Materiale genetico e Caratteri

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Materiale genetico e Caratteri"

Transcript

1 Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma

2 Materiale genetico e Caratteri Elementi fondamentali DNA contiene l informazione genetica L informazione genetica deve essere contenuta nella sequenza delle basi In assenza di DNA (DNA-asi) la sintesi proteica si arresta.. se si aggiunge RNA la sintesi ricomincia

3 Materiale genetico e Caratteri Deduzioni RNA è coinvolto nella sintesi proteica La formazione dell RNA dipende dal DNA L RNA, a differenza del DNA, si trova prevalentemente nel citoplasma, in corrispondenza dei ribosomi (RNA + Proteine) Esisterà una molecola che funge da mediatore capace di trasportare l informazione genetica dal DNA del nucleo ai ribosomi nel citoplasma

4 Materiale genetico e Caratteri La sintesi dell RNA è catalizzata da un enzima la RNA polimerasi RNA polimerasi agisce solo in presenza di DNA L RNA dopo la sintesi si trasferisce dal nucleo al citoplasma dove ha luogo la sintesi proteica Trascrizione Traduzione Proteina DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE

5 Materiale genetico e Caratteri Caratteristiche dell RNA - 4 basi azotate: Timina Uracile - nessun rapporto di complementarietà tra le basi (quantità di A U e G C) - struttura a filamento singolo (no doppia elica) Sintesi dell RNA A è tradotta in U (non in T) - RNA polimerasi - DNA stampo (1 filamento) - Ribonucleosidi trifosfati - Ribonucleotidi legati in direzione Ribonucleotidi complementari ai nucleotidi DNA L informazione genetica contenuta nel DNA viene TRASCRITTA nell RNA

6 Materiale genetico e Caratteri L RNA polimerasi non necessita di inneschi: sintesi direzione 5 3 La trascrizione dell RNA avviene lungo un solo filamento di DNA

7 Materiale genetico e Caratteri Trascrizione dell RNA

8 Materiale genetico e Caratteri Esistono 3 differenti tipi di RNA RNA ribosomiale (rrna): Costituente dei ribosomi dove avviene la sintesi proteica RNA messaggero (mrna): Trascrive il messaggio genetico dal DNA e lo trasferisce nel citoplasma nei ribosomi RNA transfer (trna): Traduce il messaggio genetico trasportando gli aminoacidi sui ribosomi dove avviene la sintesi della catena polipeptidica I 3 tipi di RNA sono sintetizzati da 3 differenti RNA polimerasi RNA polimerasi I = rrna (ad alto PM) RNA polimerasi II = mrna RNA polimerasi III = trna e rrna (a basso PM)

9 Materiale genetico e Caratteri RNA ribosomiale (rrna) Costituente dei ribosomi insieme alle proteine (rapporto 2:1) I ribosomi sono costituiti da 2 subunità (80s e 40S negli eucarioti) La subunità 50S: 2 molecole di rrna + 34 proteine specifiche La subunità 30S: 1 molecola di rrna + 21 proteine specifiche Non chiara la funzione specifica nella sintesi proteica

10 Materiale genetico e Caratteri RNA messaggero (mrna) Responsabile del trasporto del messaggio genetico dal nucleo al citoplasma Possiede una parte iniziale (leader) e una finale (trailer) che non vengono tradotte Le molecole di mrna hanno una lunghezza e un peso molecolare variabile da cui dipende la grandezza della catena polipeptidica La molecola di mrna può essere tradotta in una sola catena o in una serie di catene polipeptidiche differenti Una volta tradotta l mrna viene distrutta e sostituita da altre molecole

11 Materiale genetico e Caratteri RNA transfer (trna) L informazione genetica trascritta nell RNA deve essere tradotta in una sequenza di aminoacidi Come??????? trna funge da molecola adattatrice che ha la capacità di legare un aminoacido specifico e di stabilire legami con l mrna

12 Materiale genetico e Caratteri RNA transfer (trna) - 80 nucleotidi (basso peso molecolare) - struttura a trifoglio (legami H tra le basi) - 3 lobi e 1 gobba: - mancata complementarietà - presenza di basi diverse (modificazione enzimatica) - Estremità 3 : sequenza finale CCA - Estremità 5 : sempre G Trifoglio

13 Materiale genetico e Caratteri RNA transfer (trna) Come si lega ad un amminoacido specifico???? Come riconosce e come si lega all mrna????

