Soluzioni ai problemi del Capitolo 15. Domande concettuali

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Soluzioni ai problemi del Capitolo 15. Domande concettuali"

Transcript

1 Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come nel caso dei geni delle immunoglobuline; la metilazione del DNA, che inibisce la trascrizione; le regioni di controllo di specifici loci, che agiscono localmente sulla conformazione della cromatina. 2. La trascrizione. Questo livello comprende i fattori di regolazione della trascrizione/gli elementi di controllo, ossia le interazioni che possono attivare o inibire la trascrizione. 3. Il livello dell RNA. Questo include la sua maturazione, la regolazione dello splicing, la stabilità dell RNA, la regolazione dell emivita della molecola e la traduzione dell RNA attraverso le proteine che legano RNA; la regolazione mediante mirna. 4. Il livello della proteina. Questo comprende il feedback inibitorio, le piccole molecole che modulano l attività enzimatica, le modificazioni covalenti post-trascrizionali che cambiano la struttura della proteina e influenzano la sua attività. C2. Gli elementi di controllo sono sequenze relativamente brevi riconosciute da fattori di trascrizione. Dopo che i fattori di trascrizione si sono legati agli elementi di controllo, l efficienza della trascrizione sarà influenzata sia attivandola che inibendola, in base all azione della proteina di regolazione. Gli elementi di controllo sono localizzati tipicamente nella regione a monte del promotore, ma possono essere localizzati in qualunque altra posizione (ossia a monte o a valle) e anche molto distanti dal promotore. C3. La modulazione dei fattori di trascrizione si riferisce alle diverse modalità per cui può essere regolata la funzione di questi fattori. Le tre vie principali sono mediate dal legame di effettori, dalle interazioni proteina-proteina, e dalle modificazioni covalenti. C4. L attivazione trascrizionale avviene quando un fattore di trascrizione si lega a un elemento di controllo e attiva la trascrizione. Queste proteine, definite transattivanti, possono interagire con TFIID e/o Mediatore per promuovere l assemblaggio dell RNA polimerasi e dei fattori generali di trascrizione alla regione del promotore. Essi possono inoltre alterare la struttura della cromatina, in modo che l RNA polimerasi e i fattori di trascrizione possano avere accesso al promotore. L inibizione della trascrizione avviene invece quando un repressore interagisce per esempio con TFIID e/o Mediatore per inibire l RNA polimerasi. C5. A. Vero B. Falso C. Vero D. Falso, esso causa sovraregolazione. C6. A. Legame al DNA B. Legame al DNA C. Dimerizzazione proteica C7. I recettori degli steroidi: il legame di un effettore e le interazioni proteina-proteina; la proteina CREB: le modificazioni covalenti e le interazioni proteina-proteina.

2 C8. Affinché il recettore dei glucocorticoidi si leghi all elemento GRE, un ormone steroideo deve anzitutto entrare nella cellula. Esso si lega quindi al recettore dei glucocorticoidi, il quale rilascia la proteina HSP90. Questo evento rende esposto un segnale di localizzazione nucleare (NLS) del recettore, che gli consente di formare un dimero e di traslocare nel nucleo. Una volta all interno del nucleo, il dimero si lega a una coppia di elementi GRE che attivano la trascrizione dei geni adiacenti. C9. 1. Potrebbe trovarsi nel dominio di legame al DNA, così che il recettore non riconoscerebbe gli elementi GRE. 2. Potrebbe trovarsi nel dominio HSP90, così che HSP90 non sarebbe rilasciata quando si lega l ormone. 3. Potrebbe trovarsi nel dominio di dimerizzazione, così che il recettore non potrebbe formare il dimero. 4. Potrebbe trovarsi nel dominio di localizzazione nucleare, così che il recettore non potrebbe muoversi all interno del nucleo. 5. Potrebbe trovarsi nel dominio che attiva l RNA polimerasi, così che il recettore non potrebbe attivare la trascrizione, anche se potrebbe legarsi agli elementi GRE. C10. La fosforilazione della proteina CREB la fa agire da attivatore trascrizionale. La proteina non fosforilata può ancora legarsi a CRE, ma non stimola la trascrizione. C11. A. Nessun effetto B. Nessun effetto C. Sarebbe inibita D. Nessun effetto C12. A. L ormone glucocorticoide alla fine viene degradato dalla cellula. Il legame al suo recettore è un processo reversibile, che avviene con un certo valore di affinità. Se la concentrazione dell ormone cade al di sotto del valore di affinità l ormone viene rilasciato dal recettore, che cambia conformazione e non resta ulteriormente legato al DNA. B. Una fosfatasi rimuoverà i gruppi fosfato dalla proteina CREB, la quale cesserà la sua funzione di attivatore trascrizionale. C13. E corretta la possibilità 2. Siccome sappiamo già che la proteina E e la proteina Id formano eterodimeri con bhlh, ci attendiamo che le tre proteine abbiamo tutte un motivo a cerniera di leucine, che favorisce la dimerizzazione. Inoltre abbiamo bisogno di spiegare perché la proteina Id inibisca la trascrizione, mentre la proteina E la favorisce. Come si vede dalla possibilità 2, la proteina Id non ha un dominio di legame al DNA. Perciò, essa forma un eterodimero con bhlh miogenica, e l eterodimero probabilmente non si legherà molto bene al DNA. Invece, quando la proteina E forma l eterodimero con bhlh, saranno disponibili due domini di legame al DNA e dunque il legame avverrà appropriatamente (Nota: per una descrizione di queste proteine vai al Capitolo 23). C14. L enhancer che si trova in A funzionerebbe, mentre quelli localizzati in B e in C no. La sequenza riconosciuta dall attivatore è 5' GTAG 3' in un filamento, e 3' CATC 5' in quello opposto. Si tratta della stessa disposizione che si osserva in A. Invece in B e in C la disposizione è 5' GATG 3' e 3' CATC 5', quindi le due basi centrali (A e T) non sono nell ordine corretto.

3 C15. Ci sono quattro tipi di basi (A, T, G, C) e questa sequenza CRE contiene 8 bp, per cui in base al semplice caso essa dovrebbe formarsi ogni 4 8 bp, ossia ogni bp. Se dividiamo 3 miliardi per questo numero ne risulta che ci attendiamo di osservare questa sequenza ogni volte. Questo valore è molto più grande rispetto al numero di geni che sono effettivamente attivati da CREB. Le ragioni per cui CREB non attiva oltre geni sono diverse, per esempio: 1. Un sito CRE funzionale prevede che due di queste sequenze si trovino vicine, perché CREB funziona da omodimero. 2. I siti CRE casuali potrebbero essere lontani da una sequenza genica. 3. La conformazione della cromatina che contiene una sequenza CRE potrebbe non essere accessibile a CREB. C16. Domini di transattivazione Domini di legame all ormone Domini di dimerizzazione Domini di legame al DNA Ecco un disegno ipotetico del recettore dei glucocorticoidi. Esso forma omodimeri. Il dimero qui rappresentato mostra una simmetria speculare sull asse verticale. In arancione viene mostrato l ormone. Sono indicate le posizioni dei vari domini funzionali. C17. La mutazione potrebbe causare un difetto in: 1. Un recettore dell adrenalina 2. Una proteina G 3. Adenilato ciclasi 4. Protein chinasi A 5. La proteina CREB

4 6. La sequenza CRE del gene tirosina idrossilasi Se altri geni fossero regolati in modo appropriato da CREB, potremmo concludere che la mutazione probabilmente cade nel gene stesso della tirosina idrossilasi. Forse CRE è stata mutata e non riconosce più la proteina CREB. C18. La fibra di 30 nm è la forma predominante di cromatina all interfase. Perché la trascrizione abbia luogo. la cromatina deve essere convertita dalla conformazione chiusa a quella aperta. Questo processo implica una diminuzione del livello di ripiegamento della cromatina, e può coinvolgere modificazioni della localizzazione di proteine istoniche. Gli attivatori trascrizionali reclutano l istone acetiltransferasi e gli enzimi di rimodellamento della cromatina ATP-dipendenti nella regione, e avviene la conversione alla conformazione aperta. C19. La metilazione del DNA è l aggiunta di un gruppo metilico a una base del DNA. In molte specie eucariotiche questo avviene sulla citosina in una sequenza CG. Dopo la metilazione de novo questa viene trasmessa da madre a figlia. Siccome la replicazione del DNA è semiconservativa, il DNA neosintetizzato contiene un solo filamento metilato. La DNA metiltransferasi riconosce le doppie eliche emimetilate e aggiunge il gruppo metilico in modo da mantenere lo schema di metilazione originale. C20. Forse la metiltransferasi è responsabile della metilazione e dell inibizione di un gene che porta la cellula a differenziarsi in cellula del muscolo. La metiltransferasi viene inattivata dalla mutazione. C21. Si tratta di una stringa di coppie nucleotidiche che contengono un numero elevato di siti CpG. Le isole CpG sono spesso nelle vicinanze dei promotori. Quando l isola è metilata la trascrizione è inibita. Questo può essere dovuto all incapacità degli attivatori di riconoscere i promotori metilati e/o agli effetti delle proteine che legano metil-cpg, che possono promuovere la conformazione chiusa della cromatina. C22. La funzione dei fattori di splicing è quella di influenzare la scelta dei siti di splicing nell RNA. In certi tipi cellulari, la concentrazione di particolari fattori di splicing è maggiore che in altri tessuti. L elevata concentrazione di questi fattori e la regolazione della loro attività può promuovere la scelta di determinati siti di splicing e quindi causare uno splicing tessuto-specifico. C23. Come si vede nella Figura 15.10, la caratteristica unica dell mrna dell α tropomiosina sintetizzato nel muscolo liscio è che esso contiene l esone 2. I fattori di splicing specifici del muscolo liscio possono riconoscere la giunzione di splicing all estremità 3 dell introne 1 e al 5 dell introne 2, promuovendo una forma di splicing che include l esone 2 nel trascritto maturo. Inoltre, siccome le cellule del muscolo liscio non possiedono l esone 3 nell mrna dell α tropomiosina, deve esistere un soppressore dello splicing che si lega al 3 dell introne 2, promuovendo l esclusione dell esone 3. C24. Per un mrna con vita breve uno svantaggio è che la cellula usa probabilmente molta energia per produrlo. Se una cellula ha bisogno di una proteina codificata da un mrna con vita breve, il gene deve essere trascritto continuativamente a causa della rapida degradazione dell mrna. Il vantaggio è che la cellula interrompe rapidamente la sintesi proteica. Con molecole di mrna a vita più lunga, è necessario un periodo di tempo maggiore per spegnere la sintesi proteica dopo che è terminata la trascrizione. C25. L interferenza dell RNA è il fenomeno per cui in presenza di molecole di RNA a doppio filamento si ottiene il silenziamento di un mrna complementare. Perché ciò avvenga la doppia

5 elica di RNA deve essere maturata da dicer in piccoli frammenti (i microrna o mirna). Questi si associano con un complesso chiamato RISC e si legano all mrna complementare, portando alla sua degradazione oppure a inibirne la traduzione. C26. Anzitutto il mirna a doppio filamento può derivare dalla trascrizione di un gene, sottoforma di pre-mirna. Secondo, può essere prodotto da un virus. Terzo, l inserzione multipla dello stesso gene in un genoma può portare alla trascrizione di entrambi i filamenti di DNA e quindi alla produzione di RNA a doppio filamento. C27. Condizioni quali infezione virale, mancanza di nutrienti, shock termico, esposizione a metalli pesanti, causano la fosforilazione di eif2α. Bloccare la sintesi proteica può impedire la proliferazione del virus. In mancanza di nutrienti, si preservano le risorse. Durante lo shock termico le proteine potrebbero subire un ripiegamento scorretto, da cui il vantaggio di aver bloccato la sintesi proteica. Infine, poiché gli ioni metalli sono tossici e possono indurre danno al DNA, è vantaggioso che l organismo pluricellulare arresti la divisione cellulare in queste condizioni. C28. Se la stabilità dell mrna è bassa, questo significa che viene degradato più velocemente. Perciò, la bassa stabilità risulta in bassa concentrazione di mrna. La lunghezza della coda di polia è un fattore che influenza la stabilità. Una coda più lunga rende l mrna più stabile. Certi mrna possiedono inoltre delle sequenze che influenzano la loro vita media. Per esempio, gli elementi ricchi in AU si trovano in diversi mrna a vita breve. Questi elementi sono riconosciuti da proteine cellulari che conducono l mrna a una rapida degradazione. Domande sperimentali S1. Un sito sensibile alla DNasi I viene tagliato più spesso di altri siti cromosomici in presenza dell enzima. Ciò significa che per conformazione esso è molto accessibile al taglio enzimatico. Quando un gene diviene trascrizionalmente attivo esso sarà anche più suscettibile alla DNasi I perché in questa regione il DNA assume la conformazione aperta. S2. La nucleasi S1 taglia il DNA a singolo filamento ma non quello a doppia elica. Se un gene nella conformazione aperta viene digerito dalla DNasi I, esso non potrà ibridare con la sonda complementare. In questo caso la sonda a singolo filamento sarà digerita dalla nucleasi S1. Invece, se il gene si trova nella conformazione chiusa ed è resistente all azione della DNasi I, la sonda potrà ibridare e non verrà digerita da S1. Perciò, la capacità della nucleasi S1 di degradare la sonda ci riferisce se il gene è stato o non è stato precedentemente digerito dalla DNasi I. Il passaggio di precipitazione serve a separare i frammenti di DNA dai nucleotidi liberi. Se la sonda marcata è legata al filamento complementare di DNA, essa sarà protetta dalla degradazione con S1 e verrà ritrovata nel pellet. Ciò avviene quando il gene della globina si trova nella conformazione chiusa. Al contrario, se la sonda marcata non si lega al DNA complementare essa sarà degradata in nucleotidi liberi che restano nel sovranatante. Questo è ciò che avviene se il gene della globina è nella conformazione aperta. S3. Questi risultati indicano che i fibroblasti mantengono la metilazione perché dopo la replicazione possono riconoscere il DNA emimetilato e completare la metilazione. Però le cellule non vanno incontro a metilazione de novo in quanto se il DNA non era metilato nella cellula figlia esso resterà tale. S4. Se la banda di DNA è di 3800 bp, questo significa che non è metilata, perché è stata tagliata da NotI che non è attivo sul DNA non metilato. Se il frammento è di 5300 bp allora assumiamo che il

6 DNA non è stato tagliato da NotI in quanto metilato. Ora consideriamo la corsia 4. Quando il gene viene isolato dalla radice, esso non è metilato perché la banda è di 3800 bp. Questo suggerisce che il gene T sia espresso nella radice. Negli altri campioni il DNA forma la banda da 5300 bp, cosa che indica che esso è metilato. Questo profilo di metilazione è coerente con la funzione nota del gene T: ci saremmo attesi di trovarlo espresso nelle cellule della radice, dato che la sua funzione è quella di assorbire il fosfato dal suolo. S5. Sulla base di questi risultati gli enhancer risultano presenti in A, D ed E. Quando vengono deleti il livello di trascrizione diminuisce. Nella regione B c è anche un silenziatore, perché la delezione di questa regione aumenta il tasso di trascrizione. In C non sembrano esserci elementi di controllo, perlomeno non elementi attivi nel muscolo. La regione F contiene il promotore centrale e la sua delezione inibisce la trascrizione. S6. A. Sulla base della transfezione delle cellule di rene si ritiene che la regione B contenga un silenziatore. Sulla base della transfezione delle cellule pancreatiche si ritiene che la regione A contenga un enhancer. B. Le cellule pancreatiche non esprimono il repressore che si lega al silenziatore della regione B. C. Le cellule di rene esprimono il repressore che si lega alla regione B e reprime la trascrizione. Esse esprimono il gene a valle solo se il silenziatore viene rimosso. Come si è detto in B, questo repressore non è espresso nelle cellule pancreatiche. S8. Quando essi hanno iniettato l RNA antisenso di mex-3, hanno osservato livelli più bassi ma misurabili dell mrna di questo gene. Tuttavia l iniezione di entrambi i filamenti di senso e antisenso che porterebbe alla formazione di una struttura a doppio filamento, causa la perdita completa dell mrna di mex-3 dalle cellule, perché l RNA a doppio filamento silenzia il gene.

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

scaricato da www.sunhope.it

scaricato da www.sunhope.it Recettori a tirosina chinasi I recettori a tirosina chinasi presentano vari domini Una regione di legame (extracellulare) Una regione transmembrana Una coda intracellulare con numerose tirosine scaricato

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

TRASDUZIONE DEL SEGNALE

TRASDUZIONE DEL SEGNALE TRASDUZIONE DEL SEGNALE TRASDUZIONE DEL SEGNALE Specificità (specificità riconoscimento) Amplificazione e diversificazione della risposta (cascata enzimatica) Integrazione tra segnali Spegnimento del segnale

Dettagli

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti Gli attivatori trascrizionali sono delle proteine modulari domini funzionali sovrapposti DIMOSTRAZIONE SPERIMENTALE DI DOMINI FUNZIONALI SEPARATI NEL TF DI LIEVITO GAL 4! Esperimenti di Ptshane. Cellule

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA

MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA MECCANISMI MOLECOLARI MEMORIA PROCEDURALE/IMPLICITA APLYSIA: VANTAGGI: Sistema nervoso semplice Poche e grosse (1 mm) cellule riconoscibili (20.000) MEMORIA PROCEDURALE Priming Motorie Apprendimento (abilità,abitudini)

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

Recettori di superficie

Recettori di superficie Recettori di superficie Esistono 3 classi principali di recettori di superficie 1. Recettori annessi a canali ionici 2. Recettori accoppiati alle proteine G 3. Recettori associati ad enzimi Recettori

Dettagli

Segnalazione cellulare e trasduzione del segnale. Comunicazione fra le cellule

Segnalazione cellulare e trasduzione del segnale. Comunicazione fra le cellule Segnalazione cellulare e trasduzione del segnale Comunicazione fra le cellule Le cellule comunicano e interagiscono tra loro tramite il fenomeno della segnalazione cellulare Una cellula segnalatrice produce

Dettagli

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica.

Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. Concanavalina A Emoglobina subunità Trioso fosfato isomerasi Una proteina qualsiasi assume costantemente un unica conformazione ben definita, cui è legata la sua azione biologica. 1 La conformazione è

Dettagli

CONTROLLO ORMONALE DEL METABOLISMO GLUCIDICO DA PARTE DI GLUCAGONE, ADRENALINA E INSULINA

CONTROLLO ORMONALE DEL METABOLISMO GLUCIDICO DA PARTE DI GLUCAGONE, ADRENALINA E INSULINA CONTROLLO ORMONALE DEL METABOLISMO GLUCIDICO DA PARTE DI GLUCAGONE, ADRENALINA E INSULINA QUESTI ORMONI REGOLANO IL FLUSSO DEI METABOLITI NELLA GLICOLISI, NELLA GLICOGENO-SINTESI, NELLA GLIGENO-LISI E

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Proliferazione e morte cellulare sono eventi fisiologici

Proliferazione e morte cellulare sono eventi fisiologici MORTE CELLULARE Proliferazione e morte cellulare sono eventi fisiologici Omeostasi tissutale (di tessuti dinamici) Sviluppo embrionale Eliminazione di strutture corporee inutili - Fasi di scultura/rimodellamento

Dettagli

NUCLEOTIDI e ACIDI NUCLEICI

NUCLEOTIDI e ACIDI NUCLEICI NUCLEOTIDI e ACIDI NUCLEICI Struttura dei nucleotidi Il gruppo fosfato conferisce carica negativa e proprietà acide FUNZIONI DEI NUCLEOTIDI MOLECOLE DI RISERVA DI ENERGIA L idrolisi dei nucleosidi trifosfato

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli