Replicazione in vivo Meccanismo biochimico Enzimi Origini di replicazione. Replicazione in vitro Meccanismo biochimico (idem) Enzimi Primer

Transcript

1 La replicazione del DNA Replicazione in vivo Meccanismo biochimico Enzimi Origini di replicazione Replicazione in vitro Meccanismo biochimico (idem) Enzimi Primer Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

2 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005 Colcofluor stained yeast cells A T C G C T G C T A G C G A C G A C A T A T C G C T G T A T A G C G T A T C G C A T A G C G

3 Replication: in vivo e in vitro : identical biochemical mechanism Synthesis requires a «primer», i.e. a piece of DNA in double strand form Annealed primer Growing 3 end of DNA Template strand Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

4 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

5 DNA Polymerase enzyme is extremely accurate

6 DNA Polymerase - movie

7 Precisione di base: 1*10E-04 Attività di proof-reading 1*10^-07

8 Direzione di sintesi: unicamente 5 3 I due filamenti sono antiparalleli Vengono replicati contemporaneamente Come è possibile? Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

9 Primase direction of leading strand syntesis by DNA polymerase replication RNA primer Okazaki fragments DNA Polymerase direction of lagging strand syntesis by DNA polymerase The enzyme Primase synthesizes short RNA primers (green) at a fixed distance, following the sliding of the leading strand Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

10 free 3 -end here Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

11 Svolgimento: DNA elicasi Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

12 Filmato movie

13 Origini e terminazioni Origine di replicazione (o replicatore) Proteina che riconosce l origine

14 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

15 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

16 Two replication forks take off from origin Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

17 Bacteria (e.g. E. coli) often possess circular DNA (circular chromosome). The same is true for organelle DNA of eukaryotic cells (e.g. mitochondria). When replication is complete, the two daughter molecules need to be separated. The enzyme doing this is called Topoisomerase II. Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

18 E.coli ha un unico cromosoma circolare di circa 6x10 6 bp

19 Eukaryotes have linear chromosomes that are replicated using multiple replication origins. Some of these origins can be either active or replicated passively.

20 Il problema dei telomeri (estremità dei cromosomi) Telomerasi (solo cellule linea germinale, embrionali staminali e tumorali) Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

21 La Telomerasi è un enzima fatto di proteina +RNA Parte dell RNA serve da stampo per la sintesi di ripetizioni telomeriche, con spostamento successivo della Telomerasi stessa di volta in volta verso il 3 Per gli appassionati di origini della vita ed RNA world, questo potrebbe essere un fossile molecolare di una RNA Replicasi primordiale Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

22 da Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

23 Replicazione in vitro : Meccanismo biochimico Desossiribonucleotidi trifosfato primer DNA Polimerasi simpler is better Stampo (template)

24 Vertebrate DNA: 3-4 x 10 9 bp If we to isolate a fragment 3-4 Kbp in length: 1 / 1 million I.e. if we take 1 g DNA 1pg of our desired fragment The sole property that could identify my fragment is: its sequence L essenza di tutte le tecnologie del DNA ricombinante è di poter disporre di una grande quantità di copie (infinite) del frammento di DNA che si vuole studiare ed utilizzare

25 Una notevole semplificazione del cloning si ha quando si conosce già a priori tutta o parte della sequenza del gene o del cdna che si desidera clonare. In questo caso si può applicare la tecnica chiamata PCR ( Polymerase Chain Reaction ) che consente di produrre un numero teoricamente infinito di copie della stessa sequenza di DNA ( bersaglio ) in provetta

26 La reazione a catena della Polimerasi (PCR) Si basa sulla esecuzione ciclica ripetuta più volte delle fasi di: - denaturazione - annealing (o ibridazione) di un oligonucleotide specifico (primer) - estensione (cioè la sintesi del DNA complementare allo stampo) utilizzando 2 primers complementari alla sequenza estreme ( a sinistra e a destra) del pezzo di DNA che si desidera amplificare. Poiché la denaturazione richiede alte temperature, la tecnica richiede un enzima termoresistente: La Taq DNA Polimerasi (dell organismo termofilo T. acquaticus)

27 5..aggtcatccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcatgca 5 5 -catccgtta-3 3 -ggctagcat-5 5..aggtcatccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3 -ggctagcat-5 5 -catccgtta-3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcatgca 5

28 5..aggtcatccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3 -ggctagcat-5 5 -catccgtta-3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcatgca 5 5..aggtcatccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcat-5 5 -catccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcatgca 5

29 5 -catccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3 -ggctagcat-5 5 -catccgtta-3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcatgca 5 5..aggtcatccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3 -ggctagcat-5 5 -catccgtta-3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcat-5 5 -catccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3 -gtaggcaatagatctgtattatctagatctagcaggctagcat-5 5 -catccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcatgca 5 5..aggtcatccgttatctagacataatagatctagatcgtccgatcgtacgt 3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcat-5 5 -catccgttatctagacataatagatctagatcgtccgatcgta-3 3..tccagtaggcaatagatctgtattatctagatctagcaggctagcat-5

30 Il funzionamento della PCR PCR movie 1 Specie molecolari PCR movie 2

31 DNA ottenuto mediante amplificazione con PCR - Elettroforesi su gel di agaroso + frammenti di DNA di lunghezza nota

32 Start with DNA from mouse cells in culture Extract DNA: you obtain copies of your target, together with of any other piece of DNA. Assuming your target: bp and the mouse genome 3x10 9 bp, you have a relative abundance o 1:3x10E 6, i.e. 1 copy in 3 millions unrelated sequences. Make a PCR of your fragment, 30 cycles. You obtain theoretically x x molecules of your target, and you still have the original molecules of any other sequence. The relative abundance is now 2x10 14 :2x10 5 = 10 9 You obtain a one billion prevalence of your sequence over any other unrelated sequence.

33 Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

34 L2.2 Transcription & translation The genome copier

35 coding strand 5 - AATCTGTTAATCATGAAGGTACCTTAG TTAGACAATTAGTACTTCCATGGAATC -5 DNA template strand 5 - AAUCUGUUAAUCAUGAAGGUACCUUGG -3 RNA NH 2 -..N L L I M K V P W -COOH protein DNA is double-stranded, but since one filament is coding, we can represent it as a single sequence

36 RNA polymerases from: a) Thermus aquaticus b) Saccaromyces cerevisiae Different colors refer to different subunits, colors are kept the same for subunits showing homology in the two proteins.

37 RNA synthesis (biochemistry) DNA template

38 Trascrizione Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

39 RNA Polimerasi Movie is available (Moodle) Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

40 transcription Promoter PROMOTORE TSS 5 UTR) Trascrizione Coding sequence 5 ---TGCATTCAGGCTGTAGCTTCTTGGCTGGTCCATCGTTCATGCATGACTGGGTCATGCATGCT 3 ---ACGTAAGTCCGACATCGAAGAACCGACCAGGTAGCAAGTACGTACTGACCCAGTACGTACGA DNA RNA (primary transcript) 5 -AGCUUCUUGGCUGGUCCAUCGUUCAUGCAUGACUGGGUCAUGCAUGC Regione non tradotta 5 -UTR (5 untranslated region) (detta anche leader) 1 codone: N-terminale del peptide (Può essere centinaia di bp)

41 concetto di sequenza consenso transcription start site TSS Upstream Promoter element allineamento di diversi geni

42 «Promotori» i promotori nei procarioti (E. coli)

43 Sigma subunit (σ) allows RNA Polymerase of bacteria to recognize promoter sequence

44

45 Termination of transcription is determined by special sequences that form a «stem-loop» structure

46 Terminators are usually followed by a «U» stretch that allows easy dissociation of RNA from the template

47 Termination is a special case of pause self-complementary sequences that can form a hairpin followed by a strecht of UUUUU

48 Promotori Eucarioti promotori degli 1 ) Promotori di tipo «TATA-plus» a unico TSS (transcription start site) 1 ) Promotori di tipo «GC-rich» con TSS mutipli Regione ricca di «CG» Sequenza propria

49

50 movie TBP TBP

51 Al contrario dei Procarioti, dove di solito i geni presentano una sequenza codificante continua, negli Eucarioti (e sempre in aumento con la scala evolutiva) i geni contengono sequenze codificanti discontinui Ovvero Le sequenze codificanti sono intervallate da sezioni non codificanti che si chiamano «introni» Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

52 3 utr

53 heterochromatin K hm reprogramming euchromatin Nc gene C gene K tc pre-ncrna K tc pre-mrna transcription processing & transport K pr ncrna K pr K dr mrna K tl Localization, translation folding & modifications K dr degraded degraded peptide K pd K pt protein K a degraded

54 Gene Trascritto primario 5 -capping Splicing / Alternative splicing polyadenylation Other processing RNA maturo measure degradazione Transport Localization Protein-guided degradation (exosome) RNA-guided degradation

55 guanine-n7- methyltransferase Elongation factor EJC deposited nt upstream the exon-exon junction Splicing factors and snrnps are replaced by the EJC (exon junction complex) proteins From Aguilera 2005, Curr Op Cell Biol, 17:242.

56 Proteins necessary for mrnp transport through the nuclear pores are also charged to RNA during transcription Fig. 1 Schematic view of the nuclear side of eukaryotic gene expression, from transcription to nuclear export. NPC Nuclear pore complex, CTD C-terminal domain of Rpb1, RNAPII RNA polymerase II.

57 Esistono due forme di splicing un po diverse: la prima si riferisce ad un sottotipo di introni detti AT- AC dai dinucleotidi di confine, molto poco frequenti, che hanno snrnp dedicate. La seconda è detta trans-splicing ed è un fenomeno (raro?) in cui un esone presente in un pre-mrna viene ligato ad un altro esone presente in un secondo pre-mrna

58 Costitutivo: snrnp (U1,U2) Siti di splicing «conservati» Alternativo: elementi cis (ESE, ESS, ISE, ISS) riconosciuti da SR, hnrnp, Attivatori, Repressori Basics of the mechanisms of alternative splicing. (a) The architecture of a pre-mrna and the important cisacting sequence elements that direct the splicing reaction. The consensus sequences for the 50 splice site, branchpoint and 3 splice site for human introns is shown. (b) Schematic diagram of the sequences and proteins involved in regulating alternative splicing. Four types of regulatory sequences are known: intronic splicing enhancers (ISEs), intronic splicing silencers (ISSs), exonic splicing enhancers (ESEs) and exonic splicing silencers (ESSs). The enhancer elements are recognized by activator proteins. Within exons, these activators are most commonly members of the SR protein family. The silencer elements are bound by repressor proteins. Within exons, these repressors tend to be members of the hnrnp protein family. Regardless of their binding location, activators tend to enhance the binding of spliceosomal components to the regulated splice site while repressors tend to inhibit binding or function of the spliceosomal components.

59 Eucarioti: Durante la trascrizione (sintesi di RNA) l RNA trascritto primario viene modificato da enzimi che viaggiano insieme alla RNA Polimerasi II 5 -capping Exon splicing 3 polyadenylation Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005

60 Modificazione 5 con funzioni principali di protezione = «capping» Comune a tutti gli eucarioti

61 Terminazione negli eucarioti Non esiste una vera e propria terminazione. Il trascritto viene tagliato in corrispondenza di una sequenza specifica La trascrizione continua, ma dato che l RNA tagliato non ha «cap» viene degradato e fermato Modificazione al 3 Poli-adenilazione (in media circa 200 A ) Quasi tutti gli RNA messaggeri (ovvero codificanti proteine) ma anche alcuni altri tipi di RNA Vi sono alcuni RNA messaggeri che non hanno poliadenilazione, per es. quelli che codificano gli istoni (componenti dei nucleosomi, vedi più avanti).

62

63 La traduzione ORF (open reading frame)

64 leader Coding sequence Tail 5 -UTR Cds / ORF Sempre multiplo di 3 3 -UTR

65

66 The Genetic Code

67 trna

68

69

70

71 Aminoacyl-tRNA Synthetase

72

73 ribosomi

74

75 poliribosoma

76

77

78

79 Solo procarioti

80 Il primo aminoacido è sempre metionina procarioti

81

82 corretto scorretto

83

84 Terminazione con Releasing Factors Quando nel sito A c e uno dei te codoni di STOP, non c è alcun trna appaiabile. Nel sito A entra allora una proteina chiamata Releasing Factor

85 che appaia al codone di stop una sorta di anticodone peptidico (glicinaglicina-glutamina in questo modello).

86 Solo Procarioti: co-traduzione

87 Eucarioti trasporto nucleo citoplasma Proteine di testa e di coda ciclizzano il complesso

88 The Genetic Code

89 Regolazione trascrizionale

90 genome transcriptome Noncoding RNA mrna rrna trna snrna snorna Etc. Long noncoding Small RNA proteins

91 Is the transcriptome «regulated»? Quantitatively? Qualitatively? YES!

92 Saccaromyces cerevisiae nitrogen-deficient medium induces sporulation

93

94 Samples: Cells collected at 0 hours 0.5 hours 2 hours 5 hours 7 hours 9 hours 11 hours after induction Reference sample is 0 hour sample.

95 From Chu, 2008

96 Procarioti L operone mrna policistronico 5 3 Gene 1 Gene 2 Gene n Coda 3 Promotore operatore leader Inizio di trascrizione terminatore ATG 1 st codon Stop codon

97 Un cambiamento allosterico. Il repressore di Lac lega l induttore: l effetto allosterico è l allontanamento dei domini che permettono l interazione con il DNA

98 Procarioti I repressori agiscono sempre impedendo l ingresso della RNA Polimerasi RNA Pol R

99 Procarioti Example: The E. coli lactose operon

100 Eucarioti 2 problemi Nucleo (necessità di trasduzione) Il DNA non è nudo ma è organizzato in struttura complessa cromatina Necessità di regolare l accessibilità del DNA alla RNA Polimerasi ed ai fattori regolatori

101 Eukaryotes The default status for all the genes is the REPRESSED status. This is because all the DNA is chromatinized, i.e. it is tightly wrapped around nucleosomes. In this condition, the DNA is not accessible to Transcription Factors and to RNA Polymerase. Eterocromatina in bianco

102

103

104 Histone H4 HCH 3 C=O CH 3 Acetyl-Lys HCH 3 Methyl-Arg

105

106 Un-acetylated histone tails have positive charges Acetylated histone tails have no positive charge La modificazione più dinamica, legata all attivazione della trascrizione, è l acetilazione degli istoni nucleosomali nell intorno del promotore del gene

107 RNA molecules being synthesized RNA Polymerase Heterochromatic, silenced region: very compacted chromatin nucleosomes

108 Secondo problema: Gli eucarioti (e man mano sempre di più salendo la scala evolutiva ed organizzativa) devono integrare numerosi segnali cellulari nel controllo dei geni.

109 prokaryotes + - up P O transcribed unit eukaryotes Cn C4 C3 C2 C1 P transcribed unit Molti elementi cis- di regolazione ciascuno dei quali lega una specifica proteina regolatrice (fattori di trascrizione regolatori)

110 In prokaryotes, there are a limited number of repressors (and activators) that regulate one or few related operons. In Eukaryotes, there are hundreds to thousands transcription factors (activators and repressors) that regulate thousands of genes by a combinatorial mechanisms Gene A Gene C 5 3 Gene B Gene D

111 Most of eukaryotic genes contains regulatory elements not only in the proximal region, but also in distal position (up to tens of Kbp away, upstream or downstream, as well as in introns. These regulatory units are called enhancers. Eukaryotes Upstream enhancer Downstream enhancer Distal elements Proximal elements P Transcribed sequence

112 Each cis element has the potential to bind a specific transcription factor PIC P Transcribed sequence Each bound protein contributes its own regulatory activity to the gene. The result in terms of gene regulation is the sum of all specific contributions by the bound transcription factors.