Applicazioni biotecnologiche in systems biology

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Applicazioni biotecnologiche in systems biology"

Transcript

1 Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013

2 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013

3 Regolazione genica Elementi molecolari e di sequenza

4 Relazione Genotipo - Fenotipo Quale parte del genotipo è correlabile col fenotipo? Presenza/assenza di geni Presenza/assenza di un regolatore e/o del motivo di binding Presenza/assenza di interazione fra proteine Regolazione non convenzionale : asrna, metilazione, Un gene -> un fenotipo Un genoma -> molti fenotipi

5 Regolazione genica Aggiunta di una componente dinamica al sistema cellulare Risposta agli stimoli esterni Risparmio di energia Espressione al momento giusto Assenza di interferenza fra prodotti proteici Espansione delle capacita dell organismo Paradosso C-value / G-value Negli organismi complessi la differenza la fa la regolazione

6 Regolazione genica La regolazione genica aggiunge complessita Una possibile spiegazione al paradosso del G-value Un numero alto di geni richiede un altissimo numero di regolatori Scarsa efficienza dell organismo

7 A livello molecolare Regolazione in cis L elemento regolativo e prossimo al gene regolato Specifiche sequenze di DNA vengono riconosciute dai TF Interazione con l RNA polimerasi Attivatori Repressori Il legame col dna in prossimita del gene e sufficiente ad alterare l espressione del gene Legame meno evidente negli eucarioti La sequenza riconosciuta dal TF e chiamata motivo

8 A livello molecolare Domini funzionali Separati Indipendenti Domini di legame al DNA e riconoscimento del cognate motif Helix-turn-helix, zinc-finger, leucine-zipper Gli altri domini della proteina indicano il segnale che viene ricnosciuto dal regolatore Modularita dei domini differente comportamento regolativo

9 A livello molecolare Domini di legame al DNA e riconoscimento del cognate motif Helix-turn-helix, zinc-finger, leucine-zipper Gli altri domini della proteina indicano il segnale che viene ricnosciuto dal regolatore Modularita dei domini differente comportamento regolativo

10 Individuazione motivi Come individuare un TF binding motif? Prossimita ad un gene -400 / +100 Sequenza piu variabile rispetto ad un gene Non si applica la traduzione Il legame del TF ha una componente termodinamica Variabilita nella forza del legame Regole meno certe nell individuazione delle sequenze

11 Individuazione motivi Come individuare un TF binding motif? Determinazione dei geni regolati Esperimenti di analisi della trascrizione (microarray, RNAseq, geni reporter, ) Non esiste un metodo per stabilire il motivo a partire dal dominio Allineamento sequenze a monte dei geni regolati Ricerca motivi conservati

12 Sequence logo Contenuto di informazione Posizione nel motivo Come individuare un TF binding motif? Descrive un motivo Alcune posizioni del motivo sono fisse, altre estremamente variabili Spesso i domini di legame al DNA sono dimerici e palindromi

13 Position weigth matrix (PWM) Position specific scoring matrix (PSWM) Come individuare un TF binding motif? Descrive un motivo Indica la frequenza (e quindi la probabilita ) di trovare un certo nucleotide ad ogni posizione Utilizzato per cercare le occorrenze di un motivo all interno di un genoma

14 Position weigth matrix (PWM) Position specific scoring matrix (PSWM)

15 Ricerca motivo A G T C A G T C T T G A T C A A G A T C A A A T G C Bassa similarita Ricerca PWM tramite sliding window Per ogni posizione nucleotidica verifico la similarita con il motivo Calcolo di uno score di similarita per ogni posizione Ottengo uno score per ogni posizione Scarsa similarita : indica il rumore di fondo delle mie sequenze target Alta similarita : score significativamente maggiore del rumore di fondo

16 Ricerca motivo A G T C A G T C T T G A T C A A G A T C A A A T G C Alta similarita Ricerca PWM tramite sliding window Per ogni posizione nucleotidica verifico la similarita con il motivo Calcolo di uno score di similarita per ogni posizione Ottengo uno score per ogni posizione Scarsa similarita : indica il rumore di fondo delle mie sequenze target Alta similarita : score significativamente maggiore del rumore di fondo

17 Ricerca motivo Numero di hit Score Ricerca PWM tramite sliding window Ottengo uno score per ogni posizione Scarsa similarita : indica il rumore di fondo delle mie sequenze target Alta similarita : score significativamente maggiore del rumore di fondo

18 Contenuto informativo Differenza fra procarioti ed eucarioti

19 Contenuto informativo Differenza fra procarioti ed eucarioti

20 Contenuto informativo Che caratteristiche deve avere un motivo per distinguersi dal rumore di fondo? Analisi del contenuto di informazione del motivo e del genoma Dipendenza dalla dimensione e contenuto di basi del motivo Dipendenza dalla dimensione e contenuto di basi del genoma

21 Contenuto informativo Che caratteristiche deve avere un motivo per distinguersi dal rumore di fondo? Batteri: 10 6 possibili siti di legame Eucarioti: 10 9 possibili siti di legame Contenuto minimo di informazione di un motivo

22 Contenuto informativo Contenuto di informazione di un motivo Dipendenza dalla frequenza delle varie basi nel genoma Sostanzialmente dal contenuto in GC

23 Contenuto informativo

24 Contenuto informativo Genoma 1: Alto contenuto in GC Alto contenuto informativo Genoma 2: Basso contenuto in GC Basso contenuto informativo

25 Contenuto minimo di informazione di un dominio

26 Che caratteristiche deve avere un motivo per distinguersi dal rumore di fondo? Nei batteri la maggior parte dei motivi di legame e facilmente distinguibile dal background Pochi siti di legame sono necessari ad assicurare il legame del TF Negli eucarioti i motivi non sono distinguibili dal rumore di fondo Molti motivi in cluster sono necessari a garantire effetti regolativi

27 Reti logiche I sistemi cellulari come molecular computing machines Oppure molecular lego

28 Reti logiche Requisiti di un sistema regolativo: 1.Stimolo 2.Trasmissione al target 3.Risposta 4.Reset del sistema

29 Reti logiche Trasduzione del segnale: Un singolo stimolo può indurre una o più risposte Una singola risposta può essere controllata da un singolo segnale o influenzata da molti segnali Ciascuna risposta può essere stimolatoria o inibitoria La trasmissione del segnale può smorzare o amplificare gli stimoli

30 Reti logiche Caratteristiche di una rete regolativa: Tende ad essere unidirezionale Ha un componente logico Produce un pattern dinamico

31 Reti logiche Representation of a promoter as a logic gate Hunziker A et al. PNAS 2010;107:

32 Reti logiche Si possono fare analogie con i circuiti integrati per quanto riguardo il processamento del segnale. Importanti differenze: Bassa velocita di trasmissione del segnale Nei batteri la velocita di regolazione e proporzionale al tempo di generazione Bassa sincronicita Bassa interconnessione I regolatori globali sono pochi Basso numero di nodi Similarita Proprieta ON/OFF del segnale Espressione basale ( 1nM) Attivazione espressione ( 1μM)

33 Reti logiche La regolazione puo essere approssimata come una funzione proporzionale alla concentrazione del TF e della sua forza di legame al promotore Piu regolatori possono interagire assieme Ognuno risponde al proprio stimolo Fattori importanti per determinare l effetto dell interazione La forza di legame di ciascun regolatore (misurabile tramite cistanti di dissociazione) L interazione fisica (sterica) fra i regolatori e la RNA polimerasi Dipendente dalla distanza reciproca dei siti di legame Dipendente dalla distanza dei promotori dalla RNA polimerasi

34 Reti logiche Operatori logici Legame forte Legame debole Interazione cooperativa Il modo con cui i due regolatori interagiscono fra loro determina il modo con cui viene processato il segnale ed espresso o meno il gene target Il posizionamento relativo dei promotori e importante Il DNA e a doppia elica!

35 Reti logiche Operatori logici Lo stesso regolatore puo agire da attivatore o repressore La differenza sta nella posizione del motivo E l interazione con altri regolatori Concetti importanti in synthetic biology Possibile costruire un gene che reagisce a determinati stimoli sfruttando i regolatori gia esistenti

36 Reti logiche Operatori logici Cascate regolative La somma delle varie logiche determina pattern di espressione particolari Difficolta di predizione Alta dinamicita e modularita del sistema

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico rocessi biologici in cui sono coinvolti sistemi a due componenti Utilizzazione di elementi necessari alla crescita (azoto); NtrC Virulenza (BvgAS di Bordetella pertussis) Resistenza a metalli pesanti (pco)

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

I mirna NEI MECCANISMI ANTIVIRALI

I mirna NEI MECCANISMI ANTIVIRALI Davide Schiavone Biochimica A.A. 2004-2005 I mirna NEI MECCANISMI ANTIVIRALI I processi di difesa antivirale operati da RNA sfruttano diversi meccanismi che sono raggruppati sotto il nome di RNA silencing.

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Beatrice Arosio Dipartimento di Medicina Interna, Università degli Studi di Milano U.O. di Geriatria, Fondazione IRCCS

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà Bioinformatica Analisi del trascrittoma Dott. Alessandro Laganà Analisi del trascrittoma Regolazione dell espressione genica I microarray cdna microarray Oligo microarray Affymetrix Chip Analisi dei dati

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici)

De-constructing and Reconstructing. Life. (smontare e costruire oggetti biologici) De-constructing and Reconstructing Life (smontare e costruire oggetti biologici) ogni oggetto biologico rappresenta un particolare stato di aggregazione e di organizzazione della materia, corrispondente

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

Programmazione individuale per competenze CLASSE 3^B LST. Materia: biologia

Programmazione individuale per competenze CLASSE 3^B LST. Materia: biologia Programmazione individuale per competenze CLASSE 3^B LST Materia: biologia La classe lavora bene. L'interesse per la materia è nella norma. Esistono pochi casi di scarso risultato che destano preoccupazione.

Dettagli

Classe: 5ESC Indirizzo: Liceo Scientifico Materia: Scienze naturali (Chimica, Biologia,

Classe: 5ESC Indirizzo: Liceo Scientifico Materia: Scienze naturali (Chimica, Biologia, LICEO SCIENTIFICO STATALE "G.B.QUADRI" VICENZA DOCUMENTO DEL CONSIGLIO DI CLASSE (Regolamento, art.5; O. M. 38 art.6) Anno scolastico 2014-2015 RELAZIONE FINALE DEL DOCENTE All. A Classe: 5ESC Indirizzo:

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

PNEINEWS ALIMENTAZIONE E CANCRO LE DUE FACCE I NUOVI SAPERI DELLA SALUTE. Cibi che promuovono, cibi che proteggono

PNEINEWS ALIMENTAZIONE E CANCRO LE DUE FACCE I NUOVI SAPERI DELLA SALUTE. Cibi che promuovono, cibi che proteggono rivista della società italiana di psico - neuro - endocrino - immunologia diretta da Francesco Bottaccioli PNEINEWS I NUOVI SAPERI DELLA SALUTE ALIMENTAZIONE E CANCRO LE DUE FACCE Cibi che promuovono,

Dettagli

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences

Il DNA e la cellula. Versione 2.3. Versione italiana. ELLS European Learning Laboratory for the Life Sciences Il DNA e la cellula Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013

Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 1. Tabella degli insegnamenti Manifesto degli Studi Laurea Magistrale in BIOINFORMATICA a.a. 2012-2013 Insegnamento SSD CFU Risultati di apprendimento previsti Applicazioni Web per la Biomedicina MED/04

Dettagli

Sperimenta il BioLab

Sperimenta il BioLab Progetto Sperimenta il BioLab Centro Università di Milano - Scuola per le Bioscienze e le Biotecnologie http://www.cusmibio.unimi.it/ I laboratori del Cus-Mi-Bio dedicati a "SPERIMENTA IL BIOLAB" si trovano

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

strutture di Proteine

strutture di Proteine Laboratorio di Bioinformatica I Database di strutture di Proteine Dott. Sergio Marin Vargas (2014 / 2015) Dal gene alla proteina La funzione della proteina è nella sua struttura 3D. Struttura delle proteine

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli