INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA"

Transcript

1 INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA LUISA PIERFEDERICI 1

2 NUTRIGENETICA Studio delle variazioni genetiche nell uomo che causano differenti risposte fenotipiche alle molecole introdotte con il cibo. Molecole introdotte con il cibo Interazioni a livello genomico 2

3 I composti introdotti con la dieta possono esercitare a livello del genoma umano effetti indiretti o diretti alterando l espressione genica. Una dieta personalizzata può essere uno strumento idoneo alla prevenzione per le patologie degenerative. Il grado in cui la dieta può influenzare la salute dipende dal corredo genetico di ciascun essere umano

4 4

5 L intolleranza al lattosio o ipolattasia è un esempio di polimorfismo genetico 5

6 Molecola di lattosio. L enzima lattasi-florizina idrolasi(lph)

7 L ipolattasia deriva dalla ridotta attività fisiologica dell enzima LPH prodotto dalle cellule dell intestino tenue. 7

8 Le persone intolleranti al lattosio manifestano i primi sintomi a 2-3 anni Diventano completamente intolleranti a 5-10 anni Essi vengono chiamati lattasi non persistenti. Coloro che invece possiedono l enzima ancora attivo vengono chiamati lattasi persistenti. 8

9 Esiste un test per individuare gli intolleranti al lattosio: Breath Test all idrogeno Somministrando lattosio ad un soggetto intollerante, sarà possibile rinvenire una quota di idrogeno esalato dal respiro superiore rispetto a quella riscontrata precedentemente alla somministrazione. 9

10 Il gene per l enzima lattasi, denominato LCT, è localizzato nel cromosoma 2, è formato da 50 kb e presenta nella sua sequenza 17 esoni. Immagine cromosoma

11 I lattasi persistenti sono coloro che hanno subito una mutazione nel gene regolatore dell enzima lattasi, per cui digeriscono il lattosio anche in età adulta. I lattasi non persistenti sono coloro che non hanno subito una mutazione per cui dallo Mutanti Non svezzamento mutanti in poi hanno una produzione limitata.

12 La mutazione coinvolge un singolo nucleotide situato a 14 Kb prima del punto di inizio della trascrizione della lattasi, precisamente in un introne adiacente al gene MCM6. La mutazione è dovuta ad un polimorfismo nella posizione C/T secondo il database, ed è una sostituzione del nucleotide C T in un punto del gene regolatore di LCT 12

13 Sezione nucleotidica del gene mutante GAGTATCGGTGGATGAAGAAAAAATAGTCTCACATGTCTTCATTTCCATCCTTG GCTCAGTACAGCTCCAGTTCCATTATTCTTAAACATCTATTAACATGATTGCTAAA TAATTACACAGGCTAACTGCCAAGCATTTTTCACAGGAAGCAAGGCACTGCTC TTCTGGCTTATGCAAAAGGGTCACTGTTTTTTTTTTTTTTTTAACTTTATCTTGTT TTGATTGAAGAAACATCTCTAAAAATACCAT [C/T] TGAGTGCAAGATAAAAAGGAAATAGCAATCAAGGCAACAAAGCTAAGCACAT GCAACAATATAGATGATTTGGGGGTGGGACAGTACAGAATTCAGAACTGATAG AAGTTATCAGCTCCATATTTCAGAAAGACCTAATGTCTTCCTTCTGCTTATACTGT TCTGACAGAATTTTAATTTTGGCAGAGATCACTCTCGATGTTATGATGTACTGAT TCAGAGGTCCCAAATCAGTAACCTGATCCTAGAT 13

14 Esistono 3 genotipi nella popolazione europea: Genotipo Incidenza Fenotipo TT ca. 40% nessun segno di PLI (Intolleranza Primaria al Lattosio) TC ca. 45% nessun segno di PLI, portatore CC ca. 15% predisposizione genetica per PLI (Europa) L allele con la base T è dominante rispetto a quello con la base C, quindi solo il genotipo CC manifesterà l intolleranza al Lattosio. 14

15 ORIGINE DELLA MUTAZIONE MOLTO VICINA AI NOSTRI TEMPI Sono stati raccolti dall University College of London e dall Università di Mainz campioni di DNA di scheletri umani del Neolitico risalenti al 5840 e al 5000 a.c. Hanno scoperto che la mutazione nel gene che controlla la nostra capacità di digerire il latte non era presente in nessun campione. La mutazione genetica apparsa di recente in termini di evoluzione è divenuta comune perchè ha attribuito ai soggetti che la possedevano un enorme vantaggio nella sopravvivenza e permettendo tramite la selezione naturale di trasmetterla ai figli. 15

16 DISTRIBUZIONE DELLA MUTAZIONE NELLA POPOLAZIONE MONDIALE La frequenza alla lattasi persistenza varia drasticamente tra le differenti popolazioni: Percentuale Bassa Lattasi frequenza persistenza alta in nelle Svezia molto popolazioni e frequente Danimarca asiatiche. tra al i beduini nord, decrescendo del deserto in africani percentuale e arabici spostandosi a sud 16

17 L alta frequenza dell allele per la lattasi persistenza potrebbe essere il risultato di anni di selezione naturale che hanno favorito le popolazioni del neolitico dedite alla pastorizia.

18 In questa tabella: diffusione della mutazione in Europa 18

19 Tabella che riporta i dati riguardanti la diffusione della mutazione genetica in vari gruppi etnici. 19

20 CONCLUSIONI Da quanto è emerso si evince che la nutrigenomica è in grado di spiegare l insorgenza di patologie correlate all alimentazione. È stato anche interessante notare come ci sia una correlazione tra genetica e cultura: la mutazione che ha dato origine alla tolleranza al lattosio ha favorito certe popolazioni nello sviluppo di un economia nomade pastorale.

21 21

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

CENTRO BREATH TEST 13C-LATTOSIO BREATH TEST

CENTRO BREATH TEST 13C-LATTOSIO BREATH TEST ARS MEDICA Centro Medico Polispecialistico VIA M. ANGELONI, 80/A - PERUGIA 06124 TEL/FAX: 075 5000388 CELL: 334 2424824 E-Mail: info@arsmedicapg.it Sito Web: www.arsmedicapg.it CENTRO DI ALTA SPECIALIZZAZIONE

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

NUTRI-GENOKIT FUNZIONE GENE POLIMORFISMO RISULTATO EFFETTO. BsmI. TaqIB. FokI. ApaI C677T A1298C. BsmI. TaqI. ApaI. rs9939609.

NUTRI-GENOKIT FUNZIONE GENE POLIMORFISMO RISULTATO EFFETTO. BsmI. TaqIB. FokI. ApaI C677T A1298C. BsmI. TaqI. ApaI. rs9939609. REPORT TECNICO: RISULTATI DELL ANALISI Nella tabella vengono indicati tutti i parametri ed i geni che vengono studiati facendo il test NUTRI-GENOKIT : una guida completa verso l alimentazione personalizzata.

Dettagli

Allergia da alimenti. Cause. Manifestazioni cliniche

Allergia da alimenti. Cause. Manifestazioni cliniche Allergia da alimenti Il problema delle reazioni avverse agli alimenti era noto fin dai tempi degli antichi greci e particolari manifestazioni erano già state associate all ingestione di cibi. Tutti gli

Dettagli

TEST GENETICI PER IL DIABETE E LE SUE COMPLICANZE

TEST GENETICI PER IL DIABETE E LE SUE COMPLICANZE Discover yourself TEST GENETICI PER IL DIABETE E LE SUE COMPLICANZE www.diabs.it A chi sono rivolti i nostri test A persone senza il diabete L insieme di suscettibilità genetica e abitudini di vita scorrette

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

Riccardo Troncone Dipartimento di Pediatria Università Federico II, Napoli. I carboidrati nell alimentazione del bambino

Riccardo Troncone Dipartimento di Pediatria Università Federico II, Napoli. I carboidrati nell alimentazione del bambino Riccardo Troncone Dipartimento di Pediatria Università Federico II, Napoli I carboidrati nell alimentazione del bambino I carboidrati nell alimentazione del bambino Chimica I carboidrati nella dieta Indice

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Affidabilità nella diagnostica

Affidabilità nella diagnostica Affidabilità nella diagnostica Passione per la ricerca Research & Innovation è un laboratorio di medicina molecolare che esegue test genetici avanzati al servizio dei medici e delle strutture di diagnosi

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

LE EPATITI B e C. Verso una terapia personalizzata

LE EPATITI B e C. Verso una terapia personalizzata LE EPATITI B e C Verso una terapia personalizzata 3 L EPATITE B LE EPATITI B e C Le epatiti B e C rappresentano un campo molto complesso della Clinica Medica. La Medicina di Laboratorio propone nuove analisi

Dettagli

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA INDICE pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA 1.1. Il concetto d identificazione... 9 1.2. L identificazione nella storia....

Dettagli

ISTITUTO TECNICO ECONOMICO MOSSOTTI

ISTITUTO TECNICO ECONOMICO MOSSOTTI SECONDE AFM - TUR UdA n. 1 Titolo: biosfera/evoluzione dei viventi/tassonomia Acquisire e decodificare concetto di complessità e di interdipendenza all'interno di un sistema biologico Generalità sulla

Dettagli

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT1 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 GREGOR MENDEL 1822-1884 2 2 Grandi navigatori 3 3 Rotte commerciali per le

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica DSTB - Università degli Studi di Udine P.le Kolbe,1-33100 Udine - ITALIA

Dettagli

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013

La sindrome di Lynch. Cancro colonrettale ereditario non poliposico o HNPCC. G. A. Pablo Cirrone. lunedì 11 marzo 2013 La sindrome di Lynch Cancro colonrettale ereditario non poliposico o HNPCC G. A. Pablo Cirrone 1 Caratteristiche generali I HNPCC (Hereditary Non-Polyposis Colonrectal Cancer) è caratterizzato dalla comparsa,

Dettagli

Istituto Kandinsky Anno Scolastico 2011-12. Programma di SCIENZE DELLA TERRA E BIOLOGIA - Classi prime

Istituto Kandinsky Anno Scolastico 2011-12. Programma di SCIENZE DELLA TERRA E BIOLOGIA - Classi prime Istituto Kandinsky Anno Scolastico 2011-12 Programma di SCIENZE DELLA TERRA E BIOLOGIA - Classi prime Testo in adozione: di: M. Di Stefano - S. Pederzoli - A. Pizzirani UNA INTRODUZIONE ALLO STUDIO DEL

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel

Dettagli

L integrazione scolastica degli allievi con Distrofia Muscolare Duchenne o Becker

L integrazione scolastica degli allievi con Distrofia Muscolare Duchenne o Becker L integrazione scolastica degli allievi con Distrofia Muscolare Duchenne o Becker Raffaela Maggi USP - Ancona Falconara Marittima 16.12.08 Sotto il termine DISTROFIA MUSCOLARE si raccolgono un gruppo di

Dettagli

TEST AL LATTOSIO : quando richiederlo?

TEST AL LATTOSIO : quando richiederlo? 3 Giornate Gastro-epatologiche Cuneesi Vicoforte, 19-20 febbraio 2010 TEST AL LATTOSIO : quando richiederlo? Carlo Sguazzini, Marco Astegiano, Renato Bonardi, Daniele Simondi S.C. Gastro-epatologia 1 U.

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

CAPITOLO 2 I TRATTI COMPLESSI

CAPITOLO 2 I TRATTI COMPLESSI CAPITOLO 2 I TRATTI COMPLESSI Tratti semplici e tratti complessi Come detto nel capitolo precedente, la genetica classica studia fondamentalmente i cosiddetti tratti mendeliani semplici, quelli in cui,

Dettagli

I geni del metabolismo

I geni del metabolismo I geni del metabolismo Lezione 6 1 Premessa I Quello che interessa e individuare i geni che controllano le vie metaboliche. Per arrivare a questo risultato si possono usare diverse strategie (non tecniche:

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

MASTER DI NUTRIZIONE MOLECOLARE. dalla DIETA IPOCALORICA al METODO di ALIMENTAZIONE CONSAPEVOLE. Prof. Dr. Pier Luigi Rossi

MASTER DI NUTRIZIONE MOLECOLARE. dalla DIETA IPOCALORICA al METODO di ALIMENTAZIONE CONSAPEVOLE. Prof. Dr. Pier Luigi Rossi ALICONS SCUOLA DI ALIMENTAZIONE CONSAPEVOLE P R E S E N T A N O MASTER DI NUTRIZIONE MOLECOLARE dalla DIETA IPOCALORICA al METODO di ALIMENTAZIONE CONSAPEVOLE Prof. Dr. Pier Luigi Rossi PROGRAMMA 25 CREDITI

Dettagli

Le allergie alimentari

Le allergie alimentari Le allergie alimentari A cura del Dott. Renato Caviglia, MD, PhD Specialista in Gastroenterologia ed Endoscopia Digestiva Dottore di Ricerca in Scienze Epato-Gastroenterologiche Introduzione L'allergia

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule.

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule. Il patrimonio genetico, base della vita Il patrimonio genetico (genoma) è l insieme di tutte le informazioni necessarie per costruire ogni embrione, attraverso complessi meccanismi di moltiplicazione delle

Dettagli

svolgimento del programma precedente M F totale

svolgimento del programma precedente M F totale PROGRAMMAZIONE ANNO SCOLASTICO 2009-2010 Docente:Cristina Marcon CLASSE 2A Materia: Biologia 1. Nel primo consiglio di classe sono stati definiti gli obiettivi educativo-cognitivi generali che sono stati

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Genomica e modelli animali di malattie umane

Genomica e modelli animali di malattie umane I giovedì della cultura scientifica Etica e sperimentazione animale nella ricerca biomedica Genomica e modelli animali di malattie umane Mariateresa Mancuso BIOTEC-MED Mus Musculus : organismo modello

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

Vademecum - Elenco Esami

Vademecum - Elenco Esami Vademecum - Elenco Esami Virologia Molecolare Citologia e Genetica Microbiologia colturale e molecolare Genetica e Biologia Molecolare Intolleranze alimentari e Nutrigenetica 2015 ELENCO ESAMI VIROLOGIA

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

ELENCO ESAMI DI BIOLOGIA MOLECOLARE VIROLOGIA MOLECOLARE. Ricerca qualitativa mediante PCR. Urine, liquido amniotico, siero, sangue in EDTA

ELENCO ESAMI DI BIOLOGIA MOLECOLARE VIROLOGIA MOLECOLARE. Ricerca qualitativa mediante PCR. Urine, liquido amniotico, siero, sangue in EDTA ELENCO ESAMI DI BIOLOGIA MOLECOLARE VIROLOGIA MOLECOLARE CMV QUALITATIVO Citomegalovirus Urine, liquido amniotico, siero, sangue in EDTA CMV QUANTITATIVO Citomegalovirus Ricerca quantitativa mediante Real-Time

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Stare bene con Genutrix Approfondisci i nostri campi Per Genutrica, si intende il metodo della medicina personalizzata applicata alla Nutrizione, che i professionisti di Genutrix, applicheranno ai pazienti

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

ETTORE MARRE DIGITAL FOR BUSINESS

ETTORE MARRE DIGITAL FOR BUSINESS USO ED ABUSO DEI FARMACI Venerdì 17 aprile 2015 Sala conferenze Digital for Business - Sesto San Giovanni (MI) ETTORE MARRE DIGITAL FOR BUSINESS www.digitalforacademy.com Appropriatezza prescrittiva e

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

LISTINO ESAMI DI BIOLOGIA MOLECOLARE. HCV QUALITATIVO 29,00 PL 5 gg PCR. HCV QUANTITATIVO 39,00 PL 5 gg. HBV QUALITATIVO 29,00 PL 5 gg PCR

LISTINO ESAMI DI BIOLOGIA MOLECOLARE. HCV QUALITATIVO 29,00 PL 5 gg PCR. HCV QUANTITATIVO 39,00 PL 5 gg. HBV QUALITATIVO 29,00 PL 5 gg PCR LISTINO ESAMI DI BIOLOGIA MOLECOLARE VIROLOGIA MOLECOLARE Metoca HCV QUALITATIVO 29,00 PL 5 gg HCV QUANTITATIVO 39,00 PL 5 gg HBV QUALITATIVO 29,00 PL 5 gg HIV QUALITATIVO 29,00 PL 5 gg HIV QUANTITATIVO

Dettagli

ELETTRONICA ED ELETTROTECNICA

ELETTRONICA ED ELETTROTECNICA Istituto di Istruzione Secondaria Superiore Statale «Via Silvestri 301» Programma di BIOLOGIA Classe 2 a A Indirizzo ELETTRONICA ED ELETTROTECNICA n.1 Titolo La cellula La struttura della cellula La teoria

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

CELIACHIA E TEST HLA RACCOMANDAZIONI

CELIACHIA E TEST HLA RACCOMANDAZIONI CELIACHIA E TEST HLA RACCOMANDAZIONI a cura di Maria Cristina Mazzilli 1 Antonio Calabrò 2 Carlo Catassi 2 Luigi Greco 2 Riccardo Troncone 2 Umberto Volta 2 Valerio Misefari 3 Antonio Amoroso 4 Ettore

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Classificazione. I complessi. Le pietre miliari della tassonomia. Tassonomia del genere Mycobacterium. Pietre miliari nella tassonomia dei micobatteri

Classificazione. I complessi. Le pietre miliari della tassonomia. Tassonomia del genere Mycobacterium. Pietre miliari nella tassonomia dei micobatteri Le pietre miliari della tassonomia Tassonomia del genere Mycobacterium Enrico Tortoli Centro Regionale di Riferimento per i Micobatteri Firenze Adamo è autorizzato da Dio a dare un nome a tutti gli esseri

Dettagli

La Genetica. Le leggi di Mendel

La Genetica. Le leggi di Mendel La Genetica Le leggi di Mendel La Genetica Il monaco Gregor Mendel (1822-1884) fu il primo a studiare in modo rigoroso il fenomeno della trasmissione dei caratteri ereditari. Per questo, pur non avendo

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare V Scuola di Ingegneria dell Informazione Laurea Magistrale in Ingegneria Informatica II Scuola di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

Che significa animale transgenico o animale Knockout???

Che significa animale transgenico o animale Knockout??? Che significa animale transgenico o animale Knockout??? ORGANISMI TRANSGENICI Gli animali che sono stati ingegnerizzati per inserzione di un gene, delezione di un gene o sostituzione di un gene si chiamano

Dettagli

Tecnologia Strumentale. Il Sistema di Qualità

Tecnologia Strumentale. Il Sistema di Qualità L evoluzione tecnologica nel settore della diagnostica molecolare impone un continuo aggiornamento delle strumentazioni. Questo è diventato uno dei nostri punti di forza. Tecnologia Strumentale Strumento

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Dott.ssa Stefania Ubaldi, MD, PhD

Dott.ssa Stefania Ubaldi, MD, PhD MEDINVITA fornisce un supporto qualificato a tutte le Strutture Sanitarie (Ospedali, Cliniche e Ambulatori) rendendo disponibili competenze professionali specialistiche all avanguardia nell ambito della

Dettagli

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO Documento redatto da: Dott.ssa T.Venesio, Dr.ssa A. Balsamo - Laboratorio di Patologia

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

LA SIBO: CONDIZIONE TRASVERSALE TRASCURATA?

LA SIBO: CONDIZIONE TRASVERSALE TRASCURATA? LA SIBO: CONDIZIONE TRASVERSALE TRASCURATA? SIBO è l acronimo di Small Intestinal Bacterial Overgrowth, ovvero sovraccrescita batterica dell intestino tenue. La sua caratterizzazione clinica è variata

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed.

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015 CHIMICA Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. Tramontana S. Passannanti C. Sbriziolo Noi e la chimica agli atomi

Dettagli

La genomica nella prospettiva delle cure primarie

La genomica nella prospettiva delle cure primarie La genomica nella prospettiva delle cure primarie Dott. Enrico Ioverno Medico di Medicina Generale SIMG Vicenza Le cure primarie rappresentano il primo livello attraverso il quale gli individui, le famiglie

Dettagli

BIOLOGA e BIOLOGO MOLECOLARE

BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...

Dettagli