GENOTIPO: costituzione genetica di un individuo (sia riferito ad un singolo gene, sia all insieme dei suoi geni).

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GENOTIPO: costituzione genetica di un individuo (sia riferito ad un singolo gene, sia all insieme dei suoi geni)."

Transcript

1 DNA e geni

2 Cosa sono i geni? Sono tratti di DNA ben delimitati Sono sequenze codificanti: tramite le istruzioni contenute in uno specifico gene viene prodotta una caratteristica fenotipica (carattere).

3 GENOTIPO: costituzione genetica di un individuo (sia riferito ad un singolo gene, sia all insieme dei suoi geni). FENOTIPO: manifestazione fisica di un carattere genetico: dipende dal genotipo specifico e dalla sua interazione con l'ambiente CARATTERE: tutte le caratteristiche di un organismo rilevabili con un qualsiasi mezzo di indagine

4 I geni sono quindi il punto di partenza della determinazione della struttura e funzione di un organismo; la strada verso il fenotipo finale è però molto complessa e implica l interazione con l ambiente e di molte vie metaboliche I geni che un individuo possiede determinano solo la possibilità di realizzarsi di una particolare caratteristica fenotipica; il modo in cui questa capacità potenziale viene sviluppata dipende da interazioni con altri geni e con i loro prodotti ma anche da influenze ambientali ed eventi casuali di sviluppo

5 Corpi colorati Cromosomi La cromatina è avvolta in bastoncelli durante la mitosi (divisione cellulare) nelle cellule somatiche Sono presenti in numero fisso per ogni specie (specie-specifico) Sono classificati in base alla forma e a ognuno è assegnato un numero

6 Cariotipo (insieme di tutti i cromosomi) della specie Homo sapiens: i cromosomi sono individuati in base alla forma e numerati da 1 a 23

7 Cromatina DNA associato a proteine chiamate istoni (e a RNA) Il livello più semplice di impacchettamento del DNA consiste nell avvolgimento del doppio filamento attorno agli istoni a formare una struttura detta a collana di perle chiamata nucleosoma

8

9

10

11 Diploide/aploide Un individuo, una specie, una cellula (eucariote) si definisce diploide se contiene nelle cellule somatiche (se pluricellulare) due serie o copie di ciascun cromosoma È aploide se contiene una sola copia per ogni cromosoma In uno stesso organismo (pluricellulare a riproduzione sessuata) possiamo trovare sia cellule aploidi (i gameti) che diploidi (le cellule somatiche): l organismo si definisce comunque diploide Le cellule somatiche sono tutte le cellule che compongono un organismo a eccezione delle cellule che danno origine ai gameti o cellule riproduttive.

12 OGNI COPPIA DI CROMOSOMI CONTIENE GLI STESSI GENI NELLO STESSA POSIZIONE SUL CROMOSOMA (LOCUS) MA NON NECESSARIAMENTE IN FORMA IDENTICA. ALLELI: FORME ALTERNATIVE DI UNO STESSO GENE

13 Allele dominante/recessivo Allele dominante (o fenotipo dominante): allele (o fenotipo) espresso sia allo stato omozigote che allo stato eterozigote Allele recessivo (o fenotipo recessivo): allele (o fenotipo) espresso SOLO allo stato omozigote Un allele dominante si indica con una lettera maiuscola; quello recessivo con la lettera minuscola.

14 Omozigote Organismo diploide che porta alleli identici di uno o più geni e che produce di conseguenza gameti identici Omozigote dominante: organismo diploide che porta lo stesso allele dominante in un determinato locus genico in entrambi i cromosomi (materno e paterno) Omozigote recessivo: organismo diploide che porta lo stesso allele recessivo in un determinato locus genico in entrambi i cromosomi (materno e paterno)

15 Eterozigote Organismo diploide che ha due alleli diversi per uno o più geni. Di conseguenza produrrà alleli diversi

16 Nell immagine è rappresentato l incrocio di due individui omozigoti per il gene A (colore del mantello) L individuo omozigote DOMINANTE produce solo alleli A L individuo omozigote RECESSIVO produce solo gameti a La progenie sarà costituita per il 100% da individui eterozigoti per il gene a e il fenotipo sarà per il 100% mantello nero

1 modulo didattico - Impatto clinico delle malattie genetiche e

1 modulo didattico - Impatto clinico delle malattie genetiche e 1 modulo didattico - Impatto clinico delle malattie genetiche e fondamenti di genetica GENETICA MEDICA OBBIETTIVI FORMATIVI Conoscere le basi cellulari e molecolari dell eredità Conoscere le basi genetiche

Dettagli

3 modulo didattico - Le

3 modulo didattico - Le 3 modulo didattico - Le mutazioni del DNA e le malattie monogeniche. Le mutazioni del genoma umano Mutazione: qualsiasi cambiamento permanente ed ereditabile del DNA Mutazione ereditata proveniente dai

Dettagli

GENETICA. La mappatura dei cromosomi eucariotici mediante la ricombinazione

GENETICA. La mappatura dei cromosomi eucariotici mediante la ricombinazione GENETICA La mappatura dei cromosomi eucariotici mediante la ricombinazione Mappatura: : domande Se 2 geni sono localizzati sullo stesso cromosoma (linked)) si possono scoprire nuove combinazioni di alleli

Dettagli

Cromosomi sessuali. Le cellule maschili e femminili differiscono per i cromosomi sessuali o

Cromosomi sessuali. Le cellule maschili e femminili differiscono per i cromosomi sessuali o Cromosomi sessuali Le cellule maschili e femminili differiscono per i cromosomi sessuali o cromosomi del sesso o eterosomi (cosiddetti perché hanno forma diversa). Nell uomo e in molte altre specie (ma

Dettagli

Genetica e sesso. Paolo Edomi - Genetica

Genetica e sesso. Paolo Edomi - Genetica Genetica e sesso determinazione genetica del sesso eredità legata al sesso prova della teoria cromosomica dell eredità compensazione di dose eredità autosomica e sesso Determinazione del sesso A. autofecondazione

Dettagli

Mutazioni genetiche 2

Mutazioni genetiche 2 Mutazioni genetiche 2 Cosa sono le mutazioni? Le proteine sono in grado di svolgere la loro funzione solo se la loro sequenza amminoacidica è quella corretta. In caso contrario si possono generare delle

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione

La mappatura dei geni umani. SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione La mappatura dei geni umani SCOPO conoscere la localizzazione dei geni per identificarne la struttura e la funzione Un grande impulso alla costruzione di mappe genetiche è stato dato da le tecniche della

Dettagli

Capitolo 2 Eredità mendeliana

Capitolo 2 Eredità mendeliana Capitolo 2 Eredità mendeliana 2.1 Se una cavia nera di sesso femminile è sottoposta a incrocio di prova e produce 2 figli neri, qual è il suo probabile genotipo? Con quale grado di certezza può essere

Dettagli

Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

I MOTORI DELL EVOLUZIONE PT4. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT4. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT4 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 RICOMBINAZIONE E LINKAGE DISEQUILIBRIUM 2 In organismi a riproduzione sessuata

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

PROF. Edoardo Soverini

PROF. Edoardo Soverini PROGRAMMA SVOLTO A.S. 2015-2016 PROF. Edoardo Soverini MATERIA: Scienze Naturali CLASSE IIB Liceo I. CONTENUTI DISCIPLINARI, FINALITÀ E OBIETTIVI FORMATIVI DELLA DISCIPLINA UNITÀ DIDATTICHE - MODULI PERIODO

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà GENETICA... lessico Genetica: studio dei geni e dell'ereditarietà Geni: porzioni di DNA contenenti un'informazione che permette di decodificare una certa proteina. Es: gene che determina il colore dei

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

LAB-NEWS Anno 1 n 4 Aprile 2006

LAB-NEWS Anno 1 n 4 Aprile 2006 1 FAVISMO (DEFICIT G6PD) Cos è il deficit di G6PD? Il deficit di G6PD o favismo è una condizione determinata dalla carenza dell enzima glucosio-6-fosfatodeidrogenasi (G6PD), importante in una via metabolica

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

CLASSE I classico A e B

CLASSE I classico A e B LICEO SCIENTIFICO "A. APROSIO" VENTIMIGLIA CLASSE I classico A e B Anno scolastico 2011-2012 UNITA' DIDATTICA N 1 METODI ED ORGANIZZAZIONE DEI CONCETTI IN BIOLOGIA 1.1 LE CARATTERISTICHE COMUNI A TUTTI

Dettagli

1 a LEGGE DI MENDEL Legge della Segregazione

1 a LEGGE DI MENDEL Legge della Segregazione IMPRINTING 1 a LEGGE DI MENDEL Legge della Segregazione I due membri di una coppia di alleli, durante la formazione dei gameti segregano in maniera indipendente, cioè in modo che metà dei gameti porti

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI:

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Durante la meiosi, i membri di una coppia allelica si separano in modo simmetrico nelle uova e negli spermatozoi. Questa separazione

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

SPERMATOGONI A(scuri) poia1(chiari) SPERMATOCITA PRIMARIO (max 64 da 1 cell) SPERMATOCITI SECONDARI SPERMATIDI SPERMATOZOI MATURI.

SPERMATOGONI A(scuri) poia1(chiari) SPERMATOCITA PRIMARIO (max 64 da 1 cell) SPERMATOCITI SECONDARI SPERMATIDI SPERMATOZOI MATURI. Riproduzione asessuata o agama sessuata o gamica genera individui, questi costituiscono un clone dalla ricombinazione dei genotipi parentali emerge la producono una generazione di figli con un genoma risultante

Dettagli

GENETICA GENERALE ED UMANA LA GENETICA E LA SCIENZA DELL EREDITARIETA, CIOE STUDIA LA TRASMISSIONE DELLE CARATTERISTICHE EREDITARIE, CHE DISTINGUONO UN SOGGETTO DALL ALTRO. NEGLI ULTIMI DECENNI LA GENETICA,

Dettagli

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione.

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. Gregor Jhoann Mendel (1822-1884) Mendel viveva nel monastero di Brum, a Brno in Repubblica Ceca, studiò

Dettagli

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA

MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA FACOLTÀ MEDICINA E CHIRURGIA ANNO ACCADEMICO OFFERTA 2014/2015 FORMATIVA ANNO ACCADEMICO EROGAZIONE 2014/2015 CORSO DI LAUREA (o LAUREA MAGISTRALE) Medicina e Chirurgia Canale Chirone- Sede Formativa Palermo

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

Divisione riduzionale: meiosi

Divisione riduzionale: meiosi Anomalie genetiche Divisione riduzionale: meiosi Nelle ovaie, con la meiosi si generano 4 nuclei da ogni ovogonio ma uno solo diventerà cellula-uovo mentre gli altri tre degenerano. Nei testicoli ogni

Dettagli

La terza legge: l'indipendenza dei caratteri

La terza legge: l'indipendenza dei caratteri La terza legge: l'indipendenza dei caratteri Formulazione semplificata della terza legge, supportata da immagine e filmato TERZA LEGGE DI MENDEL ANIMAZIONE a cura di Gigliola Merante 1 Verifichiamo la

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI?

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? CARATTERE AUTOSOMICO -codificato da geni su cromosomi non sessuali -non ci sono differenze di trasmissione

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

Arintha biotech Dicembre 2005

Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Arintha biotech Dicembre 2005 GENETICA MOLECOLARE Il genoma è costituito dall insieme dei geni, localizzati all interno dei cromosomi Ogni gene codifica una proteina. Ogni proteina

Dettagli

LA GENETICA MENDELIANA

LA GENETICA MENDELIANA LA GENETICA MENDELIANA A partire dal 1856, Johann Gregor Mendel (1822 1884) iniziò una lunga serie di esperimenti sulle piante di pisello (Pisum sativum), con le quali era facile effettuare incroci ed

Dettagli

ESTENSIONI DELLE LEGGI DI MENDEL

ESTENSIONI DELLE LEGGI DI MENDEL ESTENSIONI DELLE LEGGI DI MENDEL Mendel rinuncia alle sue ricerche Mendel proseguì le sue ricerche su altre piante per ottenere conferme alle sue leggi, ma trovò tante e tali contraddizioni che (si dice)

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT1 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 GREGOR MENDEL 1822-1884 2 2 Grandi navigatori 3 3 Rotte commerciali per le

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare V Scuola di Ingegneria dell Informazione Laurea Magistrale in Ingegneria Informatica II Scuola di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione

Dettagli

ANOMALIE CROMOSOMICHE DI STRUTTURA. necessitano di rotture dei cromosomi

ANOMALIE CROMOSOMICHE DI STRUTTURA. necessitano di rotture dei cromosomi ANOMALIE CROMOSOMICHE DI STRUTTURA necessitano di rotture dei cromosomi ANOMALIE CROMOSOMICHE DI STRUTTURA necessitano di rotture dei cromosomi una rottura su un cromosoma ANOMALIE CROMOSOMICHE DI STRUTTURA

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

I CARATTERI EREDITARI

I CARATTERI EREDITARI I CARATTERI EREDITARI I primi passi per comprendere come si trasmettono le caratteristiche attraverso le generazioni furono lenti e difficili. I caratteri di un individuo sono spesso molto simili a quelli

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 15 Capitolo 12

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 15 Capitolo 12 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 15 Capitolo 12 1 Genetica del lievito S. cerevisiae

Dettagli

LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione

Dettagli

www.fisiokinesiterapia.biz LE LEGGI DI MENDEL

www.fisiokinesiterapia.biz LE LEGGI DI MENDEL www.fisiokinesiterapia.biz LE LEGGI DI MENDEL Gregor Johann Mendel (1822-1884) Comprese i principi che regolano la trasmissione dei caratteri ereditari alla progenie senza conoscere - l esistenza dei geni

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Adriana Giangrande. Paradigmi dell evoluzione biologica

Adriana Giangrande. Paradigmi dell evoluzione biologica Adriana Giangrande Paradigmi dell evoluzione biologica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 A/B 00173 Roma (06) 93781065 ISBN 978

Dettagli

Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali

Dettagli

La riproduzione nelle piante. Lezioni d'autore

La riproduzione nelle piante. Lezioni d'autore La riproduzione nelle piante Lezioni d'autore VIDEO Introduzione (I) Come in molti altri esseri viventi, anche nelle piante la riproduzione può essere sessuata o asessuata. Esistono specie che presentano

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

Struttura di una possibile serie di lezioni sull ereditarietà e sul DNA

Struttura di una possibile serie di lezioni sull ereditarietà e sul DNA 1 Struttura di una possibile serie di lezioni sull ereditarietà e sul DNA IL PERCORSO DIDATTICO Conosciamo noi stessi A chi assomiglio? Analisi dei caratteri ereditati Da dove derivano i caratteri? Costruiamo

Dettagli

PROGRAMMA EFFETTIVAMENTE SVOLTO DAL DOCENTE

PROGRAMMA EFFETTIVAMENTE SVOLTO DAL DOCENTE Ministero dell istruzione, dell università e della ricerca Istituto d Istruzione Superiore Severi-Correnti IIS Severi-Correnti 02-318112/1 via Alcuino 4-20149 Milano 02-33100578 codice fiscale 97504620150

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

PROF. Edoardo Soverini

PROF. Edoardo Soverini PIANO DI LAVORO A.S. 2015-2016 PROF. Edoardo Soverini MATERIA: Scienze Naturali CLASSE 1B classico DATA DI PRESENTAZIONE: 19.10.2015 I. SCANSIONE TEMPORALE Monte ore annuale: 66h UNITÀ DIDATTICHE - MODULI

Dettagli

SBOBBINATURE DI GENETICA prof. Varriale a.a. 2012/2013. Olivetta Michelangelo/Fonticelli Mariano. scaricato da www.sunhope.it

SBOBBINATURE DI GENETICA prof. Varriale a.a. 2012/2013. Olivetta Michelangelo/Fonticelli Mariano. scaricato da www.sunhope.it SBOBBINATURE DI GENETICA prof. Varriale a.a. 2012/2013 Olivetta Michelangelo/Fonticelli Mariano 16.10.2012 GENETICA N 1 Perché studiare la genetica? A parte un semplice interesse, lo studio di questa materia

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Introduzione alle macchine a stati (non definitivo)

Introduzione alle macchine a stati (non definitivo) Introduzione alle macchine a stati (non definitivo) - Introduzione Il modo migliore per affrontare un problema di automazione industriale (anche non particolarmente complesso) consiste nel dividerlo in

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

La Riproduzione e l Apparato Riproduttivo Umano. Tratto e parzialmente rielaborato da amedeorollo.altervista.org

La Riproduzione e l Apparato Riproduttivo Umano. Tratto e parzialmente rielaborato da amedeorollo.altervista.org La Riproduzione e l Apparato Riproduttivo Umano Tratto e parzialmente rielaborato da amedeorollo.altervista.org La Riproduzione Perché gli esseri viventi si riproducono? La riproduzione (o procreazione)

Dettagli

Principi di mappatura genetica. Paolo Edomi - Genetica

Principi di mappatura genetica. Paolo Edomi - Genetica Principi di mappatura genetica Mappa genetica o di associazione cromosoma = mappa lineare posizione dei geni = punti sulla mappa loci genici frequenza di ricombinazione A B A B distanza dei geni > distanza

Dettagli

MOLTIPLICAZIONE CELLULARE

MOLTIPLICAZIONE CELLULARE MOLTIPLICAZIONE CELLULARE by Alfio Francesco e Maria Cannone La moltiplicazione cellulare è il processo attraverso il quale piante e animali generano nuove cellule o individui e rappresenta una delle funzioni

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari

La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi divisione cellulare caratteristica degli eucarioti, sia unicellulari che pluricellulari La meiosi porta alla formazione di cromosomi nuovi attraverso il crossing over Con la meiosi, una cellula

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi

È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi È stimato che oggi sulla terra sono presenti da 10*10 6 a 100*10 6 specie viventi Enorme diversità di forme Costanza di struttura interna La cellula è l unità fondamentale di tutti gli organismi viventi

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 4. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 4. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 4 Domande concettuali C1. La dominanza si verifica quando un allele esercita completamente i suoi effetti sul fenotipo rispetto a un altro allele. La dominanza incompleta

Dettagli

ELETTRONICA ED ELETTROTECNICA

ELETTRONICA ED ELETTROTECNICA Istituto di Istruzione Secondaria Superiore Statale «Via Silvestri 301» Programma di BIOLOGIA Classe 2 a A Indirizzo ELETTRONICA ED ELETTROTECNICA n.1 Titolo La cellula La struttura della cellula La teoria

Dettagli

GENETICA. La genetica è la scienza che studia i geni, l ereditarietà

GENETICA. La genetica è la scienza che studia i geni, l ereditarietà GENETICA La genetica è la scienza che studia i geni, l ereditarietà Gregor Johann Mendel è stato un monaco considerato, il precursore della moderna genetica. Nel 1910 Thomas hunt Morgan suggerì che i geni

Dettagli

Psiche e complessità. 4. L approccio bottom-up ai problemi

Psiche e complessità. 4. L approccio bottom-up ai problemi Psiche e complessità 4. L approccio bottom-up ai problemi Complessità della mente FENOMENI LINEARI (LOGICA, RAZIONALITA, CONTENUTI ESPLICITI) FENOMENI NON LINEARI (ASSOCIAZIONI ANALOGICHE, CONTENUTI IMPLICITI)

Dettagli

Ereditarietà biologica: le leggi di Mendel, e le eccezioni alla ereditarietà mendeliana.

Ereditarietà biologica: le leggi di Mendel, e le eccezioni alla ereditarietà mendeliana. Ereditarietà biologica: le leggi di Mendel, e le eccezioni alla ereditarietà mendeliana. la scienza dell ereditarietà Le radici storiche della genetica, la scienza dell ereditarietà, risalgono agli antichi

Dettagli

IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE.

IL GENOMA UMANO. Ogni cromosoma è suddiviso in regioni d informazione dette GENI. L informazione espressa da ciascun gene è detta CARATTERE. IL GENOMA UMANO Ogni cellula contiene nel nucleo una molecola chiamata DNA (acido desossiribonucleico) Tale molecola ha la forma di una lunghissima scala a chiocciola. I gradini che compongono la scala

Dettagli

FENILCHETONURIA. Adattarsi ad una nuova realtà

FENILCHETONURIA. Adattarsi ad una nuova realtà FENILCHETONURIA Adattarsi ad una nuova realtà 9 Che cosa è la fenilchetonuria? Per capire la fenilchetonuria bisogna partire dal concetto che tutti gli alimenti, in quantità variabile, contengono una sostanza

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

ISTITUTO SALESIANO DON BOSCO Villa Ranchibile. LICEO SCIENTIFICO Anno scolastico 2015/2016 PROGRAMMA DI SCIENZE Svolto nella classe II a sez.

ISTITUTO SALESIANO DON BOSCO Villa Ranchibile. LICEO SCIENTIFICO Anno scolastico 2015/2016 PROGRAMMA DI SCIENZE Svolto nella classe II a sez. ISTITUTO SALESIANO DON BOSCO Villa Ranchibile Via Libertà, 199 90143 PALERMO LICEO SCIENTIFICO Anno scolastico 2015/2016 PROGRAMMA DI SCIENZE Svolto nella classe II a sez. A Docente: Prof. Rosario Papa

Dettagli

PILLOLE DI GENETICA. Da Gregor Mendel ad oggi

PILLOLE DI GENETICA. Da Gregor Mendel ad oggi PILLOLE DI GENETICA Da Gregor Mendel ad oggi Obiettivi Conoscere: DNA, cromosomi, geni, genoma, alleli, eterozigote e omozigote, genotipo e fenotipo, tratti dominanti e recessivi, codominanza e dominanza

Dettagli

GENETICA GENERALE GENETICA UMANA E MOLECOLARE

GENETICA GENERALE GENETICA UMANA E MOLECOLARE GENETICA GENERALE GENETICA UMANA E MOLECOLARE Come si studiano i geni 1. Trasmissione genetica, studia i fenomeni del passaggio dei caratteri da generazione a generazione (sperimentale: in modelli animali

Dettagli

Le strategie mendeliane

Le strategie mendeliane Le strategie mendeliane Il punto di partenza: il rompicapo sull eredità e come l approccio sperimentale innovativo di Mendel aiutò a risolverlo. Il lavoro vero e proprio: l analisi genetica secondo Mendel,compresa

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

TEORIA CROMOSOMICA : ALLEGATI

TEORIA CROMOSOMICA : ALLEGATI TEORIA CROMOSOMICA : ALLEGATI FIG. 2 a pag. 1 FIG. 5 a pag. 3 FIG. 7 a pag. 5 FIG. 9 a pag. 7 FIG. 3 e 4 a pag. 2 FIG. 6 a pag. 4 FIG. 8 a pag. 6 FIG. 10 e 11 a pag. 8 1 FIGURA 2 Perché sono tutti maschi

Dettagli