Applicazioni biotecnologiche in systems biology

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Applicazioni biotecnologiche in systems biology"

Transcript

1 Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013

2 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013

3 Regolazione genica Elementi molecolari e di sequenza

4 Relazione Genotipo - Fenotipo Quale parte del genotipo è correlabile col fenotipo? Presenza/assenza di geni Presenza/assenza di un regolatore e/o del motivo di binding Presenza/assenza di interazione fra proteine Regolazione non convenzionale : asrna, metilazione, Un gene -> un fenotipo Un genoma -> molti fenotipi

5 Regolazione genica Aggiunta di una componente dinamica al sistema cellulare Risposta agli stimoli esterni Risparmio di energia Espressione al momento giusto Assenza di interferenza fra prodotti proteici Espansione delle capacita dell organismo Paradosso C-value / G-value Negli organismi complessi la differenza la fa la regolazione

6 Regolazione genica La regolazione genica aggiunge complessita Una possibile spiegazione al paradosso del G-value Un numero alto di geni richiede un altissimo numero di regolatori Scarsa efficienza dell organismo

7 A livello molecolare Regolazione in cis L elemento regolativo e prossimo al gene regolato Specifiche sequenze di DNA vengono riconosciute dai TF Interazione con l RNA polimerasi Attivatori Repressori Il legame col dna in prossimita del gene e sufficiente ad alterare l espressione del gene Legame meno evidente negli eucarioti La sequenza riconosciuta dal TF e chiamata motivo

8 A livello molecolare Domini funzionali Separati Indipendenti Domini di legame al DNA e riconoscimento del cognate motif Helix-turn-helix, zinc-finger, leucine-zipper Gli altri domini della proteina indicano il segnale che viene ricnosciuto dal regolatore Modularita dei domini differente comportamento regolativo

9 A livello molecolare Domini di legame al DNA e riconoscimento del cognate motif Helix-turn-helix, zinc-finger, leucine-zipper Gli altri domini della proteina indicano il segnale che viene ricnosciuto dal regolatore Modularita dei domini differente comportamento regolativo

10 Individuazione motivi Come individuare un TF binding motif? Prossimita ad un gene -400 / +100 Sequenza piu variabile rispetto ad un gene Non si applica la traduzione Il legame del TF ha una componente termodinamica Variabilita nella forza del legame Regole meno certe nell individuazione delle sequenze

11 Individuazione motivi Come individuare un TF binding motif? Determinazione dei geni regolati Esperimenti di analisi della trascrizione (microarray, RNAseq, geni reporter, ) Non esiste un metodo per stabilire il motivo a partire dal dominio Allineamento sequenze a monte dei geni regolati Ricerca motivi conservati

12 Sequence logo Contenuto di informazione Posizione nel motivo Come individuare un TF binding motif? Descrive un motivo Alcune posizioni del motivo sono fisse, altre estremamente variabili Spesso i domini di legame al DNA sono dimerici e palindromi

13 Position weigth matrix (PWM) Position specific scoring matrix (PSWM) Come individuare un TF binding motif? Descrive un motivo Indica la frequenza (e quindi la probabilita ) di trovare un certo nucleotide ad ogni posizione Utilizzato per cercare le occorrenze di un motivo all interno di un genoma

14 Position weigth matrix (PWM) Position specific scoring matrix (PSWM)

15 Ricerca motivo A G T C A G T C T T G A T C A A G A T C A A A T G C Bassa similarita Ricerca PWM tramite sliding window Per ogni posizione nucleotidica verifico la similarita con il motivo Calcolo di uno score di similarita per ogni posizione Ottengo uno score per ogni posizione Scarsa similarita : indica il rumore di fondo delle mie sequenze target Alta similarita : score significativamente maggiore del rumore di fondo

16 Ricerca motivo A G T C A G T C T T G A T C A A G A T C A A A T G C Alta similarita Ricerca PWM tramite sliding window Per ogni posizione nucleotidica verifico la similarita con il motivo Calcolo di uno score di similarita per ogni posizione Ottengo uno score per ogni posizione Scarsa similarita : indica il rumore di fondo delle mie sequenze target Alta similarita : score significativamente maggiore del rumore di fondo

17 Ricerca motivo Numero di hit Score Ricerca PWM tramite sliding window Ottengo uno score per ogni posizione Scarsa similarita : indica il rumore di fondo delle mie sequenze target Alta similarita : score significativamente maggiore del rumore di fondo

18 Contenuto informativo Differenza fra procarioti ed eucarioti

19 Contenuto informativo Differenza fra procarioti ed eucarioti

20 Contenuto informativo Che caratteristiche deve avere un motivo per distinguersi dal rumore di fondo? Analisi del contenuto di informazione del motivo e del genoma Dipendenza dalla dimensione e contenuto di basi del motivo Dipendenza dalla dimensione e contenuto di basi del genoma

21 Contenuto informativo Che caratteristiche deve avere un motivo per distinguersi dal rumore di fondo? Batteri: 10 6 possibili siti di legame Eucarioti: 10 9 possibili siti di legame Contenuto minimo di informazione di un motivo

22 Contenuto informativo Contenuto di informazione di un motivo Dipendenza dalla frequenza delle varie basi nel genoma Sostanzialmente dal contenuto in GC

23 Contenuto informativo

24 Contenuto informativo Genoma 1: Alto contenuto in GC Alto contenuto informativo Genoma 2: Basso contenuto in GC Basso contenuto informativo

25 Contenuto minimo di informazione di un dominio

26 Che caratteristiche deve avere un motivo per distinguersi dal rumore di fondo? Nei batteri la maggior parte dei motivi di legame e facilmente distinguibile dal background Pochi siti di legame sono necessari ad assicurare il legame del TF Negli eucarioti i motivi non sono distinguibili dal rumore di fondo Molti motivi in cluster sono necessari a garantire effetti regolativi

27 Reti logiche I sistemi cellulari come molecular computing machines Oppure molecular lego

28 Reti logiche Requisiti di un sistema regolativo: 1.Stimolo 2.Trasmissione al target 3.Risposta 4.Reset del sistema

29 Reti logiche Trasduzione del segnale: Un singolo stimolo può indurre una o più risposte Una singola risposta può essere controllata da un singolo segnale o influenzata da molti segnali Ciascuna risposta può essere stimolatoria o inibitoria La trasmissione del segnale può smorzare o amplificare gli stimoli

30 Reti logiche Caratteristiche di una rete regolativa: Tende ad essere unidirezionale Ha un componente logico Produce un pattern dinamico

31 Reti logiche Representation of a promoter as a logic gate Hunziker A et al. PNAS 2010;107:

32 Reti logiche Si possono fare analogie con i circuiti integrati per quanto riguardo il processamento del segnale. Importanti differenze: Bassa velocita di trasmissione del segnale Nei batteri la velocita di regolazione e proporzionale al tempo di generazione Bassa sincronicita Bassa interconnessione I regolatori globali sono pochi Basso numero di nodi Similarita Proprieta ON/OFF del segnale Espressione basale ( 1nM) Attivazione espressione ( 1μM)

33 Reti logiche La regolazione puo essere approssimata come una funzione proporzionale alla concentrazione del TF e della sua forza di legame al promotore Piu regolatori possono interagire assieme Ognuno risponde al proprio stimolo Fattori importanti per determinare l effetto dell interazione La forza di legame di ciascun regolatore (misurabile tramite cistanti di dissociazione) L interazione fisica (sterica) fra i regolatori e la RNA polimerasi Dipendente dalla distanza reciproca dei siti di legame Dipendente dalla distanza dei promotori dalla RNA polimerasi

34 Reti logiche Operatori logici Legame forte Legame debole Interazione cooperativa Il modo con cui i due regolatori interagiscono fra loro determina il modo con cui viene processato il segnale ed espresso o meno il gene target Il posizionamento relativo dei promotori e importante Il DNA e a doppia elica!

35 Reti logiche Operatori logici Lo stesso regolatore puo agire da attivatore o repressore La differenza sta nella posizione del motivo E l interazione con altri regolatori Concetti importanti in synthetic biology Possibile costruire un gene che reagisce a determinati stimoli sfruttando i regolatori gia esistenti

36 Reti logiche Operatori logici Cascate regolative La somma delle varie logiche determina pattern di espressione particolari Difficolta di predizione Alta dinamicita e modularita del sistema

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

PERCHE I BATTERI HANNO SUCCESSO

PERCHE I BATTERI HANNO SUCCESSO PERCHE I BATTERI HANNO SUCCESSO VERSATILITA METABOLICA VELOCITA DI ADATTAMENTO ALLE VARIAZIONI AMBIENTALI Livia Leoni Università Roma Tre Dipartimento Biologia Laboratorio di Biotecnologie Microbiche Stanza

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

CLASSE I classico A e B

CLASSE I classico A e B LICEO SCIENTIFICO "A. APROSIO" VENTIMIGLIA CLASSE I classico A e B Anno scolastico 2011-2012 UNITA' DIDATTICA N 1 METODI ED ORGANIZZAZIONE DEI CONCETTI IN BIOLOGIA 1.1 LE CARATTERISTICHE COMUNI A TUTTI

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

ID55/2005 PROGETTO R&S Lo sviluppo di nuovi inibitori delle istone deacetilasi per un approccio epigenetico alla terapia dei tumori.

ID55/2005 PROGETTO R&S Lo sviluppo di nuovi inibitori delle istone deacetilasi per un approccio epigenetico alla terapia dei tumori. SCHEDE TECNICHE INTERVENTI CONCLUSI ATI CONGENIA - CONGENIA Srl Milano - DAC Srl Milano - NIKEM RESEARCH Srl Bollate MI - ISTITUTO EUROPEO DI ONCOLOGIA Milano - ISTITUTO FIRC DI ONCOLOGIA MOLECOLARE Milano

Dettagli

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico rocessi biologici in cui sono coinvolti sistemi a due componenti Utilizzazione di elementi necessari alla crescita (azoto); NtrC Virulenza (BvgAS di Bordetella pertussis) Resistenza a metalli pesanti (pco)

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

L essenziale di biologia molecolare della cellula

L essenziale di biologia molecolare della cellula Bruce ALBERTS et al. L essenziale di biologia molecolare della cellula Seconda edizione Capitolo 7: Dal DNA alle proteine: come la cellula legge il genoma Alberts et al., L ESSENZIALE DI BIOLOGIA MOLECOLARE

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

2 H H + O=O 2 H2O un legame chimico si rompe se si forma un altro legame chimico

2 H H + O=O 2 H2O un legame chimico si rompe se si forma un altro legame chimico RNA DNA Cl Cl Cl* + Cl* la rottura di un legame chimico può portare a formare radicali liberi 2 H H + O=O 2 H2O un legame chimico si rompe se si forma un altro legame chimico Strutture del DNA: a doppia

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

I mirna NEI MECCANISMI ANTIVIRALI

I mirna NEI MECCANISMI ANTIVIRALI Davide Schiavone Biochimica A.A. 2004-2005 I mirna NEI MECCANISMI ANTIVIRALI I processi di difesa antivirale operati da RNA sfruttano diversi meccanismi che sono raggruppati sotto il nome di RNA silencing.

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Programmazione individuale per competenze CLASSE 3^A CMB. Materia: Biologia, microbiologia e biotecnologie

Programmazione individuale per competenze CLASSE 3^A CMB. Materia: Biologia, microbiologia e biotecnologie Programmazione individuale per competenze CLASSE 3^A CMB Materia: Biologia, microbiologia e biotecnologie Situazione della classe Accordi con la classe Accordi con le altre discipline Correlazione con

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti

Gli attivatori trascrizionali sono delle proteine modulari. domini funzionali sovrapposti Gli attivatori trascrizionali sono delle proteine modulari domini funzionali sovrapposti DIMOSTRAZIONE SPERIMENTALE DI DOMINI FUNZIONALI SEPARATI NEL TF DI LIEVITO GAL 4! Esperimenti di Ptshane. Cellule

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

PROGRAMMA DI BIOLOGIA. CLASSE 2^ F a. s. 2014 2015. Prof.ssa RUBINO ALESSANDRA

PROGRAMMA DI BIOLOGIA. CLASSE 2^ F a. s. 2014 2015. Prof.ssa RUBINO ALESSANDRA ISTITUTO TECNICO INDUSTRIALE DI STATO "ENRICO FERMI" Via Luosi n. 23-41124 Modena Tel. 059211092 059236398 - (Fax): 059226478 E-mail: info@fermi.mo.it Pagina web: www.fermi.mo.it PROGRAMMA DI BIOLOGIA

Dettagli

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi

Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi Il flusso dell informazione genetica il ruolo dei polimeri di nucleotidi trascrizione traduzione DNA RNA Proteina replicazione DNA replicazione: sintesi del DNA trascrizione: sintesi del RNA traduzione:

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer

Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Correlazione tra profilo genetico e biochimico di Pin1 nella malattia di Alzheimer Beatrice Arosio Dipartimento di Medicina Interna, Università degli Studi di Milano U.O. di Geriatria, Fondazione IRCCS

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

PROGRAMMAZIONE DIDATTICA PROF. RAMIN GINO CLASSE III B SCIENTIFICO A.S 2015/2016 MATERIA : SCIENZE

PROGRAMMAZIONE DIDATTICA PROF. RAMIN GINO CLASSE III B SCIENTIFICO A.S 2015/2016 MATERIA : SCIENZE PROGRAMMAZIONE DIDATTICA PROF. RAMIN GINO CLASSE III B SCIENTIFICO A.S 2015/2016 MATERIA : SCIENZE LIVELLI DI PARTENZA La classe è attenta ma poco partecipe, qualcuno porta anche dei contributi personali

Dettagli

Protocollo dei saperi imprescindibili

Protocollo dei saperi imprescindibili Protocollo dei saperi imprescindibili Ordine di scuola:professionale DISCIPLINA: Scienze integrate( Scienze della Terra e Biologia) RESPONSABILE: Meri Teti CLASSI SECONDE SEZIONE B INDIRIZZO: Grafico CONOSCENZE/CONTENUTI:

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Programma Didattico Annuale

Programma Didattico Annuale LICEO SCIENTIFICO STATALE GALILEO GALILEI PdQ - 7.06 Ediz.: 1 Rev.: 0 Data 02/09/05 Alleg.: D01 PROG. M2 PROCEDURA della QUALITA' Programma Didattico Annuale Anno Scolastico 2012/2013 MATERIA : Scienze

Dettagli

Programmazione individuale per competenze CLASSE 3^B LST. Materia: biologia

Programmazione individuale per competenze CLASSE 3^B LST. Materia: biologia Programmazione individuale per competenze CLASSE 3^B LST Materia: biologia La classe lavora bene. L'interesse per la materia è nella norma. Esistono pochi casi di scarso risultato che destano preoccupazione.

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà Bioinformatica Analisi del trascrittoma Dott. Alessandro Laganà Analisi del trascrittoma Regolazione dell espressione genica I microarray cdna microarray Oligo microarray Affymetrix Chip Analisi dei dati

Dettagli

I MICRORGANISMI E GLI ALIMENTI

I MICRORGANISMI E GLI ALIMENTI Le applicazioni attuali delle biotecnologie NON OGM nel settore alimentare diego.mora@unimi.it www.distam.unimi.it I MICRORGANISMI E GLI ALIMENTI Quanti microrganismi ingeriamo con gli alimenti? Si ingeriscono

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno

Dettagli

Strategie per lo sviluppo di antivirali

Strategie per lo sviluppo di antivirali Strategie per lo sviluppo di antivirali Attacco del virus al recettore Ingresso Spoliazione Trascrizione e traduzione Modifiche post-traduzionali Replicazione del genoma virale Assemblaggio/maturazione

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli