristretta serie di

Dettagli

Nucleotidi, Acidi Nucleici, Cromatina. Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano

Nucleotidi, Acidi Nucleici, Cromatina. Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Nucleotidi, Acidi Nucleici, Cromatina Marco Nardini Dipartimento di Scienze Biomolecolari e Biotecnologie Università di Milano Nucleotidi - 8 tipi di nucleotidi comuni Struttura nucleotidi - base azotata

Dettagli

SOLUZIONI DEGLI ESERCIZI

SOLUZIONI DEGLI ESERCIZI Dal carbonio agli OGM Biochimica e biotecnologie SOLUZIONI DEGLI ESERCIZI Capitolo 0 Il mondo del carbonio 1. b, e 2. d 3. 7 4. 5. 6. 7. a) Isomeria di posizione; b) i due composti non sono isomeri; c)

Dettagli

http://digilander.libero.it/glampis64 Idrogeno, ossigeno, carbonio e azoto costituiscono il 99% delle cellule. I composti del carbonio sono chiamati composti organici o molecole organiche. I composti organici

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Costituenti chimici della materia vivente

Costituenti chimici della materia vivente Costituenti chimici della materia vivente Le macromolecole biologiche Macromolecole (dal greco macros = grande) biologiche. Classi di composti biologici multifunzionali: Polisaccaridi proteine acidi

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

BIOMOLECOLE LE BASI DELLA BIOCHIMICA. Capitolo 1 Dal Carbonio agli OGM PLUS

BIOMOLECOLE LE BASI DELLA BIOCHIMICA. Capitolo 1 Dal Carbonio agli OGM PLUS BIOMOLECOLE LE BASI DELLA BIOCHIMICA Capitolo 1 Dal Carbonio agli OGM PLUS BIOMOLECOLE Carboidrati Lipidi Acidi Nucleici Proteine BIOMOLECOLE Carboidrati Lipidi Acidi Nucleici - monosaccaridi - disaccaridi

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli

F. Fogolari Milano, Marzo

F. Fogolari Milano, Marzo Biomolecole - 1 Federico Fogolari Dipartimento Scientifico e Tecnologico Universita di Verona Ca Vignal 1, Strada Le Grazie 15 37134 Verona, Italy tel. ++39-045-8027906 fax. ++39-045-8027929 email: fogolari@sci.univr.it

Dettagli

Adenina Adenine H H N N N N N Z

Adenina Adenine H H N N N N N Z Adenina Adenine Z Guanina O GUAIA Z Citosina CITOSIA Z O Timina Thymine C3 O Z O Siti di attacco elettrofilo 3 Thymine Basi appaiate: Timina-Adenina Adenine C 3 O O 3.ooA Basi appaiate: Citosina-Guanina

Dettagli

Relazione DNA. Giulia Carbonara classe 3 A

Relazione DNA. Giulia Carbonara classe 3 A Giulia Carbonara classe 3 A Relazione DNA Il DNA (la sigla dell'acido desossiribonucleico ) è una macromolecola biologica sede delle informazioni genetiche e dell'unicità di un organismo che appartiene

Dettagli

ORIGINE DELL UOMO: Da Dio o per caso? Silvio Chierichetti MD, PhD.

ORIGINE DELL UOMO: Da Dio o per caso? Silvio Chierichetti MD, PhD. ORIGINE DELL UOMO: Da Dio o per caso? Nerviano, 18 0ttobre 2012 Cosa hanno in comune? la materia vivente Che cosa è un essere vivente? Determinata quantità di materia organizzata nello spazio e nel tempo,

Dettagli

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT2 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 IL MATERIALE GENETICO 2 2 Per svolgere il proprio ruolo, il materiale genetico

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

Gerard Tortora, Brian Derrickson. Conosciamo

Gerard Tortora, Brian Derrickson. Conosciamo 1 Gerard Tortora, Brian Derrickson Conosciamo il corpo umano Capitolo 1 L organizzazione del corpo umano 1. Che cosa sono l anatomia e la fisiologia 2. I livelli di organizzazione e gli apparati del corpo

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Per gli studenti che intendono iscriversi per l anno accademico 2008/09 al Corso di Laurea in Biotecnologie

Per gli studenti che intendono iscriversi per l anno accademico 2008/09 al Corso di Laurea in Biotecnologie Luglio 2008 Per gli studenti che intendono iscriversi per l anno accademico 2008/09 al Corso di Laurea in Biotecnologie Elenco dei quesiti proposti dalla Commissione per la prova di ammissione relativa

Dettagli

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per:

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per: Nucleo L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: 1. Citoplasma 2. Materiale Genetico 3. Membrana Plasmatica Differiscono tra loro per: Forma Dimensione Funzione

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Esperienza 9: estrazione del DNA

Esperienza 9: estrazione del DNA Esperienza 9: estrazione del DNA Il DNA è la molecola essenziale di tutti gli organismi viventi. Essa contiene l informazione genetica che fa di un organismo o di una cellula ciò che è. Soggetti: purificazione

Dettagli

LA CHIMICA DELLA VITA

LA CHIMICA DELLA VITA LA CHIMICA DELLA VITA L elemento presente in tutte le molecole caratteristiche degli esseri viventi è IL CARBONIO Il carbonio ha numero atomico 6 (Z=6). Ha valenza 4: ai suoi atomi mancano 4 elettroni

Dettagli

Traduzione. Trascrizione

Traduzione. Trascrizione Duplicazione del DNA IL DNA è LA MOLECOLA DEPOSITARIA DELL INFORMAZIONE GENICA CHE DEVE ESSERE EREDITATA DI GENERAZIONE IN GENERAZIONE. PERTANTO LA STRUTTURA DEL DNA DEVE ESSERE TALE DA SODDISFARE AL MEGLIO

Dettagli

LE BIOMOLECOLE LIPIDI, PROTEINE E ACIDI NUCLEICI GSCATULLO

LE BIOMOLECOLE LIPIDI, PROTEINE E ACIDI NUCLEICI GSCATULLO LE BIOMOLECOLE LIPIDI, PROTEINE E ACIDI NUCLEICI GSCATULLO ( Le Biomolecole I Lipidi Definizione e classificazione I lipidi rappresentano una vasta classe di composti chimicamente eterogenea per struttura

Dettagli

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA

ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA ALCUNE DOMANDE DI RIEPILOGO PER LA 2 2 VERIFICA DEL CORSO DI GENETICA AGRARIA Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Domande di riepilogo alla lezione 1 Riproduzione

Dettagli

Nella doppia elica del DNA, le coppie di basi complementari sono tenute insieme da:

Nella doppia elica del DNA, le coppie di basi complementari sono tenute insieme da: Quale base azotata si trova nell RNA e non nel DNA? 1.Citosina 2.Uracile 3.Adenina 4.Timina Nella doppia elica del DNA, le coppie di basi complementari sono tenute insieme da: 1. legami N-glicosidici 2.

Dettagli

Irrancidimento (ossidazione) degli acidi grassi insaturi

Irrancidimento (ossidazione) degli acidi grassi insaturi Irrancidimento (ossidazione) degli acidi grassi insaturi Aldeidi STPA-Chimica rganica Alcuni saggi sui grassi numero di acidità (titolazione in presenza di fenolftaleina con base forte diluita a temperatura

Dettagli

Ricordiamo chi sono i composti aromatici. Idrocarburi aromatici

Ricordiamo chi sono i composti aromatici. Idrocarburi aromatici Ricordiamo chi sono i composti aromatici Idrocarburi aromatici La completa delocalizzazione dei sei elettroni in un unico orbitale contenente sei elettroni è rappresentato graficamente con un anello interno

Dettagli

DNA. simile ad una scala a chiocciola. I pioli della scala corrispondono

DNA. simile ad una scala a chiocciola. I pioli della scala corrispondono DNA Il DNA o acido desossiribonucleico è una grossa molecola chimica contenuta nel nucleo della cellula. Il DNA può essere paragonato ad un importante libro delle istruzioni che contiene l informazione

Dettagli

Biosintesi degli aminoacidi

Biosintesi degli aminoacidi Biosintesi degli aminoacidi Per l uomo la fonte principale di gruppi NH 4 + sono gli AA contenuti nelle proteine della dieta Parte di NH 4 + che si genera dalla degradazione degli AA viene riciclata e

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA

Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Involucro proteico del batteriofago T2 circondato dalla sua molecola di DNA Lunghezza del cromosoma di E.coli (1,7 mm) paragonata alla lunghezza di una tipica cellula di E. coli (2μm) DNA di una cellula

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Test di BIOLOGIA. 6. Gli enzimi sono costituiti da: a. polisaccaridi b. proteine c. acido ribonucleico d. proteine e acido desossiribonucleico

Test di BIOLOGIA. 6. Gli enzimi sono costituiti da: a. polisaccaridi b. proteine c. acido ribonucleico d. proteine e acido desossiribonucleico Test di BIOLOGIA 1. Che cosa rappresenta la reazione chimica 6 C02 + 6 H20 = C6H1206 + 602? a. L'equazione chimica della glicolisi b. L'equazione chimica della principale funzione mitocondriale c. L'equazione

Dettagli

08/01/14. Le basi dei nucleotidi sono derivati di purine e pirimidine. Capitolo 3 Nucleotidi, acidi nucleici e informazioni genetiche

08/01/14. Le basi dei nucleotidi sono derivati di purine e pirimidine. Capitolo 3 Nucleotidi, acidi nucleici e informazioni genetiche Nucleotidi, acidi nucleici e informazioni genetiche Copyright 2013 Zanichelli editore S.p.A. I nucleotidi Conce& chiave 3.1 Le basi azotate dei nucleotidi comprendono due tipi di purine e tre tipi di pirimidine.

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura

Dettagli

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A LICEO SCIENTIFICO STATALE «GALILEO GALILEI» Via Ceresina 17 - Tel. 049 8974487 Fax 049 8975750 35030 SELVAZZANO DENTRO (PD) ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE

Dettagli

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici

I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici I composti organici della vita: carboidrati, lipidi, proteine e acidi nucleici La seta della tela di ragno è un insieme di macromolecole, dette proteine. Sono le caratteristiche fisico-chimiche di queste

Dettagli

Amminoacidi (aa) La L-gliceraldeide e gli L- α-amminoacidi hanno la stessa configurazione relativa

Amminoacidi (aa) La L-gliceraldeide e gli L- α-amminoacidi hanno la stessa configurazione relativa BIOMOLECOLE Le proteine e loro costituenti: gli amminoacidi; le proteine come leganti; la struttura delle proteine Gli enzimi e la catalisi enzimatica Gli acidi nucleici e i loro costituenti: RNA, DNA;

Dettagli

Katherine J. Denniston, Joseph J. Topping, Robert L. Caret Chimica generale - Chimica organica - Propedeutica biochimica -aminoacidi

Katherine J. Denniston, Joseph J. Topping, Robert L. Caret Chimica generale - Chimica organica - Propedeutica biochimica -aminoacidi Katherine J. Denniston, Joseph J. Topping, Robert L. Caret Chimica generale - Chimica organica - Propedeutica biochimica α-aminoacidi (17.1) subunità che costituiscono le proteine formatei da un carbonio-α

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

ACIDI NUCLEICI.

ACIDI NUCLEICI. ACIDI NUCLEICI http://www.link2universe.net/wp-content/uploads/2012/11/dna-rna.jpgics&id=85209 3 DNA RNA Proteina Il DNA è una molecola informativa. L informazione è immagazzinata nell ordine in cui sono

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia

Ingegneria delle tecnologie per la salute. Anatomia e istologia umana. Cenni di Biologia Ingegneria delle tecnologie per la salute Anatomia e istologia umana Cenni di Biologia Macromolecole: Glucidi Lipidi Proteine Acidi nucleici glucidi Monosaccaridi: glucosio, fruttosio, galattosio, desossiribosio,

Dettagli

LA RIPRODUZIONE. Prima di iniziare questo percorso tuttavia è necessario ripassare alcune nozioni di biologia apprese gli anni scorsi

LA RIPRODUZIONE. Prima di iniziare questo percorso tuttavia è necessario ripassare alcune nozioni di biologia apprese gli anni scorsi LA RIPRODUZIONE Caratteristica fondamentale che distingue i viventi dai non viventi è la riproduzione, che permette di generare nuovi individui mantenendo e diffondendo la specie nel tempo e nello spazio.

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica)

Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Il DNA come molecola in grado di veicolare informazione ereditabile (genetica) Essenz. Alberts: cap 6 La trasmissione dell informazione replicazione trascrizione traduzione DNA RNA Proteina da, dg, dc,

Dettagli

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S CONOSCERE IL CORPO UMANO PARTE 1 DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S. 2007-2008 1 CONOSCERE IL CORPO UMANO: GLOSSARIO ANATOMIA Scienza che studia e illustra la forma, l architettura e la

Dettagli