NU PORO NUCLEARE RER

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "NU PORO NUCLEARE RER"

Transcript

1 il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla trascrizione e alla maturazione dell'rna. Il nucleo è presente solo negli eucarioti ed è delimitato da una doppia membrana fosfolipoproteica in continuità con il RER

2 Il nucleo

3 NU PORO NUCLEARE RER

4

5 la membrana nucleare (o involucro nucleare) è quella è la struttura che riveste ed isola il nucleo della cellula eucariote dall'ambiente citoplasmatico. E composta da due doppie membrane fosfolipoproteiche concentriche, ciascuna di spessore di 8 nm circa, che delimitano il lume della cisterna perinucleare di nm. Tale cisterna è in continuità con il RER. La cisterna è interrotta a livello dei pori dove le due membrane si fondono. La membrana esterna e quella interna, sebbene non contravvengano al principio di membrana unitaria hanno composizione differente sia in fosfolipidi che in proteine. Alla membrana interna è legata una fitta maglia incrociata chiamata làmina nucleare, composta da quattro tipi di lamìna nucleare o fiobrosa (A, B1, B2, C) che identifica il filamento intermedio specifico per il nucleoscheletro, il cui scopo è di fornire un sostegno per il nucleo e un ancoraggio per la cromatina

6 La lamina nucleare separa la cromatina (DNA non spiralizzato) dalla membrana nucleare interna, ed ha un spessore che varia dai 10 ai 20 nm. La struttura a maglia, con cui è disposta, si interrompe in corrispondenza dei pori nucleari ed ha una forma simile in cellule dello stesso tessuto. La membrana esterna nucleare può invece presentare ribosomi (come facilmente immaginabile, a causa della continuità con il reticolo rugoso).

7 LA LAMINA NUCLEARE E' TUTTA INTORNO ALLA MAMBRANA NUCLEARE INTERNA COME DIMOSTRA LA LOCALIZZAZIONE CON UN ANTICORPO SPECIFICO

8 LE INTERAZIONI TRA NUCLEOSCHELETRO E CITOSCHELETRO GARANTISCONO LA COMUNICAZIONE TRANUCLEO E CITOPLASMA

9 La membrana nucleare non è continua, ma presenta dei fori, detti pori nucleari, il cui scopo è quello di permettere il passaggio delle molecole dal citosol al nucleoplasma. I pori nucleari sono composti da 8 proteine canale disposte ad ottametro e da centinaia di altre proteine che formano le diverse subunità, per un totale di 120 MDa di massa. Abbiamo le subunità ad anello, subunità a colonna, subunità laminare, subunità anulare, fibrille e canestro nucleare.

10 Dalle osservazioni di microscopia elettronica si ritiene che il poro sia formato, a grandi linee, da un anello citoplasmatico (a cui sono legati filamenti citoplasmatici), sulla membrana esterna, composto da 8 subunità che si connettono con le subunità colonnari (da cui dipartono i "raggi" o subunità del trasportatore) che a loro volta si connettono alle 8 subunità dell'anello nucleare, sulla membrana nucleare interna, ad esse sono fissate le proteine del canestro che protrude nel lume nucleare.

11 Il complesso del poro

12 Le molecole più piccole (fino a Da) passano per diffusione, molecole più grandi fino a Da passano con velocità inversamente proporzionale alla loro massa.

13 Membrana esterna nucleare con pori

14 Organizzazione del nucleoscheletro e della cromatina

15 La cromatina rappresenta la forma in cui gli acidi nucleici si trovano nel nucleo di una cellula eucariota. La cromatina è formata da acido desossiribonucleico, DNA, avvolto su gruppi di proteine dette istoni (proteine basiche), formando un nucleosoma, e da proteine non-istoniche (proteine neutre o acide); essa è poi ripiegata in vario modo.

16 Esistono infatti diversi livelli di organizzazione della cromatina: la fibra da 11 nm di diametro è il primo livello, è uno stadio detto "filo a collana di perle" per il suo aspetto. In questo stadio il DNA è avvolto attorno ai nucleosomi, senza ulteriori ripiegamenti; la fibra da 30 nm di diametro è il secondo livello. In esso la cromatina assume un aspetto sinusoidale grazie alle interazioni che gli istoni H1 formano fra di loro; è lo stadio in cui si trova la cromatina attiva in interfase (periodo compreso fra due divisioni cellulari), cioè la cromatina che viene trascritta

17 fibra da 300 mn di diametro o fibra ad ansa, la cromatina si ripiega ulteriormente su se stessa grazie anche all'aiuto di altre proteine; fibra da 700 nm di diametro, la cromatina si superavvolge, è il diametro dei singoli cromatidi; fibra da 1400 nm di diametro, è il livello di condensazione massimo, quello dei cromosomi mitotici

18 Forme della cromatina nucleare

19 La cromatina in diversi stadi di condensazione vista al TEM

20 La condensazione del filamento di DNA avviene grazie alla pre senza di particolari proteine, gli Istoni, che formano complessi globulari attorno ai quali si avvolge la doppia elica a costituire il NUCLEOSOMA Grazie a fenomeni di superavvolgimento del nucleosoma il filamneto di DNA è ulteriormente raccorciato e aumenta di spessore, fino a raggiungere le dimensioni massime del Cromosoma

21 Si distinguono due tipi di cromatina: eucromatina: meno condensata e corrisponde a zone in cui vi è un'intensa attività di trascrizione per la sintesi proteica (ossia di copia delle molecole di DNA in molecole di RNA messaggero, mrna); eterocromatina: più condensata, non sembra presentare attività di trascrizione. Si distinguono due tipi di eterocromatina: l'eterocromatina costitutiva, che rimane tale durante tutto lo sviluppo, ed è presente in posizione identica su entrambi i cromosomi omologhi di un paio, e l'eterocromatina facoltativa, che varia di condizione (rilassata ed espressa/condensata e inattiva) a seconda dei diversi tipi cellulari (es: inattivazione cromosoma X) e delle diverse fasi dello sviluppo

22 H= eterocromatina E= eucromatina

23 Il nucleolo è l'organulo responsabile della sintesi dell'rna ribosomiale (rrna). Si tratta di una struttura fibrosa e granulata presente in una o più copie nel nucleo della maggior parte delle cellule eucariotiche superiori, specialmente quelle che presentano una attiva sintesi proteica. Al microscopio ottico appare come un granulo rotondeggiante, non delimitato da membrana e circondato da uno strato di cromatina condensata. È costituito da tratti di DNA che codificano per l'rna ribosomiale, da filamenti di rrna nascenti e da proteine.

24 Nucleolo

25 Probabilmente il nucleolo intervene anche in altre importanti attività cellulari: ad esempio sembra avere un ruolo centrale nel trasferimento dell'rna messaggero (mrna) dal nucleo al citoplasma.il nucleolo come gli organuli cellulari, è tenuto insieme da una struttura proteica chiamata matrice nucleolare che costituisce una delle tre conponenti del nucleoscheletro.

26 Il nucleolo si presenta con le seguenti strutture: cromatina perinucleolare, che si dispone a fascia, circondando più o meno completamente il corpo del nucleolo. Questa cromatina perinucleolare presenta proprietà fisiche singolari che permettono di isolare i nucleoli intatti ricorrendo all ultracentrifugazione. Il calcio indurisce questa zona di cromatina e, in assenza di calcio, il nucleolo si gonfia e perde le sue caratteristiche morfologiche. corpo nucleolare, in genere sferico, che corrisponde alla porzione di nucleolo circondata da cromatina perinucleolare

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali Strutture cellulari comuni tra cellule animali e vegetali: CITOPLASMA CITOSCHELETRO RIBOSOMI RETICOLO ENDOPLASMATICO APPARATO DEL GOLGI MITOCONDRI NUCLEO PEROSSISOMI CITOPLASMA materiale gelatinoso incolore

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm)

IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm) Il nucleo IL NUCLEO IL NUCLEO Nelle cellule eucariote c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita Prof.ssa Flavia Frabetti La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria

Dettagli

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si LA CELLULA Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si nutre, respira, scambia sostanze con l ambiente

Dettagli

Lezione 3. Dentro la cellula eucariote. Bibliografia. I colori della biologia. Giusti Gatti Anelli. Ed. Pearson

Lezione 3. Dentro la cellula eucariote. Bibliografia. I colori della biologia. Giusti Gatti Anelli. Ed. Pearson Lezione 3 Dentro la cellula eucariote Bibliografia I colori della biologia Giusti Gatti Anelli Ed. Pearson Quali sono la struttura e le funzioni della membrana plasmatica? Qual è la funzione del nucleo?

Dettagli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli

Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Doppia membrana Pori Matrice

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

LE TECNICHE PER LO STUDIO DELLA CELLULA

LE TECNICHE PER LO STUDIO DELLA CELLULA LE TECNICHE PER LO STUDIO DELLA CELLULA Potere risolutivo: minima distanza alla quale due punti possono essere distinti OCCHIO UMANO = 100 m (0,1 mm ) MICROSCOPIO OTTICO = 0,2 m MICROSCOPIO ELETTRONICO

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per:

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per: Nucleo L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: 1. Citoplasma 2. Materiale Genetico 3. Membrana Plasmatica Differiscono tra loro per: Forma Dimensione Funzione

Dettagli

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Pori Matrice Nucleare

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

Cellule animali e vegetali

Cellule animali e vegetali Cellule animali e vegetali Tra le cellule eucariote animali e vegetali esistono differenze piuttosto importanti; nelle cellule vegetali, per esempio, sono presenti i plastidi, organuli che permettono l

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

L esperimento di Griffith sulla trasformazione genetica in pneumococco.

L esperimento di Griffith sulla trasformazione genetica in pneumococco. L esperimento di Griffith sulla trasformazione genetica in pneumococco. La natura chimica del materiale genetico ACIDI NUCLEICI DNA : deposito informazioni RNA: a) espressione informazione (es. sintesi

Dettagli

- In che modo questi segnali dirigono il trasporto della proteina al compartimento di destinazione?

- In che modo questi segnali dirigono il trasporto della proteina al compartimento di destinazione? PRINCIPI GENERALI DELLO SMISTAMENTO DELLE PROTEINE - Dove risiede l informazione per la corretta localizzazione di una proteina? - In che modo questi segnali dirigono il trasporto della proteina al compartimento

Dettagli

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI

02/12/2014. Tutti gli esseri viventi sono composti da cellule LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI Tutti gli esseri viventi sono composti da cellule Eubatteri Procarioti unicellulari Archebatteri LA CELLULA E L UNITA STRUTTURALE E FUNZIONALE DEGLI ORGANISMI VIVENTI -Autoconservazione mantenimento della

Dettagli

La cellula. Teoria cellulare. Cellula. Organizzazione cellulare Come si studia la cellula

La cellula. Teoria cellulare. Cellula. Organizzazione cellulare Come si studia la cellula La cellula Cellula Teoria cellulare Teoria cellulare Organizzazione e dimensioni della cellula Metodi di studio della cellula Cellule procariote ed eucariote Nucleo cellulare Organuli citoplasmatici Citoscheletro

Dettagli

Dopo l invenzione del microscopio è stato possibile scoprire l esistenza delle cellule.

Dopo l invenzione del microscopio è stato possibile scoprire l esistenza delle cellule. CELLULA Dopo l invenzione del microscopio è stato possibile scoprire l esistenza delle cellule. 1. La cellula Definizione di cellula 1. È la più piccola parte di un organismo (pluricellulare). 2. Può costituire

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

Definizione Composti quaternari: C H O N S P Fe Mg I

Definizione Composti quaternari: C H O N S P Fe Mg I PROTIDI Definizione Composti quaternari: C H O N S P Fe Mg I ORIGINE cellulare ogni cellula sintetizza le sue prote CARATTERISTICHE insolubili in acqua sensibili a variazioni di ph coagulano in presenza

Dettagli

Tutta la vita cellulare ha le seguenti caratteristiche in comune. tutte le cellule hanno una membrana cellulare che separa il liquido extracellulare

Tutta la vita cellulare ha le seguenti caratteristiche in comune. tutte le cellule hanno una membrana cellulare che separa il liquido extracellulare Tutta la vita cellulare ha le seguenti caratteristiche in comune. tutte le cellule hanno una membrana cellulare che separa il liquido extracellulare dal citoplasma cellulare che ha un alto grado di organizzazione.

Dettagli

Tutti gli esseri viventi sono formati da cellule

Tutti gli esseri viventi sono formati da cellule La cellula La cellula La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. La cellula Sebbene i virus siano in grado

Dettagli

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote Nucleo Biotec 2011 Nucleo Organello che contiene il materiale genetico di una cellula eucariote NUCLEO INVOLUCRO NUCLEARE Il nucleo é il centro informazionale di una cellula eucariotica. L involucro nucleare

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU)

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU) http://www 3.unipv.it/webbio/anatcomp/freitas/freitas.html Insegnamento Biologia della Cellula Animale e Vegetale (9 CFU) Unità didattica: Biologia della Cellula Animale (6 CFU) Esempi di Testi da utilizzare

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule.

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. LA CELLULA CELLULA La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. CELLULA La teoria cellulare Le cellule furono

Dettagli

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula

Dettagli

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S

CONOSCERE IL CORPO UMANO PARTE 1. DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S CONOSCERE IL CORPO UMANO PARTE 1 DOCENTE: Prof. ssatozzi Carla CLASSE: 1G/Sport A.S. 2007-2008 1 CONOSCERE IL CORPO UMANO: GLOSSARIO ANATOMIA Scienza che studia e illustra la forma, l architettura e la

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli

Dettagli

Progressivo passaggio da organizzazione unicellulare a organizzazione coloniale e pluricellulare

Progressivo passaggio da organizzazione unicellulare a organizzazione coloniale e pluricellulare LA CELLULA unità morfo-funzionale elementare di tutti gli organismi capaci di vita autonoma: unicellulari, pluricellulari in colonie, pluricellulari organizzati in tessuti o pseudotessuti, animali, vegetali

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita CdL Infermieristica AA.2011/12 - Prof.ssa Frabetti La cellula è l unità strutturale e funzionale degli organismi viventi La cellula presenta tutte le proprietà elettive dei viventi:

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

Tu# gli organismi sono compos0 da cellule. Tu3e le cellule sono composte da componen0 cellulari

Tu# gli organismi sono compos0 da cellule. Tu3e le cellule sono composte da componen0 cellulari Tu# gli organismi sono compos0 da cellule Tu3e le cellule sono composte da componen0 cellulari Silvia.parolini@unibs.it Prof.ssa Silvia Parolini, Dipar0mento di Medicina Molecolare e Traslazionale Università

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

Gli organismi sono fatti di cellule

Gli organismi sono fatti di cellule Gli organismi sono fatti di cellule Diversi tipi di cellule a. batteri, b. un alga verde, c. cellule di una pianta, d. cellule di un embrione animale Tutti gli organismi sono formati da piccole unità chiamate

Dettagli

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

citologia Citologia (dal greco κύτος, Kytos, "un vuoto", e -λογία, -logia studio ). Significa "lo studio delle cellule".

citologia Citologia (dal greco κύτος, Kytos, un vuoto, e -λογία, -logia studio ). Significa lo studio delle cellule. cellula citologia Citologia (dal greco κύτος, Kytos, "un vuoto", e -λογία, -logia studio ). Significa "lo studio delle cellule". Quanto è piccola una cellula Il volume della cellula può variare da 1 μm

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

La cellula in dettaglio 1

La cellula in dettaglio 1 La cellula in dettaglio 1 ASPETTI GENERALI Che cos è la cellula? La cellula è la più piccola porzione di un essere vivente in grado di svolgere una vita, entro certi limiti, autonoma. Tutti gli organismi

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Lezione 1: Atomi e molecole:

Lezione 1: Atomi e molecole: Lezione 1: Atomi e molecole: La materia è costituita da elementi chimici in forma pura o in combinazioni dette composti. La vita richiede circa 25 elementi chimici. La struttura atomica determina il comportamento

Dettagli

MEMBRANE INTERNE. nm)

MEMBRANE INTERNE. nm) MEMBRANE INTERNE Nella cellula eucariotica,, membrane circoscrivono cavità chiuse di varia forma: i compartimenti citoplasmatici. In base alla forma, le strutture delimitate da membrana possono essere

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita Prof.ssa Flavia Frabetti aa. 2010-11 La cellula è l unità strutturale e funzionale degli organismi viventi La cellula presenta tutte le proprietà elettive dei viventi: auto-regolazione

Dettagli

CV2008 Isis Romagnosi 1

CV2008 Isis Romagnosi 1 CV2008 Isis Romagnosi 1 I microscopi costruiti da Hooke (1635-1703), che si avvalevano di nuovi sistemi ottici e di un nuovo sistema di illuminazione, gli permisero una serie di scoperte esposte nel libro

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare

Università degli Studi del Sannio. Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a Programma di Biologia Cellulare Università degli Studi del Sannio Facoltà di Scienze MM.FF.NN. - Corso di Laurea in Biotecnologie a.a. 2010-2011 Programma di Biologia Cellulare (Prof Massimo Mallardo, I semestre, I anno) massimo.mallardo@unina.it

Dettagli

In base alle caratteristiche delle miofibrille

In base alle caratteristiche delle miofibrille Tessuto muscolare Rende possibili sia i movimenti del corpo nell insieme che quelli delle singole parti. Il tessuto muscolare è dotato di contrattilità oltre che di eccitabilità. In base alle caratteristiche

Dettagli

Corso di Laurea in Scienze Biologiche

Corso di Laurea in Scienze Biologiche Corso di Laurea in Scienze Biologiche Insegnamento di CITOLOGIA ANIMALE E VEGETALE (Corso A) 5 CFU Docente: I. Perroteau 1 Login Inizio esercitazioni a Gennaio 2009 Orario Appelli: iscrizioni e risultati

Dettagli

endoplasmatico liscio Ribosomi Centriolo Apparato di Golgi Membrana plasmatica Filamento intermedio Mitocondrio

endoplasmatico liscio Ribosomi Centriolo Apparato di Golgi Membrana plasmatica Filamento intermedio Mitocondrio La cellula animale Reticolo endoplasmatico ruvido Reticolo endoplasmatico liscio Nucleo Flagello Assenti nella maggior parte delle cellule vegetali Lisosoma Ribosomi Centriolo Apparato di Golgi Perossisoma

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

Capitolo 4 Un viaggio dentro la cellula

Capitolo 4 Un viaggio dentro la cellula Capitolo 4 Un viaggio dentro la cellula Introduzione al mondo della cellula 4.1 I microscopi ci permettono di esplorare l interno delle cellule Il microscopio ottico (LM, dall inglese Light Microscope)

Dettagli

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti

Dettagli

Benvenuti! CL in Biotecnologie Insegnamento di Biologia generale con elementi di Citologia ed Istologia

Benvenuti! CL in Biotecnologie Insegnamento di Biologia generale con elementi di Citologia ed Istologia Corso di laurea in Biotecnologie (Canale A) [L-2] D. M. 270/2004 CL in Biotecnologie Insegnamento di Biologia generale con elementi di Citologia ed Istologia Benvenuti! AA 2016-17 Biologia generale con

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA AA 2011-2012 Dott.ssa Veronica Papa Citologia

Dettagli

LA STRUTTURA CELLULARE

LA STRUTTURA CELLULARE LA STRUTTURA CELLULARE Cellula procariote Cellula eucariote: Cellula vegetale animale vegetale Sintesi prof. Mariantonia Resnati Cellula Inglese: cell L'unità strutturale di tutti gli organismi viventi.

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

IL DOGMA CENTRALE DELLA BIOLOGIA RNA

IL DOGMA CENTRALE DELLA BIOLOGIA RNA La traduzione IL DOGMA CENTRALE DELLA BIOLOGIA Trascrizione DNA Passaggio dell informazione contenuta nel DNA mediante la sintesi di RNA RNA Proteine Duplicazione DNA Traduzione Costruzione della catena

Dettagli

PARTE PRIMA EMBRIOLOGIA GENERALE

PARTE PRIMA EMBRIOLOGIA GENERALE PARTE PRIMA EMBRIOLOGIA GENERALE 21 Capitolo 1 L ovocita e lo spermatozoo Inizieremo lo studio dell embriologia umana con la descrizione di due cellule molto speciali che, interagendo in un processo chiamato

Dettagli

CITOSCHELETRO. Caratteristica degli epiteli: mutua adesività fra le singole cellule.

CITOSCHELETRO. Caratteristica degli epiteli: mutua adesività fra le singole cellule. CITOSCHELETRO Caratteristica degli epiteli: mutua adesività fra le singole cellule. Ematossilina eosina Ematossilina ferrica, fissazione in bicromato Nell epidermide l istologia rivela strutture di coesione

Dettagli

LA CHIMICA DELLA VITA

LA CHIMICA DELLA VITA LA CHIMICA DELLA VITA L elemento presente in tutte le molecole caratteristiche degli esseri viventi è IL CARBONIO Il carbonio ha numero atomico 6 (Z=6). Ha valenza 4: ai suoi atomi mancano 4 elettroni

Dettagli

RNA: trascrizione e maturazione

RNA: trascrizione e maturazione RNA: trascrizione e maturazione Trascrizione e traduzione Nei procarioti: : stesso compartimento; negli eucarioti: : due compartimenti Pulse and chase 1) le cellule crescono in uracile radioattivo in eccesso

Dettagli

ACIDI GRASSI INSATURI

ACIDI GRASSI INSATURI LIPIDI ACIDI GRASSI SATURI ACIDI GRASSI INSATURI TRIGLICERIDI TRIGLICERIDI Grassi neutri o lipidi semplici glicerolo + 1 acido grasso monogliceride glicerolo + 2 acidi grassi digliceride glicerolo + 3

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

IL CITOSCHELETRO il citoscheletro dà forma alla cellula e le conferisce un impalcatura interna, sebbene non trabecolare rete microtrabecolare

IL CITOSCHELETRO il citoscheletro dà forma alla cellula e le conferisce un impalcatura interna, sebbene non trabecolare rete microtrabecolare IL CITOSCHELETRO Ipotetica ricostruzione tridimensionale delle interazioni tra citoscheletro e organelli cellulari (Porter et al., 1976) ottenuta da immagini al ME. Secondo questa ipotesi il citoscheletro

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

Immagini e concetti della biologia

Immagini e concetti della biologia Sylvia S. Mader Immagini e concetti della biologia 2 A3 Le molecole biologiche 3 Il carbonio è l elemento di base delle biomolecole Una cellula batterica può contenere fino a 5000 tipi diversi di composti

Dettagli

La vita e gli esseri viventi, la cellula. La vita e gli esseri viventi

La vita e gli esseri viventi, la cellula. La vita e gli esseri viventi il testo: 01 e gli esseri viventi La scienza che studia la vita e gli esseri viventi si chiama Biologia. Per capire cosa studia la Biologia dobbiamo sapere che un essere vivente ed un oggetto senza vita

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

Scheda di presentazione

Scheda di presentazione Scheda di presentazione TITOLO: Struttura e funzioni della cellula BREVE DESCRIZIONE DELL UNITÀ DI APPRENDIMENTO: in questa unità di apprendimento si vuole trattare lo studio della struttura e delle funzioni

Dettagli

SCHEDA DI PRESENTAZIONE

SCHEDA DI PRESENTAZIONE SCHEDA DI PRESENTAZIONE TITOLO: LA CELLULA EUCARIOTE BREVE DESCRIZIONE DELL UNITÀ DI APPRENDIMENTO: in questa unità di apprendimento si vuole trattare lo studio della cellula, la sua struttura e le funzioni

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

27/01/2012. Ciclo Cellulare. Biotecnologie 2011 M.G. Bottone

27/01/2012. Ciclo Cellulare. Biotecnologie 2011 M.G. Bottone Ciclo Cellulare Biotecnologie 2011 M.G. Bottone 1 FASI DEL CICLO CELLULARE INTERFASE (1) Il ciclo di divisione della maggior parte delle cellule eucariotiche è suddiviso in quattro fasi distinte: M, G

Dettagli

La cellula. La cellula.

La cellula. La cellula. La cellula La cellula è l unità biologica elementare che costituisce tutti gli esseri viventi: essa è la più piccola porzione di materia vivente in grado di vivere autonomamente. Ogni cellula, infatti,

Dettagli

STRUTTURA DELLA CELLULA

STRUTTURA DELLA CELLULA STRUTTURA DELLA CELLULA IL NUCLEO Il nucleo, presente unicamente nelle cellule eucariote è circondato dall involucro nucleare costituito, da due membrane separate e provvisto di pori. Esso contiene i cromosomi,

Dettagli

La cellula eucariotica e i suoi organuli (seconda parte)

La cellula eucariotica e i suoi organuli (seconda parte) Università di Ferrara Corso di Laurea in Scienze Motorie Primo anno di corso Corso di Biologia Applicata Lezione di Biologia Cellulare La cellula eucariotica e i suoi organuli (seconda parte) Dott.ssa

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) -traduzione e indirizzamento delle proteine MFN0366-A1 (I. Perroteau) -traduzione delle proteine trna Traduzione: mrna -------> proteine mrna MFN0366-A1 (I. Perroteau) -traduzione

Dettagli

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA

TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRASCRIZIONE DEL DNA, TRADUZIONE DELL RNA TRADUZIONE La traduzione e il processo con cui viene sintetizzata un data proteina, attraverso reazioni chimiche di polimerizzazione di amminoacidi, in una

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli