INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA"

Transcript

1 INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA LUISA PIERFEDERICI 1

2 NUTRIGENETICA Studio delle variazioni genetiche nell uomo che causano differenti risposte fenotipiche alle molecole introdotte con il cibo. Molecole introdotte con il cibo Interazioni a livello genomico 2

3 I composti introdotti con la dieta possono esercitare a livello del genoma umano effetti indiretti o diretti alterando l espressione genica. Una dieta personalizzata può essere uno strumento idoneo alla prevenzione per le patologie degenerative. Il grado in cui la dieta può influenzare la salute dipende dal corredo genetico di ciascun essere umano

4 4

5 L intolleranza al lattosio o ipolattasia è un esempio di polimorfismo genetico 5

6 Molecola di lattosio. L enzima lattasi-florizina idrolasi(lph)

7 L ipolattasia deriva dalla ridotta attività fisiologica dell enzima LPH prodotto dalle cellule dell intestino tenue. 7

8 Le persone intolleranti al lattosio manifestano i primi sintomi a 2-3 anni Diventano completamente intolleranti a 5-10 anni Essi vengono chiamati lattasi non persistenti. Coloro che invece possiedono l enzima ancora attivo vengono chiamati lattasi persistenti. 8

9 Esiste un test per individuare gli intolleranti al lattosio: Breath Test all idrogeno Somministrando lattosio ad un soggetto intollerante, sarà possibile rinvenire una quota di idrogeno esalato dal respiro superiore rispetto a quella riscontrata precedentemente alla somministrazione. 9

10 Il gene per l enzima lattasi, denominato LCT, è localizzato nel cromosoma 2, è formato da 50 kb e presenta nella sua sequenza 17 esoni. Immagine cromosoma

11 I lattasi persistenti sono coloro che hanno subito una mutazione nel gene regolatore dell enzima lattasi, per cui digeriscono il lattosio anche in età adulta. I lattasi non persistenti sono coloro che non hanno subito una mutazione per cui dallo Mutanti Non svezzamento mutanti in poi hanno una produzione limitata.

12 La mutazione coinvolge un singolo nucleotide situato a 14 Kb prima del punto di inizio della trascrizione della lattasi, precisamente in un introne adiacente al gene MCM6. La mutazione è dovuta ad un polimorfismo nella posizione C/T secondo il database, ed è una sostituzione del nucleotide C T in un punto del gene regolatore di LCT 12

13 Sezione nucleotidica del gene mutante GAGTATCGGTGGATGAAGAAAAAATAGTCTCACATGTCTTCATTTCCATCCTTG GCTCAGTACAGCTCCAGTTCCATTATTCTTAAACATCTATTAACATGATTGCTAAA TAATTACACAGGCTAACTGCCAAGCATTTTTCACAGGAAGCAAGGCACTGCTC TTCTGGCTTATGCAAAAGGGTCACTGTTTTTTTTTTTTTTTTAACTTTATCTTGTT TTGATTGAAGAAACATCTCTAAAAATACCAT [C/T] TGAGTGCAAGATAAAAAGGAAATAGCAATCAAGGCAACAAAGCTAAGCACAT GCAACAATATAGATGATTTGGGGGTGGGACAGTACAGAATTCAGAACTGATAG AAGTTATCAGCTCCATATTTCAGAAAGACCTAATGTCTTCCTTCTGCTTATACTGT TCTGACAGAATTTTAATTTTGGCAGAGATCACTCTCGATGTTATGATGTACTGAT TCAGAGGTCCCAAATCAGTAACCTGATCCTAGAT 13

14 Esistono 3 genotipi nella popolazione europea: Genotipo Incidenza Fenotipo TT ca. 40% nessun segno di PLI (Intolleranza Primaria al Lattosio) TC ca. 45% nessun segno di PLI, portatore CC ca. 15% predisposizione genetica per PLI (Europa) L allele con la base T è dominante rispetto a quello con la base C, quindi solo il genotipo CC manifesterà l intolleranza al Lattosio. 14

15 ORIGINE DELLA MUTAZIONE MOLTO VICINA AI NOSTRI TEMPI Sono stati raccolti dall University College of London e dall Università di Mainz campioni di DNA di scheletri umani del Neolitico risalenti al 5840 e al 5000 a.c. Hanno scoperto che la mutazione nel gene che controlla la nostra capacità di digerire il latte non era presente in nessun campione. La mutazione genetica apparsa di recente in termini di evoluzione è divenuta comune perchè ha attribuito ai soggetti che la possedevano un enorme vantaggio nella sopravvivenza e permettendo tramite la selezione naturale di trasmetterla ai figli. 15

16 DISTRIBUZIONE DELLA MUTAZIONE NELLA POPOLAZIONE MONDIALE La frequenza alla lattasi persistenza varia drasticamente tra le differenti popolazioni: Percentuale Bassa Lattasi frequenza persistenza alta in nelle Svezia molto popolazioni e frequente Danimarca asiatiche. tra al i beduini nord, decrescendo del deserto in africani percentuale e arabici spostandosi a sud 16

17 L alta frequenza dell allele per la lattasi persistenza potrebbe essere il risultato di anni di selezione naturale che hanno favorito le popolazioni del neolitico dedite alla pastorizia.

18 In questa tabella: diffusione della mutazione in Europa 18

19 Tabella che riporta i dati riguardanti la diffusione della mutazione genetica in vari gruppi etnici. 19

20 CONCLUSIONI Da quanto è emerso si evince che la nutrigenomica è in grado di spiegare l insorgenza di patologie correlate all alimentazione. È stato anche interessante notare come ci sia una correlazione tra genetica e cultura: la mutazione che ha dato origine alla tolleranza al lattosio ha favorito certe popolazioni nello sviluppo di un economia nomade pastorale.

21 21

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

I METALLI PESANTI NEL LATTE

I METALLI PESANTI NEL LATTE I METALLI PESANTI NEL LATTE di Serraino Andrea Dipartimento di Sanità Pubblica Veterinaria e Patologia Animale - Facoltà Medicina Veterinaria - Università di Bologna - Alma Mater Studiorum. I metalli sono

Dettagli

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta

Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le leggi di Mendel esposte in modo ragionato e critico di Luciano Porta Le tre leggi di Mendel, che descrivono la trasmissione dei caratteri ereditari da una generazione all altra, segnano l inizio della

Dettagli

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale?

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Questo vecchio slogan pubblicitario riconduce ad una parziale verità scientifica, oggi più che attuale. E risaputo che parlare di zucchero

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Zuccheri. Zuccheri, dolci e bevande. zuccherate: nei giusti limiti

Zuccheri. Zuccheri, dolci e bevande. zuccherate: nei giusti limiti 4. Zuccheri Zuccheri, dolci e bevande zuccherate: nei giusti limiti 4. Zuccheri, dolci e bevande zuccherate: nei giusti limiti 36 1. ZUCCHERI E SAPORE DOLCE Tutti gli zuccheri sono fonti di energia e non

Dettagli

Il fabbisogno alimentare e il ruolo dei nutrienti

Il fabbisogno alimentare e il ruolo dei nutrienti Il fabbisogno alimentare e il ruolo dei nutrienti Le necessità del nostro corpo Cibo e bevande sono i mezzi con cui il nostro organismo si procura le sostanze di cui ha bisogno per le sue attività vitali.

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli DAI GENI AI SEMI genetica e biotecnologie in agricoltura Simona Baima e Giorgio Morelli Copyright 2010 Editori: Simona Baima e Giorgio Morelli Copertina e disegni: Franco Marchiolli [www.francomarchiolli.com]

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Salute intestinale in avicoltura Il mondo interiore

Salute intestinale in avicoltura Il mondo interiore Agosto 2013 Salute intestinale in avicoltura Il mondo interiore Dr. Richard A. Bailey, Poultry Health Scientist Sommario Introduzione Flora Intestinale Mantenere in equilibrio la salute intestinale Conclusioni

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

(es.: AA, aa, BB, bb ) 2 Alleli: si tratta di geni che si trovano su cromosomi omologhi e che controllano lo stesso carattere in modo eguale (alleli

(es.: AA, aa, BB, bb ) 2 Alleli: si tratta di geni che si trovano su cromosomi omologhi e che controllano lo stesso carattere in modo eguale (alleli 1 ELEMENTI DI GENETICA LA GENETICA È: LA DISCIPLINA (= LA SCIENZA) CHE INDAGA SUI MECCANISMI DELLA TRASMISSIONE DEI CARATTERI DA UNA GENERAZIONE ALL ALTRA. RICORDIAMO 2 CONCETTI FONDAMENTALI: A) GENOTIPO:

Dettagli

acqua Bevi ogni giorno in abbondanza

acqua Bevi ogni giorno in abbondanza 5. acqua Bevi ogni giorno in abbondanza 5. Bevi ogni giorno acqua in abbondanza Nell organismo umano l acqua rappresenta un costituente essenziale per il mantenimento della vita, ed è anche quello presente

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Il Biologo Figura dinamica nel mondo del lavoro. Vademecum di orientamento alla professione

Il Biologo Figura dinamica nel mondo del lavoro. Vademecum di orientamento alla professione Il Biologo Figura dinamica nel mondo del lavoro Vademecum di orientamento alla professione A cura della: Commissione Permanente di studio Rapporti con le Università Ordine Nazionale dei Biologi 1 Consiglio

Dettagli

Agricoltura Bio nel mondo: la superficie

Agricoltura Bio nel mondo: la superficie Agricoltura Bio nel mondo: la superficie L agricoltura biologica occupa una superficie di circa 37,04 milioni di ettari nel 2010. Le dimensioni a livello globale sono rimaste pressoché stabili rispetto

Dettagli

Latte & Co. Cucinare senza lattosio. Abitudini alimentari e tendenze. Alimentazione equilibrata. Una guida per più gusto e benessere.

Latte & Co. Cucinare senza lattosio. Abitudini alimentari e tendenze. Alimentazione equilibrata. Una guida per più gusto e benessere. free.salute Alimentazione Benessere Una guida per più gusto e benessere. Latte & Co. Quando il malessere nasce a tavola. Cucinare senza lattosio. Menu leggero di 3 portate. Abitudini alimentari e tendenze.

Dettagli

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp.

Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. RECENSIONI&REPORTS recensione Erwin Schrödinger Che cos è la vita? La cellula vivente dal punto di vista fisico tr. it. a cura di M. Ageno, Adelphi, Milano 2008, pp. 154, 12 «Il vasto e importante e molto

Dettagli

Equazioni non lineari

Equazioni non lineari Dipartimento di Matematica tel. 011 0907503 stefano.berrone@polito.it http://calvino.polito.it/~sberrone Laboratorio di modellazione e progettazione materiali Trovare il valore x R tale che f (x) = 0,

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

Notizie HapMap. la sua prima pietra a miliare

Notizie HapMap. la sua prima pietra a miliare INGLESE u SPAGNOLO u ITALIANO u GIAPPONESE u CINESE u SWAHILI u YORUBA Notizie HapMap Una pubblicazione del Coriell Institute for Medical Research, V olume 2, 2005 Nei soli tre anni dalla sua istituzione,

Dettagli

Cos'é un test genetico predittivo?

Cos'é un test genetico predittivo? 16 Orientamenti bioetici per i test genetici http://www.governo.it/bioetica/testi/191199.html IL GARANTE PER LA PROTEZIONE DEI DATI PERSONALI Autorizzazione al trattamento dei dati genetici - 22 febbraio

Dettagli

Difetti del ciclo dell urea Una guida per i pazienti, i genitori e i familiari

Difetti del ciclo dell urea Una guida per i pazienti, i genitori e i familiari Difetti del ciclo dell urea Una guida per i pazienti, i genitori e i familiari Jane Gick www.e-imd.org Indice Introduzione...3 Il metabolismo...4 Ecco come l organismo utilizza le proteine...4 Quali sono

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

L'IMPORTANZA DELL'ACQUA

L'IMPORTANZA DELL'ACQUA L'IMPORTANZA DELL'ACQUA L'acqua è il principale costituente del nostro corpo. Alla nascita il 90% del nostro peso è composto di acqua: nell'adulto è circa il 75% e nelle persone anziane circa il 50%; quindi

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Ministero dell'istruzione, dell'università e della Ricerca

Ministero dell'istruzione, dell'università e della Ricerca PROVA DI AMMISSIONE AL CORSO DI LAUREA IN MEDICINA VETERINARIA Anno Accademico 2010/2011 Test di Biologia 1. Quale dei seguenti composti NON è di natura lipidica? A) Chitina B) Tripalmitina C) Vitamina

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

Test per portatori sani

Test per portatori sani 16 Test per portatori sani Tutti i nomi originali in questo opuscolo sono stati cambiati per proteggere l'identità degli intervistati. Queste informazioni sono state elaborate dal Genetic Interest Group.

Dettagli

ASU San Giovanni Battista Torino S.C. Cardiologia 2

ASU San Giovanni Battista Torino S.C. Cardiologia 2 ASU San Giovanni Battista Torino S.C. Cardiologia 2 Il processo infermieristico espresso con un linguaggio comune: sviluppo delle competenze professionali attraverso la capacità di formulare diagnosi infermieristiche

Dettagli

Le malattie genetiche

Le malattie genetiche Le malattie genetiche Anderlini Beatrice Classe 3^ - Sez. C Liceo Scientifico R. Casimiri Introduzione alle malattie genetiche Tutti gli esseri viventi sono formati da cellule in ogni cellula è presente

Dettagli

Alimentazione in caso di intolleranza al lattosio. Indice

Alimentazione in caso di intolleranza al lattosio. Indice P. 1 / 11 Alimentazione in caso di intolleranza al lattosio Indice Scheda informativa Alimentazione in caso di intolleranza al lattosio / Febbraio 2013 Parte 1 Basi teoriche 2 Introduzione 2 Che cos è

Dettagli

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS)

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) Pædiatric Rheumatology InterNational Trials Organisation Che cos é? Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) La sindrome di Blau è una malattia genetica. I pazienti affetti presentano rash

Dettagli

UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE. Programmazione didattica a.a. 2014/2015

UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE. Programmazione didattica a.a. 2014/2015 UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE CORSO DI LAUREA IN BIOTECNOLOGIE Classe L2 Programmazione didattica a.a. 2014/2015 Per l anno accademico 2014-2015

Dettagli

REGOLAMENTO SUGLI ACCERTAMENTI DELLA IDONEITÀ/INIDONEITÀ PSICO-FISICA DEL PERSONALE DELLA ASL CAGLIARI

REGOLAMENTO SUGLI ACCERTAMENTI DELLA IDONEITÀ/INIDONEITÀ PSICO-FISICA DEL PERSONALE DELLA ASL CAGLIARI Allegato alla Deliberazione n. 1576 del 19/11/2012 REGOLAMENTO SUGLI ACCERTAMENTI DELLA IDONEITÀ/INIDONEITÀ PSICO-FISICA DEL PERSONALE DELLA ASL CAGLIARI Art. 1 OGGETTO E DESTINATARI Il presente regolamento

Dettagli

MAN- GIAR BENE. Mantenere il corpo in buona

MAN- GIAR BENE. Mantenere il corpo in buona MAN- GIAR BENE vivere sani 3 Mantenere il corpo in buona salute ha la sua base in una corretta alimentazione. Essa si basa sull apporto equilibrato di acqua, carboidrati (zuccheri e amidi), proteine, grassi

Dettagli

RELAZIONE MOSTRA: FOOD, LA SCIENZA DAI SEMI AL PIATTO

RELAZIONE MOSTRA: FOOD, LA SCIENZA DAI SEMI AL PIATTO RELAZIONE MOSTRA: FOOD, LA SCIENZA DAI SEMI AL PIATTO La mostra è allestita nelle sale del Museo di Storia Naturale di Milano dal 28 Novembre 2014 al 28 Giugno 2015. Affronta il complesso tema del cibo

Dettagli

Alimentazione Così si può migliorare l efficienza alimentare

Alimentazione Così si può migliorare l efficienza alimentare Ancora dal convegno di Copenaghen. Questo parametro, nell allevamento delle bovine da latte, può crescere. E non solo perfezionando il razionamento. Ma anche intervenendo su diversi altri fattori, come

Dettagli

Intolleranza al lattosio nella pratica clinica

Intolleranza al lattosio nella pratica clinica Prevenzione e stili di vita Intolleranza al lattosio nella pratica clinica Angelo Franzè 1, Anna Bertelè 2 1 Direttore Dipartimento Medico polispecialistico e Direttore Gasoenterologia ed Endoscopia Digestiva,

Dettagli

LA SALUTE VIEN MANGIANDO

LA SALUTE VIEN MANGIANDO LA SALUTE VIEN MANGIANDO PERCHÉ MANGIAMO? Il nostro organismo per sopravvivere e stare in buona salute, per crescere, per svolgere attività fisica, per riparare le parti del corpo danneggiate e sostituire

Dettagli

Calcolo combinatorio

Calcolo combinatorio Probabilità e Statistica Esercitazioni a.a. 2009/2010 C.d.L.S.: Ingegneria Civile-Architettonico, Ingegneria Civile-Strutturistico Calcolo combinatorio Ines Campa e Marco Longhi Probabilità e Statistica

Dettagli

OMEOSTASI DEL Ca 2+ e FOSFORO

OMEOSTASI DEL Ca 2+ e FOSFORO OMEOSTASI DEL Ca 2+ e FOSFORO Metabolismo del calcio Il calcio è il minerale più rappresentato nell organismo umano (1000-1200 gr) Il 99% del Ca corporeo si trova nello scheletro e nei denti, per lo più

Dettagli

ALLENARSI CON LA FASCIA CARDIO

ALLENARSI CON LA FASCIA CARDIO ALLENARSI CON LA FASCIA CARDIO Come effettuare il monitoraggio dei nostri allenamenti? Spesso è difficile misurare il livello di sforzo di una particolare gara o sessione di allenamento. Come vi sentite?

Dettagli

Versione A Libretto Test

Versione A Libretto Test LINGUAGGIO MATEMATICO DI BASE 2 Linguaggio Matematico di Base LINGUAGGIO MATEMATICO DI BASE 1. La media aritmetica di due numeri s e t è 2 3. Allora t è uguale a A. B. C. D. E. 4 2s 3 3 2s 2 4 3s 2 4 3s

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott.

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott. C. I. D. I. M. U. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI Resp. Dott. Antonio Vercelli OSTEOPOROSI *Come prevenirla* *Come curarla* *Consigli pratici* *Cos è l osteoporosi?* L osteoporosi

Dettagli

CONVEGNO FAI L UNIVERSO APE IN PERICOLO. Resoconto preliminare

CONVEGNO FAI L UNIVERSO APE IN PERICOLO. Resoconto preliminare CONVEGNO FAI L UNIVERSO APE IN PERICOLO ---------------------------- Resoconto preliminare L importanza di una rete di monitoraggio Al fine di avere idee precise sulla natura e sull entità degli spopolamenti

Dettagli

ANEURISMA AORTA TORACICA ASCENDENTE

ANEURISMA AORTA TORACICA ASCENDENTE ANEURISMA AORTA TORACICA ASCENDENTE Definizione Dilatazione segmentaria o diffusa dell aorta toracica ascendente, avente un diametro eccedente di almeno il 50% rispetto a quello normale. Cause L esatta

Dettagli

Cosa sono le vitamine?

Cosa sono le vitamine? Cosa sono le vitamine? Le vitamine sono sostanze di natura organica indispensabili per la vita e per l accrescimento. Queste molecole non forniscono energia all organismo umano ma sono indispensabili in

Dettagli

LE SCALE M U S I C A PER LA TUA SALUTE CALORIE AUTOSTIMA LONGEVITÀ EFFICIENZA. Aumenti la tua salute, se sali le scale. Perdi peso, se sali le scale

LE SCALE M U S I C A PER LA TUA SALUTE CALORIE AUTOSTIMA LONGEVITÀ EFFICIENZA. Aumenti la tua salute, se sali le scale. Perdi peso, se sali le scale SALUTE Aumenti la tua salute, CALORIE Perdi peso, AUTOSTIMA Accresci la tua autostima, LONGEVITÀ Allunghi la tua vita, EFFICIENZA Potenzi i tuoi muscoli e migliori il tuo equilibrio, LE SCALE M U S I C

Dettagli

PREVENZIONE E SALUTE GLOBALE

PREVENZIONE E SALUTE GLOBALE PREVENZIONE E SALUTE GLOBALE SI PARTE DALLA VITAMINA D Relatore dr Donata Soppelsa Medico di medicina generale Associato alla Società Italiana di Nutriceutica Quali domande? E sufficiente l integrazione

Dettagli

www.zampadicane.it Guida alle Vaccinazioni

www.zampadicane.it Guida alle Vaccinazioni VACCINAZIONI Le vaccinazioni da fare al proprio cane sono parecchie, alcune sono obbligatorie ed alcune facoltative e possono essere consigliate dal veterinario in casi specifici. Vediamo nel dettaglio

Dettagli

L agricoltura nell Europa industrializzata

L agricoltura nell Europa industrializzata L agricoltura nell Europa industrializzata L agricoltura delle società industrializzate europee si differenzia da quella dell età moderna per gli attrezzi, le fonti di energia, i macchinari utilizzati

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

U.O.C. CHIRURGIA VASCOLARE

U.O.C. CHIRURGIA VASCOLARE REGIONE LAZIO Direttore Generale Dott. Vittorio Bonavita U.O.C. CHIRURGIA VASCOLARE Ospedale Sandro Pertini Direttore: Prof. Vincenzo Di Cintio Gentile paziente, Le diamo il benvenuto nella nostra Struttura

Dettagli

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier RICERCA APPLICATA / Stress ossidativo, invecchiamento e malattie degenerative Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier A cura del Dipartimento Scientifico

Dettagli

DIPARTIMENTO TUTELA DELLA SALUTE E POLITICHE SANITARIE Allegato 8.6 8.6. Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica

DIPARTIMENTO TUTELA DELLA SALUTE E POLITICHE SANITARIE Allegato 8.6 8.6. Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica 8.6 Requisiti Specifici per l accreditamento delle Strutture di Genetica Medica 1 Premessa Qualità e sostenibilità economica sono le principali esigenze cui cerca di rispondere la concentrazione delle

Dettagli

DIETE E PIANI ALIMENTARI: ELABORAZIONE E GESTIONE Roma, 19-22 novembre 2015

DIETE E PIANI ALIMENTARI: ELABORAZIONE E GESTIONE Roma, 19-22 novembre 2015 BRAIN HEALTH CENTRE CENTRO STUDI E RICERCHE CLINICHE NEUROPSICOFISIOLOGICHE Anagrafe Nazionale delle Ricerche (D.P.R. 11/7/1980 n.382-artt.63 e 64) n.55643fru Organizzatore di Attività Formativa Sede legale:

Dettagli

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre?

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre? Test di logica e cultura generale 1. Tre amici Carlo, Piero e Nicola acquistano della frutta al mercato. Ognuno di loro sceglie un diverso tipo di frutta e spende una somma differente. Sapendo che: - Carlo

Dettagli

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA Che cos è la degenerazione maculare? La degenerazione maculare è una malattia che interessa la regione centrale della retina (macula), deputata alla visione distinta necessaria per la lettura, la guida

Dettagli

BORTEZOMIB (Velcade)

BORTEZOMIB (Velcade) BORTEZOMIB (Velcade) POTENZIALI EFFETTI COLLATERALI Le informazioni contenute in questo modello sono fornite in collaborazione con la Associazione Italiana Malati di Cancro, parenti ed amici ; per maggiori

Dettagli

Acidi nucleici non codificanti

Acidi nucleici non codificanti Vol. Giacca 4bozza 17-02-2011 11:05 Pagina 19 Acidi nucleici non codificanti 19 maniera controllata in modo da non favorire la crescita di eventuali tumori presenti in sedi lontane da quella in cui sono

Dettagli

LA DECOLONIZZAZIONE. Nel 1947 l India diventa indipendente

LA DECOLONIZZAZIONE. Nel 1947 l India diventa indipendente LA DECOLONIZZAZIONE Nel 1939 quasi 4.000.000 km quadrati di terre e 710 milioni di persone (meno di un terzo del totale) erano sottoposti al dominio coloniale di una potenza europea. Nel 1941, in piena

Dettagli

Dipartimento Medicina Interna e Specialità Mediche Reumatologia Dott. Carlo Salvarani - Direttore ARTRITI DA

Dipartimento Medicina Interna e Specialità Mediche Reumatologia Dott. Carlo Salvarani - Direttore ARTRITI DA Dipartimento Medicina Interna e Specialità Mediche Reumatologia Dott. Carlo Salvarani - Direttore LA GOTTA ED ALTRE ARTRITI DA CRISTALLI REGGIO EMILIA,, APRILE 2007 La Gotta ed altre Artriti da Cristalli

Dettagli

VAD O VED POTENZIALI EFFETTI COLLATERALI

VAD O VED POTENZIALI EFFETTI COLLATERALI VAD O VED POTENZIALI EFFETTI COLLATERALI 1 Questo schema di cura impiega i seguenti farmaci: vincristina, doxorubicina (adriamicina) o epidoxorubicina, cortisone. Le informazioni contenute in questo modello

Dettagli

4. Confronto tra medie di tre o più campioni indipendenti

4. Confronto tra medie di tre o più campioni indipendenti BIOSTATISTICA 4. Confronto tra medie di tre o più campioni indipendenti Marta Blangiardo, Imperial College, London Department of Epidemiology and Public Health m.blangiardo@imperial.ac.uk MARTA BLANGIARDO

Dettagli

U N I V E R S I T À D E G L I S T U D I D I T O R I N O

U N I V E R S I T À D E G L I S T U D I D I T O R I N O U N I V E R S I T À D E G L I S T U D I D I T O R I N O Il Centro della Innovazione Nato inizialmente per ospitare alcune attività didattiche dell Università di Torino, il complesso polifunzionale di Via

Dettagli

RESPONS.In.City - Methodology

RESPONS.In.City - Methodology RESPONS.In.City - Methodology THE METHODOLOGY OF A RESPONSIBLE CITIZENSHIP PROMOTION Metodologia di Promozione della Cittadinanza come Responsabilità Condivisa 1 Premessa La possibilità di partecipare

Dettagli

IL BENESSERE VIEN M ANGIANDO L ALIMENTA ZIONE NELL A PRIM A INFANZIA

IL BENESSERE VIEN M ANGIANDO L ALIMENTA ZIONE NELL A PRIM A INFANZIA IL BENESSERE VIEN M ANGIANDO L ALIMENTA ZIONE NELL A PRIM A INFANZIA ALIMENTAZIONE ANTICANCRO L alimentazione è un bisogno essenziale dell uomo: per funzionare, un individuo deve introdurre una certa quantità

Dettagli

Terra e Cibo: alcune riflessioni su un volume del Consiglio Pontificio Giustizia e Pace.

Terra e Cibo: alcune riflessioni su un volume del Consiglio Pontificio Giustizia e Pace. Terra e Cibo: alcune riflessioni su un volume del Consiglio Pontificio Giustizia e Pace. 1. È stato pubblicato, di recente, dal Pontificio Consiglio della Giustizia e della Pace un volume, che reca il

Dettagli

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua.

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua. La DIGESTIONE Perché è necessario nutrirsi? Il corpo umano consuma energia per muoversi, pensare, mantenere la temperatura costante, ma anche solo per riposarsi. Il consumo minimo di energia è detto metabolismo

Dettagli

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza Simona Giampaoli, Anna Rita Ciccaglione Istituto Superiore di Sanità Prevalenza e carico dell infezione cronica da virus dell epatite

Dettagli

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico Monossido d azoto NO (Nitric Oxide) Ruolo biologico: Messaggero del segnale cellulare Molecola regolatoria nel sistema cardiovascolare Molecola regolatoria nel sistema nervoso centrale e periferico Componente

Dettagli

DIFETTI VISIVI NEI BAMBINI AFFETTI DALLA SINDROME DOWN

DIFETTI VISIVI NEI BAMBINI AFFETTI DALLA SINDROME DOWN DIFETTI VISIVI NEI BAMBINI AFFETTI DALLA SINDROME DOWN DADDY FADEL OPTOMETRISTA Nel 1866 John Langdon Down ha descritto per la prima volta la sindrome che porta il suo nome. Nel 1959 Lejeune et al. hanno

Dettagli

Estratto distribuito da Marsilio

Estratto distribuito da Marsilio Migliaia di persone l hanno già fatto. Con pochi click e qualche goccia di saliva, chiunque può acquistare online una scansione del proprio dna e ricavarne un profilo genetico personalizzato. È l alba

Dettagli

Altre informazioni sul virus HPV: informazioni approfondite per le utenti

Altre informazioni sul virus HPV: informazioni approfondite per le utenti Altre informazioni sul virus HPV: informazioni approfondite per le utenti Questo è un documento di approfondimento sull HPV. Prima di leggerlo consultate il documento Alcune informazioni sul virus HPV

Dettagli

Oggetto: reciproche interazioni tra organismo e ambiente. Metodo: scientifico-sperimentale

Oggetto: reciproche interazioni tra organismo e ambiente. Metodo: scientifico-sperimentale Università degli Studi di Parma Facoltà di Psicologia Dipartimento di Psicologia Analisi del Comportamento (Behavior Analysis) Skinner (1904-1990) Approccio Comportamentale alla Psicologia dell Educazione

Dettagli

1 LEZIONE CHE COS E L ALLENAMENTO

1 LEZIONE CHE COS E L ALLENAMENTO 1 LEZIONE CHE COS E L ALLENAMENTO Sono molte le definizioni di allenamento: Definizione generale: E un processo che produce nell organismo un cambiamento di stato che può essere fisico, motorio, psicologico.

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Dall inizio alla fine, un binomio inscindibile: Calcio piu vit. A e D

Dall inizio alla fine, un binomio inscindibile: Calcio piu vit. A e D Dall inizio alla fine, un binomio inscindibile: Calcio piu vit. A e D IL CALCIO La definizione classica per questo elemento e quella di essere un Metallo Alcalino Terroso. Non si trova libero in Natura,

Dettagli

Scuola dell Infanzia Progettazione a.s. 2014/15

Scuola dell Infanzia Progettazione a.s. 2014/15 Istituto «San Giuseppe» Scuole Primaria e dell Infanzia Paritarie 71121 Foggia, via C. Marchesi, 48-tel. 0881/743467 fax 744842 pec: istitutosangiuseppefg@pec.it e-mail:g.vignozzi@virgilio.it sito web:

Dettagli

5. Utilizzo e applicazioni attuali della genomica in Italia

5. Utilizzo e applicazioni attuali della genomica in Italia 5. Utilizzo e applicazioni attuali della genomica in Italia Attualmente in Italia la genomica per malattie complesse ha trovato un applicazione pratica in un numero molto ristretto di situazioni. I test

Dettagli

SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE

SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE SINOSSI PROTOCOLLO STUDIO OSSERVAZIONALE Studio prospettico, non interventistico, di coorte, sul rischio di tromboembolismo venoso (TEV) in pazienti sottoposti a un nuovo trattamento chemioterapico per

Dettagli