14 Materiale genetico e Caratteri RNA transfer (trna) Attivazione dell aminoacido tramite l azione dell enzima Aminoalcetilsintetasi Aminoacido + ATP = Aminoacido + ATP = Aminoacido~AMP + P~P

15 Materiale genetico e Caratteri RNA transfer (trna) Attivazione dell aminoacido tramite l azione dell enzima Aminoalcetilsintetasi Aminoacido~AMP + trna = Aminoacido~AMP + trna = Aminoacido~t-RNA + AMP Reazione altamente specifica = 20 aminoacidi 20 aminoacetilisintetasi trna

16 Materiale genetico e Caratteri RNA transfer (trna) Ogni molecola di trna deve possedere almeno 2 siti di riconoscimento LOBO 1 Unione con la superficie del ribosoma LOBO 2 Anticodone: specifico per l mrna LOBO 3 Unione con l aminoacetilsintetasi

17 Sintesi proteica Materiale genetico e Caratteri Ad una certa sequenza di nucleotidi nell mrna corrisponde una precisa sequenza di aminoacidi nella catena polipeptidica 4 nucleotidi 20 aminoacidi

18 Sintesi proteica Materiale genetico e Caratteri Ad una certa sequenza di nucleotidi nell mrna corrisponde una precisa sequenza di aminoacidi nella catena polipeptidica 4 nucleotidi 20 aminoacidi Codice a lettere singole (4 parole) A G C T Codice a 2 lettere (16 parole) A G C T A AA AG AC AT G GA GG GC GT C CA CG CC CT T TA TG TC TT Codice a 3 lettere (64 parole)

19 Materiale genetico e Caratteri Sintesi proteica UNITA D INFORMAZIONE = 3 BASI = 3 NUCLEOTIDI = TRIPLETTA TRIPLETTA DNA = CODOGENO TRIPLETTA mrna = CODONE TRIPLETTA trna = ANTICODONE IL CODONE DIRIGE L INSERIMENTO DI UN AMINOACIDO NELLA CATENA POLIPEPTIDICA

20 Sintesi proteica Materiale genetico e Caratteri UNITA D INFORMAZIONE = 3 BASI = 3 NUCLEOTIDI = TRIPLETTA

21 Materiale genetico e Caratteri Sintesi proteica La traduzione deve iniziare e finire in modo preciso INIZIO = CODONE AUG = ANTICODONE UAC = METIONINA MODIFICATA IN fmet (N-formilmetionina) Metionina N-formilmetionina No legame peptidico

22 Materiale genetico e Caratteri Sintesi proteica La traduzione deve iniziare e finire in modo preciso INIZIO = CODONE AUG = ANTICODONE UAC = 3 fattori di inizio (IF1,2,3): IF3 si lega con la subunità 30S del ribosoma e poi si lega l mrna Formazione complesso IF2 - trna+fmet Guanosintrifosfato o GTP attraverso la partecipazione del IF1

23 Sintesi proteica Materiale genetico e Caratteri La traduzione deve iniziare e finire in modo preciso Unione della subunità 50S con la 30S per dare origine al ribosoma funzionale così il GTP è idrolizzato e i IF vengono rilasciati

24 Sintesi proteica Materiale genetico e Caratteri La traduzione deve iniziare e finire in modo preciso Sito Peptilico (P) Sito Aminoacilico (A)

25 Sintesi proteica Materiale genetico e Caratteri La traduzione deve iniziare e finire in modo preciso 2 trna Legame peptidico Sito P Sito A Si lega il trna successivo nel sitoa Sito P Sito A Formazione del legame peptidico tra i 2 amminoacidi (peptidiltransferasi sito nella subunità 50S) Sito P Sito A Il ribosoma si muove sull mrna in direzione 5 3 TRASLOCAZIONE (GTP e traslocasi)

26 Sintesi proteica Materiale genetico e Caratteri La traduzione deve iniziare e finire in modo preciso Codone di terminazione (non senso) Sito P

27 Sintesi proteica Materiale genetico e Caratteri La traduzione deve iniziare e finire in modo preciso

28 Sintesi proteica Materiale genetico e Caratteri La traduzione deve iniziare e finire in modo preciso

29 Materiale genetico e Caratteri Sinetesi proteica

30 Sintesi proteica Materiale genetico e Caratteri

31 Codice Genetico Materiale genetico e Caratteri Esiste una corrispondenza tra TRIPLETTE e AMINOACIDI ð CODICE GENETICO 1961 Nirenberg e Mattei Preparazione di un mrna sintetico costituito solo da U Aggiunto ad una miscela con i 20 amminoacidi di cui uno soltanto radioattivo Fenilalanina

32 Materiale genetico e Caratteri Codice Genetico Nirenberg e Mattei dimostrarono certamente l esistenza di un codice genetico ma non precisarono il n di nucleotidi che in sequenza costituivano l UNITA DI INFORMAZIONE in grado di codificare una amminoacido Crick e collaboratori: dimostrazione che il codice genetico funziona a triplette 1) Mutazione singole (perdita o aggiunta di un nucleotidi nella molecola di DNA) rendono inoperante il messaggio ereditario Aggiunta di 1 nucleotide G CAT-CAT-CAT-CAT-CAT-CAT CAT-CGA-TCA-TCA-TCA-TCA 2) Doppie mutazioni di tipo opposto (perdita e aggiunta di un nucleotide) possono ristorare o non l attività del gene Aggiunta di un altro nucleotide G CAT-CGA-TCA-TCA-TCA-TCA CAT-CGA-TCA-TGC-ATC-ATC- 3) La ristorazione avviene solo se i due nucleotidi interessati sono vicini lungo la molecola Aggiunta di un altro nucleotide G CAT-CGA-TCA-TGC-ATG-CAT-CAT

33 Codice Genetico Materiale genetico e Caratteri Quali sono le triplette che codificano i singoli amminoacidi??? A cosa servono le altre 44 triplette? (64 combinazione - 20 amminoacidi) 3 triplette non senso = non codificano alcun aminoacido Solo Met e Trp sono codificate da 1 tripletta Molte codificano lo stesso amminoacido (in genere i primi 2 nucleotidi sono identici) Il CODICE GENETICO si dice DEGENERATO perché in esso un aminoacido può essere codificato da più di una tripletta

34 Materiale genetico e Caratteri Codice Genetico Corrispondenza tra CODONE e ANTICODONE Si riteneva che esistessero 64 trna differenti di cui 3 non senso Si notò che alcuni trna potevano riconoscere codoni differenti Inoltre alcuni presentavano una base nell anticodone non classica inosina VACILLAMENTO DELL ANTICODONE La base azotata all estremità 5 dell anticodone del trna non è spazialmente confinata come le altre 2 ed è per questo in grado di formare legami H con una qualsiasi delle basi del codone (riguarda solo 1 base del codone e dell anticodone) Base dell'anticodone G C A U I Base del codone U o C G U A o G A, U o C

35 Codice Genetico Materiale genetico e Caratteri Il codice genetico viene letto senza SOVRAPPOSIZIONI mrna Es: senza sovrapposizione 5 AGCUUAGAC.3 AGC-UUA-GAC Es: sovrapposizione AGC-GCU-CUU-UUA-UAG. Es: altre letture AGC-UUA-GAC.. GCU-UAG-AC CUU-AGA-C La fase di lettura può cambiare con la conseguenza che una stessa regione del DNA può codificare per differenti catene polipeptidiche Il codice gentico è UNIVERSALE cioè il codice ed il linguaggio genetico è lo stesso in tutte le specie esistenti sulla terra

36 Mendel Materiale genetico e Caratteri Esistenza di unità ereditarie (geni) preposte al controllo dei singoli caratteri Certi individui che possedevano certi geni manifestavano certi caratteri Materiale ereditario (DNA) e i caratteri non possono collegati in un modo semplice e diretto Una serie di reazioni a catena e di interazioni chimico-ambientali partendo dal materiale ereditario conducono al fenotipo finale UN GENE - UN CARATTERE UN GENE - UN ENZIMA UN GENE UNA CATENA POLIPEPTIDICA

37 Schema semplificato del metabolismo della fenilalanina e della 3rosina

38 Analisi del colore dell occhio in Dosophila melanogaster

39 Nel 1961, alla Cambridge University, Brenner e Crick eseguirono l'esperimento decisivo che dimostro come il codice fosse basato su triplede. Con un uso intelligente di mutageni chimici, essi riuscirono a cancellare o a inserire delle coppie di basi nel DNA. Scoprirono così che l'inserzione o la delezione di una singola coppia di basi dava luogo a una pericolosa mutazione deda frameshi1, ossia a uno spostamento del quadro di ledura: tudo il codice a valle della mutazione risultava alterato.

40 Immaginate un codice cos3tuito da parole di tre ledere come segue: CON DUE ALI NEL BLU. Ora immaginate di far cadere la «D». Se si deve preservare la strudura della frase, cos3tuita da parole di tre ledere, ci ritroveremo così: CON UEA LIN ELB LU, ossia con una sequenza priva di senso a par3re dal sito della delezione.

41 La stessa cosa accade quando si inseriscono o si cancellano due coppie di basi: rimuovendo la «D» e la «U», odeniamo CON EAL INE LBL U: un'altra sequenza priva di senso. Ora, che cosa accade se inseriamo o cancelliamo tre ledere? Rimuovendo la «D», e poi «U» ed «E», odeniamo CON ALI NEL BLU: sebbene si sia persa una «parola» - DUE -, abbiamo ciò nondimeno mantenuto il senso del resto della frase.

42 E anche se la delezione interessasse più parole - per esempio se togliessimo la «U», la«e» e infine la «A» - perderemmo solo due parole, e saremo ancora in grado di recuperare la frase desiderata a valle della mutazione: CON DLI NEL BLU. Lo stesso avviene con una sequenza di DNA: una inserzione/delezione singola devasta completamente la proteina a causa dell' effedo frameshix, che modifica ogni amminoacido a valle della mutazione; e altredanto avviene con una inserzione/delezione doppia.

43 Una delezione/inserzione tripla lungo la molecola di DNA non avrà invece necessariamente effe[ catastrofici: comporterà l'aggiunta o la perdita di un amminoacido, ma senza compromedere necessariamente tuda l'a[vità biologica della proteina risultante.

44 Materiale genetico e Caratteri Che cosa è un GENE???? Il segmento di della molecola del DNA (tratto continuo di DNA) che codifica per una catena polipeptidica completa (o per una molecola di RNA) prende il nome di GENE Per potersi esprimere il gene deve essere prima trascritto nel corrispondente mrna il quale viene poi tradotto nel polipeptide In considerazione della quantità di DNA e del n di proteine sintetizzate si deduce che parte del DNA presente nella cellula non venga espresso in proteine

45 Materiale genetico e Caratteri Che cosa è un GENE???? Il segmento di della molecola del DNA (tratto continuo di DNA) che codifica per una catena polipeptidica completa (o per una molecola di RNA) prende il nome di GENE Per potersi esprimere il gene deve essere prima trascritto nel corrispondente mrna il quale viene poi tradotto nel polipeptide In considerazione della quantità di DNA e del n di proteine sintetizzate si deduce che parte del DNA presente nella cellula non venga espresso in proteine

46 Colinearità tra i codogeni del DNA e gli amminoacidi nella catena polipeptidica. Un gene nel nel DNA specifica gli amminoacidi di una catena polipeptidica.

47 Materiale genetico e Caratteri Che cosa è un GENE???? Una unità genica di trascrizione consiste di sequenze di DNA che vengono trascritte e di sequenze di DNA che non vengono trascritte; quelle non trascritte hanno funzione di regolazione. Sequenze non trascritte costituiscono il promore che dirige a RNA polimerasi sul punto di inizio della trascrizione. Il segnale di inizio è dato da una corta sequenza di basi del DNA nelle regioni del promotore, costituita da sette nucleotidi (pribnow box TATAATG) per i procarioti e da quattro nucleotidi (TATA box) per gli eucarioti. L m-rna che si ottiene con la trascrizione e di dimensioni superiori rispetto alla sequenza di amminoacidi che verrà tradotta. Il segmento traducibile in amminoacidi (il gene vero e proprio) inizia sempre con AUG (codone start) e termina con tre triplette di terminazione (codoni stop) UAA, UAG, UGA

48 Materiale genetico e Caratteri Che cosa è un GENE???? Negli eucarioti esistono sequenze di bp, a monte o a valle del promotore capaci di modulare in senso positivo (enhancer) o negativo (silencer) la frequenza della trascrizione. Tali basi non codificano proteine. Geni discontinui. Parte del DNA presente nella cellula non viene espresso in proteine Negli eucarioti il DNA viene trascritto nel nucleo in molecole di RNA messaggero precursore che vengono eleborate e ridotte di dimensioni fino a formare l m- RNA maturo che migra nel citoplasma e viene tradotto in proteine. Il processo di maturazione (accorciamento) può spiegare alcune delle discrepanze tra la quantità di DNA e quella di RNA messaggero.

49 Materiale genetico e Caratteri Geni discontinui. La scoperta dei geni discontinui porta alla deduzione che parte dei geni corrispondente alle zone non appaiate non compare nell RNA messaggero quindi il gene è discontinuo. Le parti del gene che trovano un corrispettivo nell RNA messaggero vengono chiamate esoni, le altre introni. Durante la maturazione l m-rna subisce tagli ad opera di enzimi, le sequenze esoniche vengono ricucite e lrna messaggero risulta più corto.

50 Materiale genetico e Caratteri Geni discontinui Una ipotesi vorrebbe che le sequenze di introni funzionino come distanziatrici degli esoni e aumenterebbero la frequenza delle mutazioni presenti negli esoni cuciti successivamente a formare un gene. Regolazione dell espressione genica L espressione del gene è regolata da meccanismi dipendenti sia dal controllo genetico interno che dall ambiente esterno alla cellula (fattori induttori e inducili). Il prodotto terminale del gene è regolato dall azione di enzimi chiamati reprimibili la cui attività diminuisce in presenza dei loro metaboliti terminali chiamati correpressori.

51 Materiale genetico e Caratteri Regolazione dell espressione genica I geni della sintesi proteica sono soggetti ad azione di altri geni chiamati regolatori. I sistemi inducibili, quando i geni regolatori hanno subito una mutazione non sono più in grado di codificare repressori funzionali nei sistemi inducibili e producono proteine anche quando non c e ne bisogno

52 Filamento stampo (viene trascri,o nel corrispondente RNA) Filamento senso (la sua sequenza e quella che si trova nel RNA messaggero che codifica la proteina) Diversi 3pi di RNA RNA ribosomale rrna (98 %) deriva dal 1% DNA totale - cosetuisce i ribosomi cioe i sie citoplasmaeci dove avviene la sintesi proteica. RNA di trasferimento - trna ha la funzione di tradurre il messaggio geneeco trasportando gli amminoacidi sui ribosomi. RNA messaggero mrna- ha la funzione di trascrivere il messaggio geneeco dal DNA e di trasferirlo nel citoplasma sui ribosomi. RNA piccoli small RNA intervengono nella regolazione della espressione genica RNA di varia dimensione non codificane snrna

53 Rapido turnover e sosetuzione nei ribosomi da altri mrna. RNA messaggero Le molecole di RNA hanno una lunghezza e un peso variabile ed e quindi da ritenere che cio rifle,a la variabilita nelle dimensioni polipepediche. MeEl Guanilato mrna 5 UTR UTR 3 Regione Leader 5 UTR (Untranslated). Al leader si aggiunge il cap (7- meel guanilato) Regione Trailer 3 UTR (Untranslated) (si lega catena polia). AAAAAAA Nei procarioe una singola molecola di mrna dirige la sintesi di piu catene polipeediche con funzioni correlate. Negli eucarioe l mrna va incontro ad un processo di maturazione.

54 Piccoli RNA Recentemente e stato scoperto che quasi tutti gli eucarioti producono piccole molecole di RNA, lunghe nucleotidi. Questi piccoli RNA intervengono nella regolazione di numerosi processi cellulari, impedendo la traduzione dell mrna.

55 Gene: un segmento di DNA che codifica per una catena polipetidica completa o per una molecola di RNA. Alle triplette presenti nel DNA, chiamate codogeni, corrispondono codoni nell RNA messaggero, anticodoni nel trna e aminoacidi specifici nella catena polipetidica in maniera tale che la sequenza dei codogeni nel DNA e colineare con la sequenza degli aminoacidi nella catena polipeptidica che essa codifica. Il gene e trascritto in mrna e tradotto nel polipeptide.

56 Gene: un segmento di DNA che codifica per una catena polipetidica completa o per una molecola di RNA. Alle triplette presenti nel DNA, chiamate codogeni, corrispondono codoni nell RNA messaggero, anticodoni nel trna e aminoacidi specifici nella catena polipetidica in maniera tale che la sequenza dei codogeni nel DNA e colineare con la sequenza degli aminoacidi nella catena polipeptidica che essa codifica. Il gene e trascritto in mrna e tradotto nel polipeptide.

57 I promotori E la porzione del gene dalla parte 5 che dirige la RNA polimerasi sul punto esatto per l inizio della trascrizione. Sito di inizio della trascrizione Regione codificante Esoni TATA box Regione 5 UTR Introni Regione 3 UTR Gene Negli eucarioti, la sequenza che determina il sito di legame della RNA polimerasi inizia circa a 35 nucleotidi a monte dal sito di inizio: TATA (detta TATA box). Nei procarioti TATAAT a 10. Negli eucarioti e frequente la sequenza CAAT (-100).

58 I geni sono discontinui Se si confronta la quantita di DNA con il numero di proteine si deduce che la maggior parte del DNA presente nella cellula non viene espresso in proteine. Mediante osservazioni al microscopio elettronico, e stato osservato che l appaiamento del RNA con il DNA corrispondente generava anse corrispondenti a regioni non ibridate di DNA. Alcune parti del DNA non compaiono nel RNA e quindi la parte codificante del gene e discontinua. Le parti trascritte del gene sono dette esoni, quelle non trascritte introni

59 La Regolazione dell Espressione Genica Quali sono i meccanismi che determinano l accensione o lo spegnimento dell espressione di un gene?

60 Regolazione della Espressione Genica Gli organismi pluricellulari sono costituiti da cellule differenziate che esprimono geni diversi a seconda della loro funzione ed e per questo necessaria una accurata regolazione delle espressione genica in base alle diverse condizioni fisiologiche e stress ambientali. Le conoscenze acquisite finora sulla regolazione genica riguardano i microorganismi ed in particolare E.coli. In particolare e stato studiato il gene Beta-galattosidasi che scinde il lattosio in glucosio e galattosio. La cellula esprime il gene beta-gal a seconda della concentrazione di lattosio nel suo substrato. Induttore o Repressore: molecola che aumenta o diminuisce la quantita di un enzima specifico (Inducibile o Reprimibile)

61 La regolazione dell espressione genica Nei procarioti: Un espressione genica selettiva permette alle cellule di risparmiare energia La regolazione avviene prevalentemente a livello trascrizionale Negli eucarioti: L espressione genica selettiva permette alle cellule di svolgere ruoli specializzati La regolazione avviene a vari livelli

62 Regolazione genica nei procarioti Geni costitutivi: sono costantemente attivi (es. geni che codificano per gli enzimi della glicolisi) Geni regolati: la loro espressione è regolata in modo tale che che la quantità del corrispondente prodotto (proteina o RNA) è controllata in relazione al fabbisogno cellulare (es. sintesi adattativa di enzimi)

63 I repressori e gli attivatori sono molecole proteiche che legano il DNA

64 Le sequenze nucleotidiche del DNA che si legano ad induttori o repressori sono dette operatori.

65 Differenze della regolazione genica fra procarioti ed eucarioti Dimensione e complessità del genoma Compartimentazione del genoma Organizzazione strutturale del genoma Stabilità dell mrna Modificazione post-traduzionale delle proteine Turnover delle proteine

66 Regolazione Genica negli Eucarioti La regolazione genica negli eucarioti e piu complessa e dipende non solo dalla sequenza del DNA ma anche da: 1) Condizioni diverse di avvolgimento e organizzazione del DNA 2) Maturazione del mrna 3) Separazione spaziale tra trascrizione e traduzione. L espressione genica e controllata a livello: -post-trascrizionale, traduzionale e post-traduzionale. Cromatina: Complesso costituito da DNA e proteine (istoni). La trascrizione dipende dalla capacita della RNA polimerasi di legarsi al promotore.

67 Cellula umana contiene circa geni Geni RNA Geni per proteine Ogni cellula in un determinato momento esprime solo una piccola parte di questo potenziale ( 5000 geni) Geni housekeeping metabolismo biosintesi membrana istoni ribosomali Geni tessuto - specifici DIFFERENZIAMENTO CELLULARE A QUESTA ESPRESSIONE SELETTIVA NON CORRISPONDE (IN GENERE) UNA VARIAZIONE DEL CONTENUTO DI DNA

68 Livelli multipli di regolazione dell espressione genica degli eucarioti

69 Esistono molteplici livelli di regolazione dell espressione genica negli eucarioti controllo trascrizionale: legame di fattori trascrizionali tessuto specifici, legame diretto di ormoni, fattori di crescita o elementi intermedi a elementi risponsivi di geni inducibili CITOPLASMA NUCLEO controllo traduzionale traduzione DNA Trascritto primario (precursore) controllo post-trascrizionale: splicing alternativo, polya alternativo, RNA editing tessutospecifico mrna mrna Meccanismi epigenetici: controllo a lungo raggio mediante rimodellamento della struttura della cromatina controllo del trasporto controllo della stabilità degradazione PROTEINA PROTEINA attiva o inattiva controllo post-traduzionale (es. catabolismo)

70 CROMATINA EUCROMATINA -> TRASCRIZIONE POTENZIALE a) geni housekeeping b) geni tessuto-specifici ETEROCROMATINA FACOLTATIVA -> inattiva quando condensata. Fornisce un meccanismo di compensazione: rapporto geni autosomici/geni X-linked maschi = 2/1 donne = 1/1 ETEROCROMATINA COSTITUTIVA -> sempre inattiva; Localizzata nelle regioni peri - e centromeriche

71 Meccanismi epigenetici Fattori che vengono trasmessi alla progenie, ma che non sono direttamente attribuibili alla sequenza del DNA. Metilazione del DNA; Nelle cellule eucariotiche la metilazione è a carico della C. Solo il 3% delle C sono metilate ed in genere è bersaglio della metilazione la C della doppietta CpG. Modificazioni degli istoni; Acetilazioni, fosforilazioni e metilazioni, responsabili di cambiamenti conformazionali della cromatina.

72 Meccanismi epigenetici: Metilazione del DNA La metilazione del DNA è un processo post-replicativo. L estensione delle modificazioni riguardanti la metilazione del DNA è fondamentalmente decisa durante lo sviluppo. La metilazione del DNA è quindi uno dei meccanismi correlati con il differenziamento cellulare, tramite l inibizione dell espressione genica a livello trascrizionale.

73 Meccanismi epigenetici: Modificazioni degli Istoni I residui amminoacidici all N-terminale di ciascun istone (20-60 residui) si estendono al di fuori della superficie del nucleosoma. Queste regioni sono particolarmente ricche in lisina (K) che può essere reversibilmente modificata mediante acetilazione, fosforilazione e metilazione."

74 Modificazioni degli istoni H3 e H4 La lisina 9 di H3 può essere sia acetilata che metilata. L acetilazione è associata alla cromatina trascrizionalmente attiva, ma se la regione cromatinica viene metilata a livello del DNA (CpG), le proteine che si legano al DNA metilato richiamano le deacetilasi istoniche, che rimuovono i gruppi acetile e le metil transferasi istoniche, legate alle CpG binding protein, metilano gli istoni. Il risultato è la condensazione della cromatina.

75 CARATTERISTICHE DELLA CROMATINA Caratteristica Cromatina attiva Cromatina inattiva Conformazione della cromatina Estesa, aperta Condensata Metilazione del DNA Acetilazione degli istoni Poco metilata specialmente nelle regioni del promotore Istoni acetilati Metilata Istoni non acetilati

76 Repressori e attivatori possono dirigere la deacetilazione/acetilazione degli istoni a livello di specifici geni" Importanza della struttura modulare e delle interazioni proteina-proteina

77 Una serie di fattori trascrizionali deve legarsi al promotore prima che possa farlo la RNA polimerasi. Quindi se la RNA polimerasi potrà iniziare la trascrizione dipenderà anche dal legame di proteine regolatorie, attivatori e repressori. Elementi distali Elementi prossimali Promotore basale

78

79

80 Le modificazioni degli istoni e della cromatina inducono cambiamenti reversibili dello stato della cromatina che hanno un ruolo importante nel controllo della espressione genica. L epigenetica studia i cambiamenti ereditabili della espressione geneica che non dipendono dalla sequenza del DNA. Imprinting genomico o parentale: E un tipo di regolazione in cui l espressione di un gene dipende dal gamete di origine. Sintesi degli antociani nell endosperma di mais: Rr (R di orgine materna, r paterna): cariossidi pigmentate Rr (R di orgine paterna, r materna): non pigmentate.

81 Regolazione Trascrizionale Il controllo trascrizionale dipende da proteine regolatrici (Fattori di regolazione) capaci di legarsi a specifiche sequenze di DNA presenti nella regione del promotore e di esercitare un controllo positivo (attivazione) o negativo (disattivazione). Regolazione Post-trascrizionale L aggiunta selettiva della guanosina metilata alla estremita 5 (sito CAP), la poliadenilazione alla estremita 3, la maturazione mediante leliminazione degli introni, il trasporto selettivo dal nucleo al citoplasma e la degradazione selettiva del mrna. Splicing alternativo.

82 Silenziamento dell RNA Regolazione mediante piccoli RNA che degradano l mrna causando il silenziamento del gene (RNA silencing).

83 Quando coinvolge i microrna si parla di RNA interference. Il silenziamento puo avvenire anche attarverso il blocco della trascrizione causato dalla interazione del piccolo RNA con il promotore del gene (transcriptional gene silencing). Ai mirna viene attribuito un significato evolutivo molto importante: l uomo e lo scimpanze hanno genomi al 99% uguali ma di recente e stato scoperto che lo scimpanze non ha molti geni codificanti mirna presenti nell uomo. Ciò è probabilmente alla base delle differenze tra noi e gli scimpanze. Gli sirna sono invece utilizzati nella difesa degli attacchi virali, nella risposta a stress, nel controllo dall azione mutagena dei trasposoni.

84 Regolazione Traduzionale Presenza di fattori di inzio, di allungamento e di terminazione per la sintesi proteica, sulla capacita dei ribosomi di legarsi alle molecolae di mrna, sulla vita media delle molecole di mrna, sulle concentrazioni di trna, e sull azione dei piccoli RNA. Regolazione Post-Traduzionale Tagli della estremita della catena polipetidica per permettere il trasporto della proteina in uno specifico comparto cellulare. La vita di una proteina puo essere piu o meno lunga e regolata dalla addizione di diversi aminoacidi alla estremita amminica. Ad es. Met e Gly stabilizzano la proteina mentre Arg, Asp provocano la sua degradazione.

85 Catabolismo delle proteine Un modo per regolare la attivita delle proteine è il controllo della loro degradazione mediante la via ubiquitina-proteosoma. Il proteosoma e un complesso proteico di 700kDa presente nel nucleo e nel citoplasma. L ubiquitina, scoperta nel 1975, e una proteina di 76 aminoacidi e peso molecolare di 8.5 kda altamente conservata. Il suo legame alle proteine le indirizza alla degradazione da parte del proteosoma.

86 Il Dogma Centrale della Biologia Molecolare Alla luce delle conoscenze disponibili oggi, lo schema proposto negli anni 50 del XX secolo si e molto modificato.

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO.

SAGGIO DI LEGAME AI RIBOSOMI: SE L AMMINOACIL-tRNA RICONOSCE LA TRIPLETTA, VI SI LEGA E NON RIESCE A PASSARE IL FILTRO CHE, COSì, DIVIENE RADIOATTIVO. TRADUZIONE LA TRADUZIONE E QUEL PROCESSO ATTRAVERSO CUI SI PASSA DAL LINGUAGGIO RIBONUCLEOTIDICO DELL RNA A QUELLO AMINOACIDICO DELLE PROTEINE. IL CODICE GENETICO E L INSIEME DI CODONI (TRIPLETTE NUCLEOTIDICHE)

Dettagli

Elementi di genetica agraria

Elementi di genetica agraria Elementi di genetica agraria Obiettivo Il corso si pone l obiettivo di fornire agli studenti elementi di conoscenza della genetica di base e applicata ai fini del miglioramento genetico delle piante erbacee

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1)

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1) CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi http://hyperphysics.phy astr.gsu.edu/hbase/biology/ribosome.html http://www.accessexcellence.org/rc/vl/gg/ecb/ecb_images/01_24_organelles.jpg

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi

Dettagli

Le idee della chimica

Le idee della chimica G. Valitutti A.Tifi A.Gentile Seconda edizione Copyright 2009 Zanichelli editore Capitolo 25 Le basi della biochimica 1. I carboidrati 2. I lipidi 3. Gli amminoacidi, i peptidi e le proteine 4. La struttura

Dettagli

Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Citosol Ribosomi Sintesi proteica

Citosol Ribosomi Sintesi proteica CITOSOL (1) Citosol Ribosomi Sintesi proteica Biotecnologie_2012 Tutta la porzione non strutturata che costituisce la parte liquida del citoplasma. In esso si trovano in soluzione tutte le molecole necessarie

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

Compattamento del DNA nel cromosoma

Compattamento del DNA nel cromosoma Compattamento del DNA nel cromosoma DOMA CENTRALE DELLA BIOLOIA l'informazione genetica, contenuta nel nucleo nella molecola di DNA, si trasferisce al citoplasma. I geni del DNA vengono, nel nucleo, trascritti

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina

Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina Riprendiamo ora il cosiddetto dogma centrale della biologia: dal gene alla proteina trascrizione traduzione L mrna lascia il nucleo e si posiziona sugli organelli chiamati ribosomi, contenenti rrna Trascrizione

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Stop codons & Readthrough. 15 novembre 2013 Alessio Branchini

Stop codons & Readthrough. 15 novembre 2013 Alessio Branchini Stop codons & Readthrough 15 novembre 2013 Alessio Branchini Fedeltà nel trasferimento dell informazione genetica Discriminazione tra basi complementari (Watson-Crick e wobble base pairs) e non complementari

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

E. Giordano 16/09/2010

E. Giordano 16/09/2010 GRUPPO NAZIONALE DI BIOINGEGNERIA XXIX Scuola Annuale BIOLOGIA SINTETICA Bressanone 13-17 settembre 2010 1/41 COSTITUENTI MOLECOLARI DELLO CHASSIS CELLULARE Emanuele GIORDANO II Facoltà di Ingegneria Dipartimento

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti

Dall RNA alle proteine. La traduzione nei procarioti e negli eucarioti Dall RNA alle proteine La traduzione nei procarioti e negli eucarioti Codice genetico La sequenza dell mrna viene decodificata a gruppi di tre nucleotidi, e tradotta in una sequenza di amminoacidi 4 x

Dettagli

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica

Il Codice Genetico. La decodifica della sequenza nucleotidica in. sequenza aminoacidica Il Codice Genetico La decodifica della sequenza nucleotidica in sequenza aminoacidica La sequenza del mrna viene letta a gruppi di 3 nucleotidi, senza interruzioni e senza sovrapposizioni; 4 3 = 64 ---------64

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

TRASCRIZIONE e TRADUZIONE

TRASCRIZIONE e TRADUZIONE TRASCRIZIONE e TRADUZIONE Trascrizione e traduzione Dogma centrale della biologia molecolare: processo con cui l informazione contenuta nel DNA dirige la sintesi delle proteine. Trascrizione Maturazione

Dettagli

SINTESI DELLE PROTEINE

SINTESI DELLE PROTEINE SINTESI DELLE PROTEINE IN UN GIORNO DI UN INDIVIDUO ADULTO NORMALE: -100 grammi vengono introdotti con la dieta -400 grammi vengono degradati -400 grammi vengono sintetizzati -100 grammi vengono consumati

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Codoni di STOP: UAA UAG UGA

Codoni di STOP: UAA UAG UGA PARTECIPANO ALLA TRADUZIONE: trna e aminoacidi Aminoacil-tRNA sintetasi Ribosomi mrna, che contiene una Open Reading Frame (ORF) CODONE DI INIZIO CODONE DI STOP 5 Cap NNNNNN AUG AAA GCA AUU----(n codoni)----uga

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

mrna + 20 aminoacidi In vitro nulla

mrna + 20 aminoacidi In vitro nulla La sintesi proteica mrna + 20 aminoacidi In vitro nulla Il codice genetico I geni controllano la struttura delle proteine: in che modo? 4 nucleotidi A, T, C, G 20 aminoacidi Esiste un codice che converte

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli