Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli"

Transcript

1 Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI

2 Cellula Interfasica Cromatina Nucleolo Involucro nucleare Doppia membrana Pori Matrice Nucleare /Nucleoplasma

3

4 Cromatina Associazione di DNA e proteine Responsabile della colorazione basofila [basofilia: colorazione di molecole biologiche acide (presenza di gruppi acidi) con coloranti basici] Proteine istoniche e non- istoniche Eterocromatina Cromatina Inattiva Eucromatina Cromatina Attiva

5 Cromatina Inattiva Eterocromatina Condensata, elettrondensa Facilmente osservabile in cellule che non sintetizzano attivamente proteine o che producono un numero ristretto di proteine Linfociti, spermatozoi, plasma cellule

6 Eterocromatina (H)

7 neuroni dei gangli spinali Cromatina rilassata DNA viene trascritto Eucromatina Colorazione chiara in Micr. ottica e elettr. Osservabile in cellule con attiva sintesi proteica Neuroni, Fegato

8 DNA nel nucleo: cromosomi Lunghe molecole lineari di DNA associate a proteine CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23 cromosomi viene dal padre e l altra serie di 23 cromosomi dalla madre Lunghezza di un cromosoma: Da 50 a 250 milioni di paia di basi (nucleotidi) Da 1,7 a 8,5 cm di lunghezza lineare Quindi in un nucleo (diametro medio 5-10 µm) ci sono circa 2 metri di DNA

9 Nucleosomi Otto molecole istoniche formano un ottamero 2 molecole di H2A 2 molecole di H2B 2 molecole di H3 2 molecole di H4 146 bp di DNA arrotolate intorno all'ottamero

10 Nucleosomi

11 Istone H1 Stabilizza il nucleosoma e il legame tra gli nucleosomi

12 Fibre di cromatina

13 Organizzazione del DNA in cromatina

14 Coinvolgimento di proteine non istoniche a formare un supporto che organizza le fibre di cromatina Video In interfase l eucromatina è nella forma di fibre da 30 nm, organizzati in anse contenenti circa 50 a 100 kb di DNA. Circa il 10% della eucromatina, contenente i geni attivamente trascritti, è in uno stato più decondensato (la conformazione a 10-nm) che ne consente la trascrizione.

15

16 Cromosomi mitotici Letteralmente, corpi colorati La cromatina si condensa in strutture discrete durante la mitosi

17 Cromosomi mitotici Centromero Restringimento +/- centrale DNA satellite, sequenze altamente ripetuto Cinetocore proteico

18 Territori Cromosomici in Interfase DNA dei diversi cromosomi è rilevato tramite ibridazione in situ

19 Corpi di Barr Cromosoma X inattivato nelle femmine Nella maggior parte dei nuclei, sembra una macchia a lato del nucleo Neutrofili, bacchetta di tamburo che penzola da uno dei lobi

20 Altri componenti del nucleo Il DNA costituisce solo il 20% del materiale nucleare, Inoltre il nucleo contiene: - RNA - una grande varietà di proteine, chiamate nucleoproteine. Tutte le nucleoproteine sono sintetizzate nel citoplasma e quindi trasportate nel nucleo.

21 Nucleoproteine associate al DNA Le proteine che legano il DNA sono di due tipi: 1) istoni 2) proteine non-istoniche Le proteine non-istoniche associate al DNA sono un gruppo eterogeneo di proteine che comprendono: - Proteine che organizzano la cromatina - Enzimi responsabili della replicazione del DNA e della sua riparazione - Enzimi responsabili della sintesi dell RNA. - Proteine che regolano l espressione dei geni.

22 RNA Vi sono tre principali tipi di RNA: - RNA messaggero - RNA di trasferimento - RNA ribosomiale L RNA nucleare è quello non ancora trasferito nel citoplasma

23 Trascrizione del DNA in RNA Il Nucleo permette di mantenere separate trascrizione e traduzione. Questo consente di regolare i due eventi in maniera indipendente e di modificare l RNA prima che venga tradotto, aumentando il numero di isoforme prodotte da un gene nucleo citoplasma

24 Trascrizione del DNA in RNA 1. La cromatina deve essere parzialmente decondensata per permette l accesso degli enzimi al DNA 2. La trascrizione è effettuata da enzimi denominati RNA polimerasi 3. La trascrizione è regolata da fattori positivi e negativi che legano sequenze regolative dei geni (promotori ed enhancer) 4. L RNA trascritto viene processato (modificazioni, splicing ) prima di essere esportato dal nucleo

25 1) La cromatina deve essere decondensata per permette l accesso degli enzimi al DNA Regolata da cambi nella Metilazione (metilasi), Fosforilazione (chinasi) ed Acetilazione (acetilasi) degli Istoni

26 2) Trascrizione Pol I: RNA ribosomiali, Pol II: RNA messaggeri, Pol III: RNA transfer e 5S ribosomiale

27 3) La trascrizione del RNA è regolata sia positivamente che negativamente da fattori trascrizionali. Questi fattori legano sequenze regolative presenti sul DNA in prossimità della porzione da trascrivere (promotori) o più distalmente (enhancer)

28 4) I RNA messaggeri trascritti vengono processati prima lasciare il nucleo Cappuccio al 5 Poliadenilazione al 3

29 Lo splicing dei RNA messaggeri Spliceosoma

30 Trascrizione dei mrna

31 Trascrizione e processamento dei RNA ribosomiali

32 Nucleolo Sintesi degli rrna Assemblaggio dei ribosomi Molto esteso nelle cellule con attiva sintesi proteica Es.: Cellule secretorie

33 Nucleolo - Masserella granulare e fibrillare dai contorni irregolari non rivestita da membrane - Costituito da parte fibrillare (DNA ed RNA: trascrizione) e parte granulare (RNA e proteine: assemblaggio)

34 Trascrizione dei RNA ribosomali e formazione dei ribosomi

35 Nucleoplasma o Spazio Intercromatinico Materiale interno all involucro nucleare ad esclusione di cromatina e nucleolo Costituito da Proteine, RNA, Metaboliti vari e Fibre che formano la matrice nucleare (una sorta di scheletro nucleare )

36 Involucro Nucleare Doppia membrana con spazio intermembrana Continuo con il RER, da cui si forma Lamina Fibrosa All interno della membrana nucleare Composta da Lamine Filamenti Intermedi classe V Connessa alle fibre della matrice nucleare

37 Lamina Nucleare e Matrice Nucleare

38 Esterno Pori Nucleari Interno

39 Aperture di nm Trasporto nucleocitoplasma bidirezionale Molecole grandi (>40 Kda) richiedono meccanismi ATP dipendenti per passare Pori Nucleari

40 Pori Nucleari Struttura molto complessa costituita da 50 proteine diverse Nucleoporine: Subunità ad anello Bracci Proteine di ancoraggio Fibre e cesto di fibre Trasportatore

41 Movimento di proteine dal citosol al nucleo Importine

42 Movimento di RNA e proteine dal nucleo al citosol Esportine

43 L attività di importine ed esportine è regolata dalla proteina G Ran. Il legame a RanGTP permette il rilascio dal cargo dalle Importine, mentre le Esportine necessitano di RanGTP per legare il cargo da esportare.

44 Differenze nei Nuclei di diversi tipi cellulari

45 Eritrociti Cellule senza Nucleo Globuli Rossi Nucleo espulso durante l eritropoiesi Non si dividono Pochi altri organelli Diametro di 8-10 µm

46 Piastrine Formate mediante trombopoiesi Residui della rottura dei Megacariociti Dimensione µm Hanno mitocondri, microtubuli, glicogeno, golgi, lisosomi, granuli specifici per la loro funzione Non si possono dividere

47 Cellule Multinucleate Muscolo Scheletrico Mioblasti > Miotubi Sincizi di centinaia di cellule Centinaia di nuclei nella cellula matura (fibra) Non possono dividersi Nuclei localizzati perifericamente Muscolo cardiaco solo 1 o 2 nuclei

48 Osteoclasti Tessuto Osseo in riassorbimento Cellule attive con molti lisosomi Originano dalla fusione di Monociti e Macrofagi Monociti sono precursori dei Macrofagi Macrofagi fagociti professionali e cellule presentati gli antigeni 5-50 nuclei

49 Cellule Multinucleate derivanti da divisione incompleta della cellula (plasmodi) Epatociti Possono essere binucleati A volte 1 nucleo con un numero di cromosomi superiore a 2n e molti nucleoli Si possono in seguito dividere per Mitosi

50 Epiteli di transizione Megacariociti Fino a 64x il numero di cromosomi Divisione incompleta dei nuclei Precursori delle Piastrine

51 Nuclei singoli Multi-lobati non sono frutto di divisioni incomplete Leucociti Polimorfonucleati (PMNs) Globuli bianchi granulari Neutrofili, Eosinofili e Basofili Derivano da una cellula staminale con nucleo più grande Granulopoiesi Forma matura non richiede nucleo così grande Si condensa e forma lobi» 5 lobi in neutrofili» 2 lobi in eosinofili e basofili

52 Neutrofili Basofili Eosinofili

53 Linfociti Nuclei caratteristici Globuli bianchi più piccoli Nucleo rotondo e denso Citoplasma scarso Monociti Nucleo a ferro di cavallo o fagiolo Precursori dei macrofagi

54 Adipociti (bianchi) Nucleo e citoplasma schiacciati alla periferia

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI

Nucleo. Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Nucleo Compartimento limitato da membrana che contiene il materiale genetico L organello più grande Solo negli EUCARIOTI Cellula Interfasica Cromatina Nucleolo Involucro nucleare Pori Matrice Nucleare

Dettagli

Citologia del nucleo

Citologia del nucleo 1 Citologia Animale e Vegetale (corso A - I. Perroteau) - il nucleo Citologia del nucleo Il nucleo è facilmente evidenziabile in una cellula tuttavia... Può avere aspetti diversi Non è presente durante

Dettagli

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - il nucleo. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita 1 Cosa contiene il nucleo? Il nucleo non contiene solo DNA, che costituisce solo il 20% del materiale nucleare, ma anche una grande quantità di proteine chiamate nucleoproteine ed RNA. La maggior parte

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

La cellula eucariotica animale

La cellula eucariotica animale Tutte le cellule sono circondate da una membrana plasmatica costituita da fosfolipidi e proteine. Le cellule eucariotiche posseggono organuli rivestiti di membrana. L organulo di dimensioni maggiori è

Dettagli

ISTOLOGIA UNIPG. Il nucleo

ISTOLOGIA UNIPG. Il nucleo Il nucleo IL NUCLEO Nelle cellule eucariotiche c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola di cui

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria cellulare (Schleiden e

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

NU PORO NUCLEARE RER

NU PORO NUCLEARE RER il Nucleo Il nucleo è un organulo che si trova all'interno della cellula ed è sede di importanti reazioni. Il suo scopo è quello di contenere gli acidi nucleici, provvedere alla duplicazione del DNA, alla

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

Biologia generale Prof.ssa Bernardo

Biologia generale Prof.ssa Bernardo Cellula procariotica cellula eucariotica CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica,

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali

3. Citologia i. Strutture cellulari comuni tra cellule animali e vegetali Strutture cellulari comuni tra cellule animali e vegetali: CITOPLASMA CITOSCHELETRO RIBOSOMI RETICOLO ENDOPLASMATICO APPARATO DEL GOLGI MITOCONDRI NUCLEO PEROSSISOMI CITOPLASMA materiale gelatinoso incolore

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm)

IL NUCLEO. A) Fibre di cromatina di nm. B) Dopo ulteriore stiramento (10 nm) Il nucleo IL NUCLEO IL NUCLEO Nelle cellule eucariote c è il nucleo, una sferetta formata da una membrana che contiene acidi nucleici (DNA o acido desossiribonucleico; RNA; proteine) Il DNA è la molecola

Dettagli

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per:

L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: Differiscono tra loro per: Nucleo L unità fondamentale di tutti gli esseri viventi è la CELLULA. Condividono tre elementi: 1. Citoplasma 2. Materiale Genetico 3. Membrana Plasmatica Differiscono tra loro per: Forma Dimensione Funzione

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle

DOGMA CENTRALE DELLA BIOLOGIA. Secondo il dogma centrale della biologia, il DNA dirige la. sintesi del RNA che a sua volta guida la sintesi delle DOGMA CENTRALE DELLA BIOLOGIA Secondo il dogma centrale della biologia, il DNA dirige la sintesi del RNA che a sua volta guida la sintesi delle proteine. Tuttavia il flusso unidirezionale di informazioni

Dettagli

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA

La struttura del DNA. Il favoloso viaggio alla scoperta del DNA La struttura del DNA Il favoloso viaggio alla scoperta del DNA Crick et Watson, 1953 Scoperta della struttura del DNA DNA= POLIMERO DI NUCLEOTIDI Ci sono 4 tipi di nucleotidi : A, T, C e G Come sono attaccati

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

espressione genica processo attraverso cui l informazione di un gene viene decodificata

espressione genica processo attraverso cui l informazione di un gene viene decodificata espressione genica processo attraverso cui l informazione di un gene viene decodificata regolazione o controllo dell espressione genica meccanismi mediante i quali un gene viene selettivamente espresso

Dettagli

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita

E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la vita Costituita da proteine, acidi nucleici, carboidrati e lipidi Si differenzia tra eucarioti e procarioti E la più piccola struttura di un organismo in grado di effettuare quei processi che definiscono la

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza

Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza Relazioni evolutive tra i viventi. Le distanze tra le ramificazioni sono proporzionali alla entità della differenza LUCA: Last Universal Common Ancestor 1 µm ARCHAEA La morfologia e le dimensioni degli

Dettagli

FORMAZIONE DEL LEGAME PEPTIDICO

FORMAZIONE DEL LEGAME PEPTIDICO AMINOACIDI FORMAZIONE DEL LEGAME PEPTIDICO SEQUENZA AMINOACIDICA DELL INSULINA STRUTTURA SECONDARIA DELLE PROTEINE STRUTTURA TERZIARIA DELLE PROTEINE STRUTTURA QUATERNARIA DELLE PROTEINE Definizione Processi

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita Prof.ssa Flavia Frabetti La cellula è l unità strutturale e funzionale degli organismi viventi. Struttura minima in grado di compiere tutte le attività minime della vita. Teoria

Dettagli

IL GENOMA DELLA CELLULA VEGETALE

IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote

Nucleo 27/01/2012 NUCLEO. Biotec 2011 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote Nucleo Biotec 2011 Nucleo Organello che contiene il materiale genetico di una cellula eucariote NUCLEO INVOLUCRO NUCLEARE Il nucleo é il centro informazionale di una cellula eucariotica. L involucro nucleare

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare

Principi di Citologia e Istologia. Prof. Pucci, Il compartimento nucleare Principi di Citologia e Istologia. Prof. Pucci, 2003 Il compartimento nucleare Il Compartimento Nucleare Il compartimento nucleare è caratteristica propria degli eucarioti. Il compartimento consiste delle

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

Viaggio al centro della cellula

Viaggio al centro della cellula Viaggio al centro della cellula I segreti del nucleo Anna Maria Rossi Dip. di Biologia - Genetica Interfase Profase Metafase Durante la mitosi possiamo osservare notevoli cambiamenti nella struttura del

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

- In che modo questi segnali dirigono il trasporto della proteina al compartimento di destinazione?

- In che modo questi segnali dirigono il trasporto della proteina al compartimento di destinazione? PRINCIPI GENERALI DELLO SMISTAMENTO DELLE PROTEINE - Dove risiede l informazione per la corretta localizzazione di una proteina? - In che modo questi segnali dirigono il trasporto della proteina al compartimento

Dettagli

LA TRASCRIZIONE...2. Terminazione della trascrizione...10

LA TRASCRIZIONE...2. Terminazione della trascrizione...10 LA TRASCRIZIONE...2 INDUZIONE ENZIMATICA...3 Organizzazione geni dei procarioti...4 Organizzazione geni degli eucarioti...5 Sequenze dei Promotori dei procarioti...6 Sequenze dei Promotori degli eucarioti...6

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

CICLO CELLULARE MITOSI MEIOSI

CICLO CELLULARE MITOSI MEIOSI CICLO CELLULARE Processo con il quale le cellule si dividono e si moltiplicano, duplicando le informazioni genetiche racchiuse nel loro nucleo. Nella specie umana, dall uovo fecondato hanno origine circa

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore

Il genoma dei batteri è organizzato in operon. Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore Il genoma dei batteri è organizzato in operon Un operon è una unità trascrizionale indipendente, formata da (2-15) geni regolati da un solo promotore I geni di un operon sono diversi, ma concorrono allo

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

Nucleo 14/01/2013 NUCLEO. Biotec 2012 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote

Nucleo 14/01/2013 NUCLEO. Biotec 2012 INVOLUCRO NUCLEARE. Nucleo Organello che contiene il materiale genetico di una cellula eucariote Nucleo Biotec 2012 Nucleo Organello che contiene il materiale genetico di una cellula eucariote NUCLEO INVOLUCRO NUCLEARE Il nucleo é il centro informazionale di una cellula eucariotica. L involucro nucleare

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

Lezione 3. Dentro la cellula eucariote. Bibliografia. I colori della biologia. Giusti Gatti Anelli. Ed. Pearson

Lezione 3. Dentro la cellula eucariote. Bibliografia. I colori della biologia. Giusti Gatti Anelli. Ed. Pearson Lezione 3 Dentro la cellula eucariote Bibliografia I colori della biologia Giusti Gatti Anelli Ed. Pearson Quali sono la struttura e le funzioni della membrana plasmatica? Qual è la funzione del nucleo?

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

I leucociti o globuli bianchi sono cellule coinvolte nella risposta immunitaria. Grazie al loro intervento il corpo umano si difende dagli attacchi

I leucociti o globuli bianchi sono cellule coinvolte nella risposta immunitaria. Grazie al loro intervento il corpo umano si difende dagli attacchi GLOBULI BIANCHI I leucociti sono cellule del sangue provviste di nucleo e si trovano nel circolo sanguigno, nel sistema linfatico e nei tessuti. La loro caratteristica assenza di pigmentazione gli conferisce

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005

GENETICA Pierce, GENETICA, Zanichelli editore S.p.A. Copyright 2005 GENETICA Tutti gli organismi utilizzano gli acidi nucleici come materiale genetico e tutti codificano le proprie informazioni genetiche con le medesime modalità. La serie completa di istruzioni

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

Progressivo passaggio da organizzazione unicellulare a organizzazione coloniale e pluricellulare

Progressivo passaggio da organizzazione unicellulare a organizzazione coloniale e pluricellulare LA CELLULA unità morfo-funzionale elementare di tutti gli organismi capaci di vita autonoma: unicellulari, pluricellulari in colonie, pluricellulari organizzati in tessuti o pseudotessuti, animali, vegetali

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Introduzione al Citoscheletro

Introduzione al Citoscheletro http://zeiss-campus.magnet.fsu.edu/galleries/cells/index.html Le cellule animali sono cellule eucariotiche caratteristiche, racchiuse da una membrana plasmatica e contenenti un nucleo circondato da una

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

La trascrizione del DNA

La trascrizione del DNA La trascrizione del DNA I prodotti iniziali dei geni consistono in molecole di Acido Ribonucleico Dogma centrale DNA RNA polipeptide RNA/DNA Proprieta dell RNA - Prodotto a partire dal DNA stampo (trascrizione)

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti

Dettagli

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule.

CELLULA. La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. LA CELLULA CELLULA La cellula è la più piccola unità di un organismo in grado di funzionare in modo autonomo. Tutti gli esseri viventi sono formati da cellule. CELLULA La teoria cellulare Le cellule furono

Dettagli

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI

BIOLOGIA MOLECOLARE DEGLI EUCARIOTI UNITÀ BIOTEC. DIDATTICA DI ELEMENTI DI BIOLOGIA MOLECOLARE BIOLOGIA MOLECOLARE DEGLI EUCARIOTI Roberto Giacominelli Stuffler 1. I geni ed il DNA degli eucarioti 2. La replicazione, la trascrizione e la

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Modificazioni istoni.

Modificazioni istoni. Modificazioni istoni. Attivazione della trascrizione Attivatori Attivatori Il complesso proteico attivatore della trascrizione recluta l enzima RNA polimerasi ed i suoi cofattori a livello della regione

Dettagli

La chimica della vita

La chimica della vita La chimica della vita Ogni organismo vivente è una macchina sofisticata, risultato di un complesso insieme di reazioni chimiche. La costruzione e il funzionamento di questa macchina si devono all'esistenza

Dettagli

Botanica e Diversità Vegetale. AA canale O-Z

Botanica e Diversità Vegetale. AA canale O-Z Botanica e Diversità Vegetale AA 2016-2017 canale O-Z IL NUCLEO Nelle cellule degli Eucarioti si sono evoluti meccanismi perfezionati di sintesi proteica e di EQUA distribuzione del materiale genetico

Dettagli

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich.

I cromosomi. I cromosomi. Modello di Saitoh and Laemmli. Anse piccole scaffold Banda G Banda R Banda G Anse grandi. SARs AT-rich. I cromosomi I cromosomi 1400 nm Modello di Saitoh and Laemmli Anse di cromatina piccole o lunghe G loops R loops G loops R loops Protein scaffold SARs AT-rich Scaffold AT-queue Chromatid fibers Anse piccole

Dettagli

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo

Dettagli

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU)

Biol Cell Anim BIOTEC Esempi di Testi da utilizzare (sono equivalenti) Unità didattica: Biologia della Cellula Animale (6 CFU) http://www 3.unipv.it/webbio/anatcomp/freitas/freitas.html Insegnamento Biologia della Cellula Animale e Vegetale (9 CFU) Unità didattica: Biologia della Cellula Animale (6 CFU) Esempi di Testi da utilizzare

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione

MUTAZIONI. -Spontanee. -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione MUTAZIONI -Spontanee -appaiamenti vacillanti*, depurinazione, deaminazione e sequenze ripetute portano ad errori durante la replicazione -errori durante il riparo -errori durante la meiosi -Indotte -agenti

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

Mitocondri Le centrali energetiche della cellula

Mitocondri Le centrali energetiche della cellula Mitocondri Le centrali energetiche della cellula I mitocondri sono presenti in tutte le cellule eucariotiche, ad eccezione dei globuli rossi dei mammiferi. Sono organelli membranosi allungati che forniscono

Dettagli

Lezione 6 - Trascrizione del DNA

Lezione 6 - Trascrizione del DNA Lezione 6 - Trascrizione del DNA 1. Flusso dell informazione genetica 2. RNA polimerasi 3. Siti di inizio e fine trascrizione 4. Reazione 5. Differenze tra procarioti ed eucarioti 6. Enhancer 7. Maturazione

Dettagli

L esperimento di Griffith sulla trasformazione genetica in pneumococco.

L esperimento di Griffith sulla trasformazione genetica in pneumococco. L esperimento di Griffith sulla trasformazione genetica in pneumococco. La natura chimica del materiale genetico ACIDI NUCLEICI DNA : deposito informazioni RNA: a) espressione informazione (es. sintesi

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita Prof.ssa Flavia Frabetti aa. 2010-11 La cellula è l unità strutturale e funzionale degli organismi viventi La cellula presenta tutte le proprietà elettive dei viventi: auto-regolazione

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

E noto che gli organismi viventi sono costituiti da cellule e che: La cellula è l unità fondamentale dei viventi. Tuttavia questa asserzione riguarda

E noto che gli organismi viventi sono costituiti da cellule e che: La cellula è l unità fondamentale dei viventi. Tuttavia questa asserzione riguarda LA CELLULA E noto che gli organismi viventi sono costituiti da cellule e che: La cellula è l unità fondamentale dei viventi. Tuttavia questa asserzione riguarda l inizio dei ragionamenti che hanno portato

Dettagli

LE TECNICHE PER LO STUDIO DELLA CELLULA

LE TECNICHE PER LO STUDIO DELLA CELLULA LE TECNICHE PER LO STUDIO DELLA CELLULA Potere risolutivo: minima distanza alla quale due punti possono essere distinti OCCHIO UMANO = 100 m (0,1 mm ) MICROSCOPIO OTTICO = 0,2 m MICROSCOPIO ELETTRONICO

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si

Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si LA CELLULA Tutti gli esseri viventi sono costituiti da unità elementari chiamate cellule Ogni cellula possiede tutte le caratteristiche degli esseri viventi: si nutre, respira, scambia sostanze con l ambiente

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

21. Regolazione dell espressione genica

21. Regolazione dell espressione genica 21. Regolazione dell espressione genica contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le cellule di un organismo pluricellulare

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

Tutta la vita cellulare ha le seguenti caratteristiche in comune. tutte le cellule hanno una membrana cellulare che separa il liquido extracellulare

Tutta la vita cellulare ha le seguenti caratteristiche in comune. tutte le cellule hanno una membrana cellulare che separa il liquido extracellulare Tutta la vita cellulare ha le seguenti caratteristiche in comune. tutte le cellule hanno una membrana cellulare che separa il liquido extracellulare dal citoplasma cellulare che ha un alto grado di organizzazione.

Dettagli

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA

La trascrizione. La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA LA TRASCRIZIONE La trascrizione La trascrizione è la sintesi delle molecole di RNA sulla base di un filamento stampo di DNA Le caratteristiche dell RNA La costituzione a singolo filamento permette alle

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli