INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA"

Transcript

1 INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA LUISA PIERFEDERICI 1

2 NUTRIGENETICA Studio delle variazioni genetiche nell uomo che causano differenti risposte fenotipiche alle molecole introdotte con il cibo. Molecole introdotte con il cibo Interazioni a livello genomico 2

3 I composti introdotti con la dieta possono esercitare a livello del genoma umano effetti indiretti o diretti alterando l espressione genica. Una dieta personalizzata può essere uno strumento idoneo alla prevenzione per le patologie degenerative. Il grado in cui la dieta può influenzare la salute dipende dal corredo genetico di ciascun essere umano

4 4

5 L intolleranza al lattosio o ipolattasia è un esempio di polimorfismo genetico 5

6 Molecola di lattosio. L enzima lattasi-florizina idrolasi(lph)

7 L ipolattasia deriva dalla ridotta attività fisiologica dell enzima LPH prodotto dalle cellule dell intestino tenue. 7

8 Le persone intolleranti al lattosio manifestano i primi sintomi a 2-3 anni Diventano completamente intolleranti a 5-10 anni Essi vengono chiamati lattasi non persistenti. Coloro che invece possiedono l enzima ancora attivo vengono chiamati lattasi persistenti. 8

9 Esiste un test per individuare gli intolleranti al lattosio: Breath Test all idrogeno Somministrando lattosio ad un soggetto intollerante, sarà possibile rinvenire una quota di idrogeno esalato dal respiro superiore rispetto a quella riscontrata precedentemente alla somministrazione. 9

10 Il gene per l enzima lattasi, denominato LCT, è localizzato nel cromosoma 2, è formato da 50 kb e presenta nella sua sequenza 17 esoni. Immagine cromosoma

11 I lattasi persistenti sono coloro che hanno subito una mutazione nel gene regolatore dell enzima lattasi, per cui digeriscono il lattosio anche in età adulta. I lattasi non persistenti sono coloro che non hanno subito una mutazione per cui dallo Mutanti Non svezzamento mutanti in poi hanno una produzione limitata.

12 La mutazione coinvolge un singolo nucleotide situato a 14 Kb prima del punto di inizio della trascrizione della lattasi, precisamente in un introne adiacente al gene MCM6. La mutazione è dovuta ad un polimorfismo nella posizione C/T secondo il database, ed è una sostituzione del nucleotide C T in un punto del gene regolatore di LCT 12

13 Sezione nucleotidica del gene mutante GAGTATCGGTGGATGAAGAAAAAATAGTCTCACATGTCTTCATTTCCATCCTTG GCTCAGTACAGCTCCAGTTCCATTATTCTTAAACATCTATTAACATGATTGCTAAA TAATTACACAGGCTAACTGCCAAGCATTTTTCACAGGAAGCAAGGCACTGCTC TTCTGGCTTATGCAAAAGGGTCACTGTTTTTTTTTTTTTTTTAACTTTATCTTGTT TTGATTGAAGAAACATCTCTAAAAATACCAT [C/T] TGAGTGCAAGATAAAAAGGAAATAGCAATCAAGGCAACAAAGCTAAGCACAT GCAACAATATAGATGATTTGGGGGTGGGACAGTACAGAATTCAGAACTGATAG AAGTTATCAGCTCCATATTTCAGAAAGACCTAATGTCTTCCTTCTGCTTATACTGT TCTGACAGAATTTTAATTTTGGCAGAGATCACTCTCGATGTTATGATGTACTGAT TCAGAGGTCCCAAATCAGTAACCTGATCCTAGAT 13

14 Esistono 3 genotipi nella popolazione europea: Genotipo Incidenza Fenotipo TT ca. 40% nessun segno di PLI (Intolleranza Primaria al Lattosio) TC ca. 45% nessun segno di PLI, portatore CC ca. 15% predisposizione genetica per PLI (Europa) L allele con la base T è dominante rispetto a quello con la base C, quindi solo il genotipo CC manifesterà l intolleranza al Lattosio. 14

15 ORIGINE DELLA MUTAZIONE MOLTO VICINA AI NOSTRI TEMPI Sono stati raccolti dall University College of London e dall Università di Mainz campioni di DNA di scheletri umani del Neolitico risalenti al 5840 e al 5000 a.c. Hanno scoperto che la mutazione nel gene che controlla la nostra capacità di digerire il latte non era presente in nessun campione. La mutazione genetica apparsa di recente in termini di evoluzione è divenuta comune perchè ha attribuito ai soggetti che la possedevano un enorme vantaggio nella sopravvivenza e permettendo tramite la selezione naturale di trasmetterla ai figli. 15

16 DISTRIBUZIONE DELLA MUTAZIONE NELLA POPOLAZIONE MONDIALE La frequenza alla lattasi persistenza varia drasticamente tra le differenti popolazioni: Percentuale Bassa Lattasi frequenza persistenza alta in nelle Svezia molto popolazioni e frequente Danimarca asiatiche. tra al i beduini nord, decrescendo del deserto in africani percentuale e arabici spostandosi a sud 16

17 L alta frequenza dell allele per la lattasi persistenza potrebbe essere il risultato di anni di selezione naturale che hanno favorito le popolazioni del neolitico dedite alla pastorizia.

18 In questa tabella: diffusione della mutazione in Europa 18

19 Tabella che riporta i dati riguardanti la diffusione della mutazione genetica in vari gruppi etnici. 19

20 CONCLUSIONI Da quanto è emerso si evince che la nutrigenomica è in grado di spiegare l insorgenza di patologie correlate all alimentazione. È stato anche interessante notare come ci sia una correlazione tra genetica e cultura: la mutazione che ha dato origine alla tolleranza al lattosio ha favorito certe popolazioni nello sviluppo di un economia nomade pastorale.

21 21

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

PROJECT SRL DISTRIBUZIONE DI DISPOSITIVI MEDICI E TEST RAPIDI IN VITRO

PROJECT SRL DISTRIBUZIONE DI DISPOSITIVI MEDICI E TEST RAPIDI IN VITRO FAQ lattosio PAZIENTE 1) Quali sono i sintomi dell'intolleranza al lattosio? Generalmente i sintomi sono di tipo intestinale e compaiono da pochi minuti a 1 2 ore dopo l'ingestione di cibi contenenti lattosio.

Dettagli

PROJECT SRL DISTRIBUZIONE DI DISPOSITIVI MEDICI E TEST RAPIDI IN VITRO

PROJECT SRL DISTRIBUZIONE DI DISPOSITIVI MEDICI E TEST RAPIDI IN VITRO FAQ lattosio SPECIALISTA 1) In cosa consiste il Breath Test? Il Breath Test all'idrogeno consiste nella misurazione dei livelli di idrogeno nel respiro del paziente. Questo idrogeno deriva dalla fermentazione

Dettagli

INTOLLERANZA AL LATTOSIO

INTOLLERANZA AL LATTOSIO per Giovanna INTOLLERANZA AL LATTOSIO LATTASI Il gene per la lattasi codifica per un enzima collocato a livello dei microvilli dell intestino tenue e deputato all idrolisi del lattosio in monosaccaridi

Dettagli

Latte e intolleranza al lattosio. Maria Eleonora Graziano, Andrea Iorio

Latte e intolleranza al lattosio. Maria Eleonora Graziano, Andrea Iorio Latte e intolleranza al lattosio Maria Eleonora Graziano, Andrea Iorio Il latte La caratteristica cui i mammiferi devono il proprio nome è la capacità di nutrire i piccoli con una secrezione prodotta dalle

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Test genetici per evidenziare il rischio di trombolfilia Il Fattore V della coagulazione è un cofattore essenziale per l attivazione della protrombina a trombina. La variante G1691A, definita variante

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

GENOTEST NUTRIZIONE ATTIVITÀ FISICA METABOLISMO CIBI CONSIGLIATI. Risultato del Test del DNA

GENOTEST NUTRIZIONE ATTIVITÀ FISICA METABOLISMO CIBI CONSIGLIATI. Risultato del Test del DNA GENOTEST Risultato del Test del DNA Otterrai una risposta personalizzata per migliorare gli stili di vita in merito a NUTRIZIONE ATTIVITÀ FISICA METABOLISMO CIBI CONSIGLIATI in base alle informazioni genetiche

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

"Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple VIII Incontro-Convegno A.C.A.R 2006-2016: DIECI ANNI DI A.C.A.R. Montecatini Terme (PT), 16 Aprile 2016 A.C.A.R "Ma.Tr.OC: un progetto europeo per studiare la progressione di malignità delle esostosi multiple"

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

NUTRIGENOMICA. 12 http://www.festivaldellacreativita.it/ LA NUTRIGENOMICA STUDIA L INTERAZIONE L NUTRIENTI COL GENOMA UMANO

NUTRIGENOMICA. 12 http://www.festivaldellacreativita.it/ LA NUTRIGENOMICA STUDIA L INTERAZIONE L NUTRIENTI COL GENOMA UMANO NUTRIGENOMICA Firenze - Festival Creativita sabato 17/Ott./2009 Ore 10-12 12 http://www.festivaldellacreativita.it/ LA NUTRIGENOMICA STUDIA L INTERAZIONE L DEI NUTRIENTI COL GENOMA UMANO Dal Progetto Genoma

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Legami chimici. Covalente. Legami deboli

Legami chimici. Covalente. Legami deboli Legami chimici Covalente Legami deboli Legame fosfodiesterico Legami deboli Legami idrogeno Interazioni idrofobiche Attrazioni di Van der Waals Legami ionici Studio delle macromolecole Lipidi

Dettagli

CENTRO BREATH TEST 13C-LATTOSIO BREATH TEST

CENTRO BREATH TEST 13C-LATTOSIO BREATH TEST ARS MEDICA Centro Medico Polispecialistico VIA M. ANGELONI, 80/A - PERUGIA 06124 TEL/FAX: 075 5000388 CELL: 334 2424824 E-Mail: info@arsmedicapg.it Sito Web: www.arsmedicapg.it CENTRO DI ALTA SPECIALIZZAZIONE

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

GENOTEST NUTRIZIONE ATTIVITÀ FISICA METABOLISMO CIBI CONSIGLIATI. Risultato del Test del DNA

GENOTEST NUTRIZIONE ATTIVITÀ FISICA METABOLISMO CIBI CONSIGLIATI. Risultato del Test del DNA GENOTEST Risultato del Test del DNA Otterrai una risposta personalizzata per migliorare gli stili di vita in merito a NUTRIZIONE ATTIVITÀ FISICA METABOLISMO CIBI CONSIGLIATI in base alle informazioni genetiche

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Fisiologia dell emostasi

Fisiologia dell emostasi 1 STRATEGIE DIAGNOSTICHE PER L EMOFILIA A DEL CANE Marco Caldin DVM, PhD, ECVCP Diplomate 2 Fisiologia dell emostasi 1 3 Fisiologia dell emostasi 4 Attivazione emostatica 2 5 Emostasi primaria 6 Emostasi

Dettagli

Allergia da alimenti. Cause. Manifestazioni cliniche

Allergia da alimenti. Cause. Manifestazioni cliniche Allergia da alimenti Il problema delle reazioni avverse agli alimenti era noto fin dai tempi degli antichi greci e particolari manifestazioni erano già state associate all ingestione di cibi. Tutti gli

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

Mario Rossi 25/04/2019. www.trapiantocapelli.info

Mario Rossi 25/04/2019. www.trapiantocapelli.info Mario Rossi 25/04/2019 www.trapiantocapelli.info L alopecia androgenetica è la principale causa di calvizie che colpisce circa l 70% degli uomini e il 35% delle donne giovani (percentuale che sale al 50%

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2 fenotipo Dominante o recessivo? Scala fenotipica fenotipo A 1 A 1 A 2 A 2 fenotipo A 1 A 2 A 1 dominante A 1 e A 2. codominanti A 2 dominante A 1 dominanza incompleta A 2 dominanza incompleta Nei casi

Dettagli

LABORATORIO DI CITOGENETICA GENETICA MOLECOLARE DIAGNOSI PRENATALE E POST-NATALE. Vademecum Esami

LABORATORIO DI CITOGENETICA GENETICA MOLECOLARE DIAGNOSI PRENATALE E POST-NATALE. Vademecum Esami LABORATORIO DI CITOGENETICA GENETICA MOLECOLARE DIAGNOSI PRENATALE E POST-NATALE Vademecum Esami ANALISI TECNICA CAMPIONE CITOGENETICA PRENATALE E POSTNATALE Cariotipo su Liquido Amniotico (con dosaggio

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

MyGenomics. Obiettivo di questo documento è illustrare il funzionamento e i benefici della analisi genomica

MyGenomics. Obiettivo di questo documento è illustrare il funzionamento e i benefici della analisi genomica Obiettivo di questo documento è illustrare il funzionamento e i benefici della analisi genomica Analisi genomica My Genomics Analisi genomica: scopo conoscere le proprie caratteristiche genetiche sapere

Dettagli

4 modulo didattico - Modalità di trasmissione delle malattie

4 modulo didattico - Modalità di trasmissione delle malattie 4 modulo didattico - Modalità di trasmissione delle malattie monogeniche. L analisi dell albero genealogico: uno strumento indispensabile della genetica medica I SIMBOLI DELL ALBERO GENEALOGICO L ANEMIA

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

TEST GENOMICO: Anticipare il futuro partendo dal presente.

TEST GENOMICO: Anticipare il futuro partendo dal presente. TEST GENOMICO: Anticipare il futuro partendo dal presente. Il passaggio dalla Medicina della Malattia alla Medicina Preventiva e Predittiva si configura come una sorta di rivoluzione copernicana della

Dettagli

20 febbraio 2012. Muore Renato Dulbecco

20 febbraio 2012. Muore Renato Dulbecco 20 febbraio 2012 Muore Renato Dulbecco la possibilità di avere una visione completa e globale del nostro DNA ci aiuterà a comprendere le influenze genetiche e non genetiche sul nostro sviluppo, la nostra

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

QUICK TEST INTOLLERANZA AL LATTOSIO. Francesca Gombac Product Specialist and Researcher GASTROENTEROLOGY DIAGNOSTIC EUROCLONE S.p.A.

QUICK TEST INTOLLERANZA AL LATTOSIO. Francesca Gombac Product Specialist and Researcher GASTROENTEROLOGY DIAGNOSTIC EUROCLONE S.p.A. QUICK TEST INTOLLERANZA AL LATTOSIO Francesca Gombac Product Specialist and Researcher GASTROENTEROLOGY DIAGNOSTIC EUROCLONE S.p.A. Intolleranza al lattosio L'intolleranza al lattosio è l'incapacità di

Dettagli

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865

Tappe della GENETICA UMANA. G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Tappe della GENETICA UMANA G. Mendel leggi dell ereditarietà 1865 Watson & Crick DNA 1953 Tappe della GENETICA UMANA G. Mendel leggi dell

Dettagli

TEST GENETICI PER IL DIABETE E LE SUE COMPLICANZE

TEST GENETICI PER IL DIABETE E LE SUE COMPLICANZE Discover yourself TEST GENETICI PER IL DIABETE E LE SUE COMPLICANZE www.diabs.it A chi sono rivolti i nostri test A persone senza il diabete L insieme di suscettibilità genetica e abitudini di vita scorrette

Dettagli

Esistono tre forme di diabete

Esistono tre forme di diabete Il Diabete mellito L insulina regola la captazione del glucosio Incapacità delle cellule di captare il glucosio in circolo iperglicemia e glucosuria Disponendo di meno glucosio le cellule degradano i grassi

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

NUTRI-GENOKIT FUNZIONE GENE POLIMORFISMO RISULTATO EFFETTO. BsmI. TaqIB. FokI. ApaI C677T A1298C. BsmI. TaqI. ApaI. rs9939609.

NUTRI-GENOKIT FUNZIONE GENE POLIMORFISMO RISULTATO EFFETTO. BsmI. TaqIB. FokI. ApaI C677T A1298C. BsmI. TaqI. ApaI. rs9939609. REPORT TECNICO: RISULTATI DELL ANALISI Nella tabella vengono indicati tutti i parametri ed i geni che vengono studiati facendo il test NUTRI-GENOKIT : una guida completa verso l alimentazione personalizzata.

Dettagli

LE EPATITI B e C. Verso una terapia personalizzata

LE EPATITI B e C. Verso una terapia personalizzata LE EPATITI B e C Verso una terapia personalizzata 3 L EPATITE B LE EPATITI B e C Le epatiti B e C rappresentano un campo molto complesso della Clinica Medica. La Medicina di Laboratorio propone nuove analisi

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

GENETICA ed EREDITARIETÀ

GENETICA ed EREDITARIETÀ GENETICA ed EREDITARIETÀ 1. Introduzione L Epidermolisi Bollosa (EB) è una malattia di carattere genetico, la cui causa è pertanto da ricercare nei caratteri ereditari di un individuo. I processi che avvengono

Dettagli

Mission. Il carattere innovativo che distingue l azienda si affianca a una sempre crescente attenzione per il settore Ricerca & Sviluppo.

Mission. Il carattere innovativo che distingue l azienda si affianca a una sempre crescente attenzione per il settore Ricerca & Sviluppo. 2 Mission Il carattere innovativo che distingue l azienda si affianca a una sempre crescente attenzione per il settore Ricerca & Sviluppo. Gemes srl è un azienda giovane, dinamica ed efficiente, capace

Dettagli

I MICRORGANISMI E GLI ALIMENTI

I MICRORGANISMI E GLI ALIMENTI Le applicazioni attuali delle biotecnologie NON OGM nel settore alimentare diego.mora@unimi.it www.distam.unimi.it I MICRORGANISMI E GLI ALIMENTI Quanti microrganismi ingeriamo con gli alimenti? Si ingeriscono

Dettagli

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel il sesso di un individuo

Dettagli

Master in Sicurezza e Qualità dell Alimentazione in Età Evolutiva

Master in Sicurezza e Qualità dell Alimentazione in Età Evolutiva Master in Sicurezza e Qualità dell Alimentazione in Età Evolutiva Valutazione dell'intake di calcio e ultrasonografia ossea quantitativa in una popolazione intollerante al lattosio geneticamente determinata.

Dettagli

CAPITOLO 2 I TRATTI COMPLESSI

CAPITOLO 2 I TRATTI COMPLESSI CAPITOLO 2 I TRATTI COMPLESSI Tratti semplici e tratti complessi Come detto nel capitolo precedente, la genetica classica studia fondamentalmente i cosiddetti tratti mendeliani semplici, quelli in cui,

Dettagli

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI?

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? CARATTERE AUTOSOMICO -codificato da geni su cromosomi non sessuali -non ci sono differenze di trasmissione

Dettagli

Il tumore al colon è temuto ma è necessario continuare nell'attività di Prevenzione

Il tumore al colon è temuto ma è necessario continuare nell'attività di Prevenzione Il tumore al colon è temuto ma è necessario continuare nell'attività di Prevenzione Milano - Nonostante la sua aggressività è definito il tumore silenzioso. Data la sua scarsa pubblicizzazione, infatti,

Dettagli

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT1 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 GREGOR MENDEL 1822-1884 2 2 Grandi navigatori 3 3 Rotte commerciali per le

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Unità Operativa di GENETICA MEDICA

Unità Operativa di GENETICA MEDICA Unità Operativa di GENETICA MEDICA Direttore: Prof. Mario Savi LABORATORIO DI GENETICA MOLECOLARE Responsabile Prof. Tauro Neri. Servizi forniti: Definizione genotipica e diagnosi molecolare POSTNATALE

Dettagli

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi

II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Seconda Università di Napoli II Anno II Semestre A.A. 2012/2013 Sbobinatura Patologia Generale Prof. Banfi Gruppo di studio La Sbobba A cura di dodo e Ely24e 1) Introduzione alla Genetica Medica Pag. 2

Dettagli

Psicologia generale. Dr. Alessandra Galmonte. e-mail: alessandra.galmonte@univr.it

Psicologia generale. Dr. Alessandra Galmonte. e-mail: alessandra.galmonte@univr.it Psicologia generale Dr. Alessandra Galmonte e-mail: alessandra.galmonte@univr.it 1 3 Evoluzione, Ereditabilità e Comportamento Evoluzione E costituita dai processi che hanno trasformato la vita sulla terra

Dettagli

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica - Facoltà di Medicina e Chirurgia PUGD - Università degli Studi di Udine

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Che cos è la celiachia?

Che cos è la celiachia? Che cos è la celiachia? La celiachia è una malattia infiammatoria cronica dell intestino tenue, dovuta ad una intolleranza al glutine assunto attraverso la dieta. Il glutine è una proteina contenuta in

Dettagli

Riccardo Troncone Dipartimento di Pediatria Università Federico II, Napoli. I carboidrati nell alimentazione del bambino

Riccardo Troncone Dipartimento di Pediatria Università Federico II, Napoli. I carboidrati nell alimentazione del bambino Riccardo Troncone Dipartimento di Pediatria Università Federico II, Napoli I carboidrati nell alimentazione del bambino I carboidrati nell alimentazione del bambino Chimica I carboidrati nella dieta Indice

Dettagli

CLASSE I classico A e B

CLASSE I classico A e B LICEO SCIENTIFICO "A. APROSIO" VENTIMIGLIA CLASSE I classico A e B Anno scolastico 2011-2012 UNITA' DIDATTICA N 1 METODI ED ORGANIZZAZIONE DEI CONCETTI IN BIOLOGIA 1.1 LE CARATTERISTICHE COMUNI A TUTTI

Dettagli

La biodiversità alla luce della rivoluzione genomica Licia Colli

La biodiversità alla luce della rivoluzione genomica Licia Colli La biodiversità alla luce della rivoluzione genomica Licia Colli Istituto di Zootecnica, Centro di ricerca sulla Biodiversità e sul DNA antico BioDNA Facoltà di Scienze Agrarie, Alimentari e Ambientali

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Estensioni e variazioni dell eredit. ereditàmendeliana

Estensioni e variazioni dell eredit. ereditàmendeliana Estensioni e variazioni dell eredit ereditàmendeliana I principi dell ereditariet ereditarietà enunciati da Mendel non sono sempre rispettati. Sbagliati? No, insufficienti per spiegare tutte le modalità

Dettagli

ELETTRONICA ED ELETTROTECNICA

ELETTRONICA ED ELETTROTECNICA Istituto di Istruzione Secondaria Superiore Statale «Via Silvestri 301» Programma di BIOLOGIA Classe 2 a A Indirizzo ELETTRONICA ED ELETTROTECNICA n.1 Titolo La cellula La struttura della cellula La teoria

Dettagli

Lo stato dell'arte in Farmacogenetica e Farmacogenomica

Lo stato dell'arte in Farmacogenetica e Farmacogenomica Lo stato dell'arte in Farmacogenetica e Farmacogenomica Maria Cristina Rosatelli Dipartimento di Scienze Biomediche e Biotecnologie Università degli Studi di Cagliari XXXI Congresso nazionale Variabilità

Dettagli

FONDAZIONE MALAVASI. Scuola secondaria di 2 grado A. MANZONI

FONDAZIONE MALAVASI. Scuola secondaria di 2 grado A. MANZONI FONDAZIONE MALAVASI Scuola secondaria di 2 grado A. MANZONI PIANO DI LAVORO E PROGRAMMAZIONE DIDATTICA DISCIPLINA: Scienze Naturali DOCENTE: Lucia Roncaglia CLASSE I CLASSICO A.S.2015 /2016 1. OBIETTIVI

Dettagli

Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi

Dettagli

ISTITUTO TECNICO ECONOMICO MOSSOTTI

ISTITUTO TECNICO ECONOMICO MOSSOTTI SECONDE AFM - TUR UdA n. 1 Titolo: biosfera/evoluzione dei viventi/tassonomia Acquisire e decodificare concetto di complessità e di interdipendenza all'interno di un sistema biologico Generalità sulla

Dettagli

L INTOLLERANZA AL LATTOSIO

L INTOLLERANZA AL LATTOSIO TITOLO: L INTOLLERANZA AL LATTOSIO SOMMARIO: Lo scopo di questa dispensa è di fornire una conoscenza di base sull intolleranza al lattosio. Ben consci di non poter fornire tutte le informazioni necessarie

Dettagli

Affidabilità nella diagnostica

Affidabilità nella diagnostica Affidabilità nella diagnostica Passione per la ricerca Research & Innovation è un laboratorio di medicina molecolare che esegue test genetici avanzati al servizio dei medici e delle strutture di diagnosi

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI L Autrice v Prefazione xiii L aspetto umano xvi Applicazioni della genetica umana xvii Il sistema Lewis di apprendimento guidato xviii P A R T E 1 Introduzione 1 A P I T O L O 1 2.2 omponenti cellulari

Dettagli

EFFETTI BIOLOGICI DELLE RADIAZIONI

EFFETTI BIOLOGICI DELLE RADIAZIONI EFFETTI BIOLOGICI DELLE RADIAZIONI Asp 2- Caltanissetta- Dott.ssa G. Di Franco Dirigente medico U.O. Radioterapia San Cataldo RADIAZIONI IONIZZANTI Radiazioni capaci di causare direttamente o indirettamente

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA

pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA INDICE pag. Presentazione... IX Ringraziamenti... XXIII Prefazione... XXV Introduzione... 1 Capitolo I IDENTIFICAZIONE GENETICA 1.1. Il concetto d identificazione... 9 1.2. L identificazione nella storia....

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli