eucarioti Cellula umana contiene circa geni

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "eucarioti Cellula umana contiene circa 30000 geni"

Transcript

1 Eucarioti

2 eucarioti Cellula umana contiene circa geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni housekeeping Geni tessuto - specifici

3 La trascrizione in vitro ed in vivo In vitro le RNA pol attivano la trascrizione genica in modo efficiente In vivo non accade, perché? Fattori accessori utili ad iniziare la trascrizione ma non appartenenti alla RNA pol Possono agire in cis o in trans

4 Trascrizione

5 Eucarioti Nei procarioti la trascrizione è uno stampo di DNA Eucarioti cromatina. Impedimento da parte degli ottameri istonici Un solo fattore sigma lega i promotori nei procarioti Negli eucarioti un gran numero di fattori deve legarsi per reclutare la RNA pol.

6 trascrizione

7 Eucarioti

8 Eucarioti RNA pol I trascrive gli rrna 18S/28S nel nucleolo RNA pol II trascrive mrna e piccoli RNA nel nucleoplasma RNA pol III trascrive trna, rrna 5S e piccoli RNA nel nucleoplasma

9

10 eucarioti Core promoter (nucleo) elementi in cis Elementi in cis (necessari a legare la RNA pol) La RNA pol si lega al sito d inizio non in modo diretto non a monte. Diversi tipi di promotori; per la Pol II molto complessi e diversi.

11 Eucarioti Hanno circa 12 subunità 500 kda Molte subunità in comune RNA pol isolata non è capace di iniziare selettivamente dai promotori La subunità maggiore di Polo II ha un CTD

12

13 Rilassamento della cromatina

14 Trascrizione

15 Maturazione RNA

16 Trascrizione

17 Percentuali di RNA 1% 14% rrna28 S;18S; 5S trna,snrna 85% mrna

18 promotori Elementi del core o elementi cis di legame Elementi di regolazione 1) transcription factor binding sites 2) regulatory units (promoters, enhancers, and silencers) 3) regulatory regions (3 and 5 regulatory regions, exons, and introns).

19 Trascrizione

20 Promotori

21

22

23

24 Promotore Pol II

25

26

27 Trascrizione

28 Fattori generali di trascrizione Sequenze regolatrici legano attivatori o repressori: 1) sequenze attivatrici a monte (UAS) 2) enhancer; 3) Iniziatore (Inr) 4) Silenziatori (Si) 5) Isolatori (Ins) ESEMPI: 1) TFIID attraverso TBP lega (TATA) 2) TFIIB lega (BRE) 3) DPE ed DCE legano TFIID

29 Eucarioti Fattori generali di trascrizione della RNA pol II

30

31

32

33 Complesso di preinizio

34

35

36

37

38

39

40

41

42

43 CTD

44

45

46 Fattori di allungamento della trascrizione P-Tefb CDK9 fosforila la serina 2 determinando : allungamento, splicing e poliadenilazione TF2H fosforila la serina 5 permettendo di reclutare gli enzimi del capping sulla estremità 5 La terminazione inizia con cicli di defosforilazione (fosfatasi) Ser5 (Scp1) ser2 (Fcp1)

47 Fattori di allungamento Altri fattori sono TFIIS ; editing idrolitico. hspt5 anche capping Famiglia ELL limitano il tempo di fermata della RNA pol II sulle sequenze

48

49 1) Sequenza o reclutamento ordinato dei fattori 2) la fosforilazione della coda è necessaria per il rilascio del promotore 3) la fosforilazione pone termine all inizio abortivo 4) gli ottameri istonici devono essere rimossi 5) fattori di allungamento e fasi della trascrizione

50 1) La fosforilazione da parte di TEF-b sulla coda permette di reclutare FACT facilitates chromatin transcription eterodimeri che smantellano i nucleosomi per ricomporli dopo il passaggio del RNA polimerasi

51

52

53 Complesso del mediatore

54

55

56 Capping Maturazione Capping Pliadenilazione splicing

57

58

59

60 Coda poli-a Taglio del messagero Aggiunta di A all estremità 3 tramite la poli-a-polimerasi Degradazione dell RNA associato al RNA pol attraverso una ribonucleasi 5-3 Termine della trascrizione

61

62 Termine trascrizione

63

64 Coda poli-a

65 Enhancer attiva il promotore più vicino a qualunque distanza Porta alla formazione di complessi che interagiscono direttamente o indirettamente con il promotore Agiscono in modo bidirezionale Elemento CAAT Spesso si trovano più copie di questi elementi modulari, perciò legano vari tipi di fattori di trascrizione Agiscono in cis

66 Fattori di trascrizione architettonici

67 Metil-5-citosina

68 CpG 1-2kB Alcune sono conservate

69 CpG island

70 Metilazione dei promotori

71

72 Unità di trascrizione è composta da Ripetizioni in tandem Alternate da spaziatori non trascritti costituti da un numero variabile Organizzatori nucleolari

73 RNA pol I

74

75

76

77

78

79

80

81 Trascrizione

82

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Trascrizione negli Eucariotici

Trascrizione negli Eucariotici Trascrizione negli Eucariotici Cytoplasm DNA RNA Transcription RNA Processing mrna G Nucleus AAAAAA Export G AAAAAA CLASSI DI GENI Le unità di trascrizione eucariotiche sono più complesse di quelle procariotiche

Dettagli

La trascrizione negli eucarioti

La trascrizione negli eucarioti La trascrizione negli eucarioti Il meccanismo della trascrizione Trascrizione eucariotica Analoga a quella procariotica ma i complessi proteici delle RNApolimerasi contengono molte più proteine accessorie

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

LE MOLECOLE DI RNA: rrna trna mrna

LE MOLECOLE DI RNA: rrna trna mrna LE MOLECOLE DI RNA: rrna trna mrna RNA polimerasi Localizzazione Prodotti Effetti dell α-amanitina I Nucleolo 25S, 17S e 5.8S rrna Nessuno II Nucleoplasma mrna, U1, U2, U4 e U5 Fortemente inibitori III

Dettagli

14. La trascrizione eucariotica

14. La trascrizione eucariotica 14. La trascrizione eucariotica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Differenze procarioti ed eucarioti PROCARIOTI

Dettagli

Genetica La trascrizione e i tipi di

Genetica La trascrizione e i tipi di Benjamin A. PIERCE Genetica La trascrizione e i tipi di molecole Prima edizione RNA Capitolo 13: La trascrizione Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 A gene is not directly translated

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina

FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA. 2. Trasmissione dell informazione genetica dal gene alla proteina FUNZIONI DEL DNA E FLUSSO DELL INFORMAZIONE GENETICA 2. Trasmissione dell informazione genetica dal gene alla proteina LA TRASCRIZIONE NEI PROCARIOTI E NEGLI EUCARIOTI PROCARIOTI EUCARIOTI LA TRASCRIZIONE

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente:

LA TRASCRIZIONE. Titolo modulo: Biologia applicata alla ricerca Biomedica. Materiale Didattico. Docente: Materiale Didattico Titolo modulo: Biologia applicata alla ricerca Biomedica LA TRASCRIZIONE Docente: FLUSSI DI INFORMAZIONE ATTRAVERSO LA CELLULA 1. Accessibilità del genoma 2. Assemblaggio del complesso

Dettagli

TRASCRIZIONE E DELL RNA

TRASCRIZIONE E DELL RNA TRASCRIZIONE E MATURAZIONE DELL RNA LA TRASCRIZIONE COME PRIMA TAPPA NEL FLUSSO DAL GENOTIPO AL FENOTIPO LA TRASCRIZIONE E IL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO DESOSSIRIBONUCLEOTIDICO DEL

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti Gli attivatori trascrizionali sono delle proteine modulari domini funzionali sovrapposti DIMOSTRAZIONE SPERIMENTALE DI DOMINI FUNZIONALI SEPARATI NEL TF DI LIEVITO GAL 4! Esperimenti di Ptshane. Cellule

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti

Biologia Molecolare. CDLM in CTF La trascrizione negli eucarioti Biologia Molecolare CDLM in CTF 2010-2011 La trascrizione negli eucarioti I meccanismi della trascrizione Organizzazione generale delle sequenze regolative Il macchinario generale della trascrizione Si

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

Il Dogma Centrale della Biologia

Il Dogma Centrale della Biologia Il Dogma Centrale della Biologia TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA L espressione dell informazione genica segue il PRINCIPIO DI COLINEARITA ESPRESSIONE

Dettagli

Regolazione trascrizionale della biogenesi dei ribosomi in Saccharomyces cerevisiae: geni per snorna e geni ribi

Regolazione trascrizionale della biogenesi dei ribosomi in Saccharomyces cerevisiae: geni per snorna e geni ribi Dottorato di ricerca in Biochimica e Biologia Molecolare XXV ciclo Regolazione trascrizionale della biogenesi dei ribosomi in Saccharomyces cerevisiae: geni per snorna e geni ribi Maria Cristina Bosio

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Trascrizione negli eucarioti

Trascrizione negli eucarioti Trascrizione negli eucarioti TRASCRIZIONE EUCARIOTI Fattori di trascrizione fattori basali, attivatori (costitutivi, non costitutivi), co-attivatori, repressori Enhancer Promotore 100bp 200bp Enhancer:

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

21. Regolazione dell espressione genica

21. Regolazione dell espressione genica 21. Regolazione dell espressione genica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le cellule di un organismo pluricellulare

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione)

Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Espressione Genica Informazione contenuta nei geni (DNA) viene decodificata prima in RNA (Trascrizione) e successivamente in proteine (Traduzione) Nucleotidi e Ribonucleotidi L RNA è costituituito

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

D ora in poi ci occuperemo, per semplicità, soltanto della RNA polimerasi II.

D ora in poi ci occuperemo, per semplicità, soltanto della RNA polimerasi II. RNA Polimerasi di eucarioti (vedi Alberts III ed. pag.483) Il processo di sintesi di RNA su di uno stampo di DNA presenta, negli eucarioti, una complessità assai elevata. A tutt oggi mancano ancora alcune

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

RNA FACTORY geni espressione genica elementi genici regolatori quattro classi principali trascritti

RNA FACTORY geni espressione genica elementi genici regolatori quattro classi principali trascritti RNA FACTORY Il genoma di un organismo è costituito da sequenze di coppie di basi distribuite sui cromosomi. Tutte le coppie di basi del genoma vengono replicate durante la fase di sintesi del DNA, mentre

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

NEGLI EUCARIOTI VARI LIVELLI DI CONTROLLO DELLA ESPRESSIONE GENICA NEI PROCARIOTI: soprattutto a livello TRASCRIZIONALE

NEGLI EUCARIOTI VARI LIVELLI DI CONTROLLO DELLA ESPRESSIONE GENICA NEI PROCARIOTI: soprattutto a livello TRASCRIZIONALE NEGLI EUCARIOTI VARI LIVELLI DI CONTROLLO DELLA ESPRESSIONE GENICA NEI PROCARIOTI: soprattutto a livello TRASCRIZIONALE IN BATTERI: UNA SOLA POLIMERASI IN EUCARIOTI: 3 TIPI DIVERSI (I, II e III) POL II

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Lezione 6 - Trascrizione del DNA

Lezione 6 - Trascrizione del DNA Lezione 6 - Trascrizione del DNA 1. Flusso dell informazione genetica 2. RNA polimerasi 3. Siti di inizio e fine trascrizione 4. Reazione 5. Differenze tra procarioti ed eucarioti 6. Enhancer 7. Maturazione

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

Trascrizione. Testi Watson et al. Biologia Molecolare del Gene, Zanichelli Nelson et al, Principi di Biochimica di Lehninger, Zanichelli

Trascrizione. Testi Watson et al. Biologia Molecolare del Gene, Zanichelli Nelson et al, Principi di Biochimica di Lehninger, Zanichelli Trascrizione Testi Watson et al. Biologia Molecolare del Gene, Zanichelli Nelson et al, Principi di Biochimica di Lehninger, Zanichelli Maurizio Crestani I componen) fondamentali del DNA Polimero di nucleo.di

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica 1 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

Corso di aggiornamento sulle Biotecnologie CusMiBio

Corso di aggiornamento sulle Biotecnologie CusMiBio Corso di aggiornamento sulle Biotecnologie CusMiBio Regolazione dell espressione genica dal DNA alle proteine Prof. Paolo Plevani, Aula 200, 22/09/2014 LEARNING WEEK Qualche novità e/o stimolo sul controllo

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! rimodellatori? Svolgimento del DNA nucleosmale a par6re

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

RNA 29/10/2014. Struttura chimica del RNA

RNA 29/10/2014. Struttura chimica del RNA I Nucleotidi Hanno Tre Componenti Solo DNA Solo RNA Acidi nucleici RNA http://www.uic.edu/classes/phys/phys461/phys450/anjum04/ Struttura chimica del RNA http://www.ncbi.nlm.nih.gov/b ooks/nbk26887/figure/a978/?

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli