Studio della regolazione dell espressione genica

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Studio della regolazione dell espressione genica"

Transcript

1 Studio della regolazione dell espressione genica

2 Un gene soggetto a regolazione possiede una o più sequenze regolatorie posizionate in maniera diversa rispetto al gene. I regolatori possono essere positivi o negativi.

3 Come funzionano gli enhancers pur essendo lontani dal gene? Il DNA looping promuove l interazione proteina-proteina

4

5 Nucleosoma Gli istoni sono proteine basiche ricche in lisina e arginina (>1/5), altamente conservate Ruolo strutturale e funzionale 5 principali istoni: H1, H2A, H2B, H3, H4

6 Le modificazioni degli istoni Gli istoni possiedono delle code che sporgono dal nucleosoma e che sono sede delle PMT Acetilazione: Metilazione Ubiquitinazione Sumoilazione Le PTM: Sono a carico di enzimi specifici Sono reversibili Permettono sia la modificazione dell interazione col DNA che il reclutamento di proteine che modificano struttura e funzione della cromatina Fosforilazione In pratica permettono di modulare tutti i processi che coinvolgono l accesso al DNA (trascrizione, replicazione, ricombinazione, riparazione )

7 Rimozione di una carica positiva sulla lisina Acetilazione Alterazione dell interazione col DNA Avviene principalmente su H3 e H4 E operata dalle istone acetilasi La deacetilazione è operata dalle HDAC E associata con l attivazione della trascrizione

8 Metilazione Avviene su residui di lisina (1-3 met) e arginina (1-2 met) degli istoni H3 e H4 Il numero di gruppi metilici influenza il reclutamento di diverse proteine E operata dalle istone metiltransferasi (HMT) La rimozione del gruppo metilico è operata da istone demetilasi E associata sia all attivazione che alla repressione trascrizionale L effetto dipende dal residuo metilato e dal grado di metilazione

9 Chromatin immunoprecipitation (ChIP)

10 Chromatin immunoprecipitation (ChIP)

11 Real time PCR (PCR quantitativa) Permette di determinare quante copie di un specifica sequenza di DNA o RNA sono presenti nel campione

12

13 Come studiare un enhancer in vivo

14 Saggio luciferasico per caratterizzare un enhancer o promotore 1. Analisi delle sequenze di legame per fattori di trascrizione (per es. mathlab) 2. ChIP per verificare il legame + luciferase assay per testare la funzionalità del legame Specific TF Enhancer

15 Identificazione di un sito di legame sul DNA Gel retardation

16 EMSA per identificare la minima sequenza di legame Electrophoretic Mobility shift assay: sfrutta il principio della differente mobilità elettroforetica fra un complesso proteina-dna e il DNA da solo a. Un piccolo frammento di DNA viene marcato radioattivamente o per fluorescenza. b. Incubazione con la proteina o con il lisato proteico di interesse c. Elettroforesi di policrilammide non denaturante Permette di capire anche se più proteine sono legate allo stesso DNA (in base alle differenze di MW delle proteine)

17 Per individuare quale proteina si sta legando si fa il supershift: il legame all anticorpo specifico rallenta la corsa del complesso proteico Un dsdna di CR4 contenente l element0 sox-oct viene incubato con lisati di ESC indifferenziate. L aggiunta di anticorpi per Oct4 o Sox2 determina un supershift del complesso.

18 Metilazione del DNA Modifica chimica che avviene sul DNA Gruppi metile sono aggiunti alla citosina generando 5-metil citosina Il genoma dei vertebrati è globalmente metilato con eccezione delle regioni 5 dei geni, promotori isole CG e esoni La metilazione del DNA è responsabile della repressione genica e avviene ad opera delle DNA metil trasferasi (DNMT). Sebbene molte isole CG restano non metilate durante lo sviluppo una minoranza diventa metilata per consentire la repression genica. Infatti la metilazione del DNA è ereditabile e reversibile. Un esempio classico è l inattivazione del cromosoma X durante cui centinaia di CGIs diventano fortemente metilate, assicurando il silenziamento genico. Altri esempi di metilazione naturale sono i geni imprinted e i geni espressi esclusivamente nella linea germinale.

19 Bisulfito per determinare la metilazione del DNA Si tratta il DNA con bisulfito (solfato di idrogeno,hso 3 ) Le C non metilate vengono convertite in U e poi in T (fase di PCR prima del sequenziamento) HSO 3 Comparazione della sequenza del DNA trattato e non col bisulfito

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica

Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica Nucleosomi e trascrizione: Rimodellamento cromatinico e regolazione dell'espressione genica La trascrizione di un gene richiede delle modifiche nell'organizzazione della cromatina Figura 4.15C Organizzazione

Dettagli

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali

Fattori di crescita. Membrana citoplasmatica. Recettori di fattori di crescita. Proteine trasduttrici del segnale. Nucleo. Fattori trascrizionali Fattori di crescita Recettori di fattori di crescita Membrana citoplasmatica roteine trasduttrici del segnale Nucleo Fattori trascrizionali roteine del ciclo cellulare Ciclo di divisione cellulare Fattori

Dettagli

Stesso DNA ma cellule diverse

Stesso DNA ma cellule diverse Stesso DNA ma cellule diverse Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico I cromosomi sono in coppia Ogni cromosoma

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

1 Gene => + fenotipi. ambiente

1 Gene => + fenotipi. ambiente 1 Gene => + fenotipi (Fattori di) trascrizione Cromatina (etero,eu, remodeling) Splicing Silenziamento (Interference) Modificazioni post traduzionali ambiente Lattosio nel mezzo Ormoni Heat shock Luce

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

21. Regolazione dell espressione genica

21. Regolazione dell espressione genica 21. Regolazione dell espressione genica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le cellule di un organismo pluricellulare

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica definizioni Gene attivato quando viene trascritto in RNA e il suo messaggio tradotto in molecole proteiche specifiche Espressione genica processo complessivo con cui

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

INATTIVAZIONE DEL CROMOSOMA X

INATTIVAZIONE DEL CROMOSOMA X INATTIVAZIONE DEL CROMOSOMA X Compensazione del dosaggio Nelle specie in cui la femmina ha due X e il maschio un solo X, esistono dei meccanismi di compensazione del dosaggio che rendono equivalente l

Dettagli

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti Biologia Molecolare CDLM in CTF 2010-2011 La trascrizione negli eucarioti I meccanismi della trascrizione Organizzazione generale delle sequenze regolative Il macchinario generale della trascrizione Si

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

Analisi dei promotori Geni Reporter Interazione DNA-proteine

Analisi dei promotori Geni Reporter Interazione DNA-proteine Analisi dei promotori Geni Reporter Interazione DNA-proteine A differenza dei procarioti, mescolando in vitro l RNA polimerasi ad un frammento di DNA contenente un avviene alcuna Promotori Eucariotici

Dettagli

CAPITOLO 1. collaboratori, possiede un attività inibitoria nei confronti dell istone deacetilasi di classe

CAPITOLO 1. collaboratori, possiede un attività inibitoria nei confronti dell istone deacetilasi di classe CAPITOLO 1 1. Introduzione Il Cambinol, composto chimico stabile identificato e caratterizzato da Bedalov e collaboratori, possiede un attività inibitoria nei confronti dell istone deacetilasi di classe

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

Tè verde e prevenzione carcinoma prostatico.

Tè verde e prevenzione carcinoma prostatico. Tè verde e prevenzione carcinoma prostatico. Il tumore prostatico è una delle neoplasie più frequenti nei paesi occidentali. anni Una buona dieta e dei buoni stili di vita aiutano ad abbassarne il rischio.

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c.

Doutez de tout et surtout de ce que je vais vous dire. Bouddha a.c. Doutez de tout et surtout de ce que je vais vous dire Bouddha 556-480 a.c. Il punto: -genotipo fenotipo -eredita -gene Esercitazione Bonus: 0-1.5 Presenza obbligatoria -gene malattia -manipolazione del

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

Riassunto struttura DNA

Riassunto struttura DNA Riassunto struttura DNA Il nucleotide (unita monomerica del DNA): composto da uno zucchero pentoso, una base azotata e un gruppo fosfato (1-3) Il DNA e l RNA sono polimeri costituiti da nucleotidi uniti

Dettagli

-85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO

-85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO Replication -85% del genoma é trascritto in RNA -Solo 1.1% codifica per proteine (c.a 20000 geni) -Le proteine sono milioni ( ogni gene più proteine) I GENI SONO QUINDI AMBIGUI I processi epigenetici,tutti

Dettagli

Infiammazione: la culla del tumore

Infiammazione: la culla del tumore Infiammazione: la culla del tumore L infiammazione cronica silente è stata implicata in numerose patologie (Alzheimer, malattie cardio-vascolari, diabete, tumori, malattie polmonari, malattie autoimmuni).

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L. Docente: Massimo Gulisano Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2013-2014 corso A- L Docente: Massimo Gulisano m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza dei legami deboli

Dettagli

LA REGOLAZIONE DELL ESPRESSIONE GENICA PUÒ AVVENIRE A DIVERSI LIVELLI:

LA REGOLAZIONE DELL ESPRESSIONE GENICA PUÒ AVVENIRE A DIVERSI LIVELLI: LA REGOLAZIONE DELL ESPRESSIONE GENICA PUÒ AVVENIRE A DIVERSI LIVELLI: 1. A livello di cromatina Metilazione del DNA Modificazioni degli istoni 2. A livello di trascrizione Fatt. di trascr. Regolatori

Dettagli

IDENTIFICAZIONE DI ISTONI ACETILATI IN ESTRATTI CEREBRALI DI RATTO IN SEGUITO AD ESPERIMENTI COMPORTAMENTALI

IDENTIFICAZIONE DI ISTONI ACETILATI IN ESTRATTI CEREBRALI DI RATTO IN SEGUITO AD ESPERIMENTI COMPORTAMENTALI UNIVERSITA DEGLI STUDI DI BOLOGNA FACOLTA DI SCIENZE MM. FF. NN. LAUREA DI PRIMO LIVELLO IN BIOTECNOLOGIE IDENTIFICAZIONE DI ISTONI ACETILATI IN ESTRATTI CEREBRALI DI RATTO IN SEGUITO AD ESPERIMENTI COMPORTAMENTALI

Dettagli

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi GENOMA EVOLUZIONE CONTENUTO FUNZIONE STRUTTURA Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine Progetti genoma in centinaia di organismi Importante la sintenia tra i genomi The

Dettagli

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi. 8. Funzionamento dei genomi Il genoma dei procarioti

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi. 8. Funzionamento dei genomi Il genoma dei procarioti GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi 8. Funzionamento dei genomi Il genoma dei procarioti Modificazioni della cromatina e l espressione del genoma Il genoma degli eucarioti

Dettagli

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L

Biologia Molecolare Corso di Laurea Magistrale in CTF aa corso A- L Biologia Molecolare Corso di Laurea Magistrale in CTF aa 2014-2015 corso A- L Docente: Massimo Gulisano Cell 3483391646 Email m.gulisano@unict.it www.gulisanolab.it Componen' chimici della cellula: Importanza

Dettagli

Organizzazione del genoma umano

Organizzazione del genoma umano Organizzazione del genoma umano Famiglie di geni o geniche Copie multiple di geni, tutte con sequenza identica o simile. La famiglia multigenica corrisponde a un insieme di geni correlati che si sono evoluti

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA PER ESPRESSIONE GENICA SI INTENDE L INSIEME DEI PROCESSI CHE PORTANO ALL UTILIZZO DELL INFORMAZIONE GENICA PER LA SINTESI DI UNA SPECIFICA PROTEINA. CONCETTUALMENTE,

Dettagli

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione)

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Nucleotidi e Ribonucleotidi L RNA è costituituito

Dettagli

- utilizzano esclusivamente le reattività chimiche di alcuni residui AA

- utilizzano esclusivamente le reattività chimiche di alcuni residui AA Enzimi semplici Enzimi coniugati - utilizzano esclusivamente le reattività chimiche di alcuni residui AA - richiedono la reattività chimica aggiuntiva di COFATTORI o COENZIMI gruppi prostetici COENZIMI

Dettagli

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

Risultati della Ricerca

Risultati della Ricerca Risultati della Ricerca Titolo Studio della risposta epigenetica a stress ambientali in Arabidopsis e mais Descrizione estesa del risultato Il progetto Acquired Environmental Epigenetics Advances: from

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Importanza della genetica dei microrganismi

Importanza della genetica dei microrganismi Importanza della genetica dei microrganismi 1.I microrganismi rappresentano un mezzo essenziale per comprendere la genetica di tutti gli organismi. 2.Vengono usati per isolare e duplicare specifici geni

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica meccanismi che determinano l accensione o lo spegnimento di un gene L evoluzione ha selezionato e premiato sistemi che accendono/spengono certe funzioni cellulari in

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

Proteine. Enzimi Fattori di Trascrizione Proteine di Membrana (trasportatori, canale, recettori di membrana)

Proteine. Enzimi Fattori di Trascrizione Proteine di Membrana (trasportatori, canale, recettori di membrana) Proteine Enzimi Fattori di Trascrizione Proteine di Membrana (trasportatori, canale, recettori di membrana) Ormoni e Fattori di crescita Anticorpi Trasporto Trasporto (emoglobina, LDL, HDL.) Fenotipo Proteine

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

È un metodo in vivo per analizzare qualsiasi componente della cromatina nel suo contesto naturale

È un metodo in vivo per analizzare qualsiasi componente della cromatina nel suo contesto naturale ? what is ChIP?? È un metodo in vivo per analizzare qualsiasi componente della cromatina nel suo contesto naturale E uno strumento potente per ottenere immagini ad alta risoluzione di proteine nel contesto

Dettagli

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,

Dettagli

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

5. NUCLEOSOMI. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 5. NUCLEOSOMI contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle

Dettagli

Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:

Dettagli

Geni che regolano la divisione cellulare

Geni che regolano la divisione cellulare Geni che regolano la divisione cellulare!geni il cui prodotto proteico promuove un aumento del numero di cellule (oncogeni) Oncogeni = acceleratori!geni il cui prodotto proteico induce una riduzione del

Dettagli

MODELLO SCHEDA INSEGNAMENTO

MODELLO SCHEDA INSEGNAMENTO Corso di Laurea Denominazione insegnamento: Numero di Crediti: Anno: Semestre: Docente Titolare: MODELLO SCHEDA INSEGNAMENTO Triennale in Scienze Biologiche Biologia molecolare 9 CFU II II Lina Sabatino

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Vettori derivati dal fago λ: batteriofagi filamentosi M13

Vettori derivati dal fago λ: batteriofagi filamentosi M13 Vettori derivati dal fago λ: batteriofagi filamentosi M13 A. Phage display: esibizione della proteina clonata in M13 ed esposta sulla superficie del batteriofago (facile screening dei ricombinanti) mediante

Dettagli

LA REGOLAZIONE GENICA DEI PROCARIOTI.

LA REGOLAZIONE GENICA DEI PROCARIOTI. LA REGOLAZIONE GENICA DEI PROCARIOTI www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con cui viene

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze

La trascrizione è simile alla replicazione ma esistono alcune importanti differenze LA TRASCRIZIONE processo nel quale il DNA stampo viene copiato in una molecola di RNA La molecola di RNA è identica in sequenza all elica codificante e complementare a quella stampo. La trascrizione è

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE:

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi 8. Funzionamento dei genomi Il genoma dei procarioti Modificazioni della cromatina e l espressione del Il genoma degli eucarioti genoma

Dettagli

Controllo dell espressione genica negli eucarioti

Controllo dell espressione genica negli eucarioti Controllo dell espressione genica negli eucarioti Differenze della regolazione genica fra procarioti ed eucarioti Dimensione e complessità del genoma Compartimentazione del genoma Organizzazione strutturale

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali.

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali. I VIRUS Un virus è definito come materiale nucleico (DNA o RNA) organizzato in una struttura di rivestimento proteico. Il materiale nucleico del virus contiene l informazione necessaria alla sua replicazione

Dettagli

IL SEQUENZIAMENTO DEL DNA. Obiettivo: ottenere la sequenza nucleotidica di un frammento di DNA.

IL SEQUENZIAMENTO DEL DNA. Obiettivo: ottenere la sequenza nucleotidica di un frammento di DNA. IL SEQUENZIAMENTO DEL DNA Obiettivo: ottenere la sequenza nucleotidica di un frammento di DNA. Il DNA può essere sequenziato generando frammenti di DNA la cui lunghezza dipende dall ultima base della sequenza.

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

α-actina vimentina cheratina 8-18 S100 HMB45 CD44v6

α-actina vimentina cheratina 8-18 S100 HMB45 CD44v6 α-actina vimentina S100 cheratina 8-18 CD44v6 HMB45 Fig. 1 Caratterizzazione tramite immunofluorescenza delle cellule TSC isolate dall AML. L analisi è stata effettuata utilizzando un pannello di anticorpi

Dettagli

Caulobacter crescentus: ciclo cellulare

Caulobacter crescentus: ciclo cellulare Caulobacter crescentus: ciclo cellulare Il C. crescentus: un modello batterico di differenziamento cellulare La replicazione cellulare tramite divisione ineguale è la norma in C. crescentus PleC e DivJ

Dettagli

Riarrangiamento genico

Riarrangiamento genico Riarrangiamento genico 1 3 quesiti per la comprensione Ø l esistenza nello stesso anticorpo di una parte variabile ed una costante; Ø l esistenza della enorme variabilità (diversità) del sito combinatorio;

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

QUANTI MECCANISMI DI REGOLAZIONE DELL ESPRESSIONE GENICA ESISTONO?

QUANTI MECCANISMI DI REGOLAZIONE DELL ESPRESSIONE GENICA ESISTONO? QUANTI MECCANISMI DI REGOLAZIONE DELL ESPRESSIONE GENICA ESISTONO? L espressione genica nei procarioti e negli eucarioti e regolata a vari livelli: -Trascrizionale - Emivita dell RNA -Traduzionale - durante

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona

Scientists with lab coats: Corso di laboratorio Chimico-Biologico. Dott.ssa Valeria Berton Università di Verona Scientists with lab coats: Corso di laboratorio Chimico-Biologico Dott.ssa Valeria Berton Università di Verona Il DNA Il DNA contiene l informazione genetica di un organismo Scritta in un codice chimico

Dettagli

Genetica per studenti di Matematica

Genetica per studenti di Matematica Published on Dipartimento di Biologia e Biotecnologie Charles Darwin BBCD - Sapienza - Università di Roma (http://bbcd.bio.uniroma1.it/bbcd) Home > Printer-friendly PDF > Genetica per studenti di Matematica

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Università di Roma Tor Vergata Scienze della Nutrizione Umana Biochimica della Nutrizione - Prof.ssa Luciana Avigliano A.A.

Università di Roma Tor Vergata Scienze della Nutrizione Umana Biochimica della Nutrizione - Prof.ssa Luciana Avigliano A.A. Università di Roma Tor Vergata Scienze della Nutrizione Umana Biochimica della Nutrizione - Prof.ssa Luciana Avigliano A.A. 2011-12 Nutrienti quali regolatori delle funzioni cellulari AZIONE REGOLATORIA

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

IL CANCRO. Lezione del 09 maggio 2013

IL CANCRO. Lezione del 09 maggio 2013 IL CANCRO Lezione del 09 maggio 2013 Cos è il cancro? Il cancro è costituito da una famiglia di malattie caratterizzate da una crescita cellulare sregolata e dall invasione e dalla diffusione di cellule

Dettagli

1) Un gene-un enzima 2) Un gene- una catena polipeptidica

1) Un gene-un enzima 2) Un gene- una catena polipeptidica 1) Un gene-un enzima 2) Un gene- una catena polipeptidica 3) Un gene è una unità funzionale di DNA che codifica per la sequenza amminoacidica di uno o più polipeptidi o alternativamente per uno o più tipi

Dettagli

TRASCRIZIONE e TRADUZIONE

TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione

Dettagli

Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Strutture di alcuni peptidi bioattivi prodotti da batteri e funghi Come vengono prodotti questi peptidi? Hanno strutture complesse (spesso

Dettagli

Ricevimento Studenti: Lunedì previa prenotazione. Cenci lab

Ricevimento Studenti: Lunedì previa prenotazione. Cenci lab Cenci lab Giovanni Cenci Dip.to Biologia e Biotecnologie C. Darwin Sezione Genetica Piano 2 -Citofono 3/4 0649912-655 (office) 0649912-843 (lab) giovanni.cenci@uniroma1.it Ricevimento Studenti: Lunedì

Dettagli

Ruolo dello sviluppo pre e neonatale (Epigenesi) nelle MCNT

Ruolo dello sviluppo pre e neonatale (Epigenesi) nelle MCNT ALMA MATER-UNIVERSITA DI BOLOGNA Dipartimento di Farmacia e Biotecnologie CONVEGNO MEDICO UNISALUTE INFLUENZA DEGLI STILI DI VITA SULLE MALATTIE CRONICHE NON TRASMISSIBILI: ASPETTI EPIDEMIOLOGICI, MEDICI

Dettagli

cardiomiocita linfocita

cardiomiocita linfocita REGOLAZIONE GENICA cardiomiocita adipocita linfocita neurone Cellula indifferenziata / pluripotente Cellule differenziate / specializzate? RIPROGRAMMAZIONE John Gurdon, 1962 Shinya Yamanaka, 2006 Controllo

Dettagli

Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri

Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri Agli inizi del Novecento studi condotti su modelli animali hanno indicato che alcune sostanze sono in grado

Dettagli

Forma e funzioni nei viventi (prima parte) Lezioni d'autore di Paola Vinesi

Forma e funzioni nei viventi (prima parte) Lezioni d'autore di Paola Vinesi Forma e funzioni nei viventi (prima parte) Lezioni d'autore di Paola Vinesi TRE PUNTI DI VISTA Il legame tra forma e funzione va interpretato in base a tre diversi aspetti: storia evolutiva di una specie

Dettagli

Trascrizione negli Eucariotici

Trascrizione negli Eucariotici Trascrizione negli Eucariotici Cytoplasm DNA RNA Transcription RNA Processing mrna G Nucleus AAAAAA Export G AAAAAA CLASSI DI GENI Le unità di trascrizione eucariotiche sono più complesse di quelle procariotiche

Dettagli

MODELLO SCHEDA INSEGNAMENTO. III II Angelo Lupo

MODELLO SCHEDA INSEGNAMENTO. III II Angelo Lupo Corso di L/LM/LMCU Denominazione insegnamento: MODELLO SCHEDA INSEGNAMENTO Numero di Crediti: 6 Anno Semestre: Docente Titolare: Corso di Laurea Triennale in Biotecnologie Biotecnologie Industriali-Modulo

Dettagli

METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI

METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI METODI DI BASE PER L ANALISI DEGLI ACIDI NUCLEICI SPETTRI UV E QUANTIZZAZIONE SPETTROFOTOMETRICA DEGLI ACIDI NUCLEICI FIGURA 7.6A METODOLOGIA BIOCHIMICA (WILSON) a a = a 1 Assorbimento = a b a 1 b FIGURA

Dettagli