CICLO CELLULARE EUCARIOTICO

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "CICLO CELLULARE EUCARIOTICO"

Transcript

1 CICLO CELLULARE EUCARIOTICO COMPESSO SISTEMA DI CONTROLLO OMEOSTASI ORGANISMO NORMALE G 0 CANCRO

2 DNA marcato con molecole intercalanti fluorescenti

3 Fluorescence Activated Cell Sorting (FACS) Rilevazione qualitativa e quantitativa CARICA SORTING

4 CHECK-POINTS: CONTROLLI DI TIPO QUALITATIVO (SI / NO) CONTROLLI DI TRANSIZIONE G2 / M E METAFASE / ANAFASE Procede tutto bene? Possiamo continuare? NO?? Possiamo farci qualcosa? G 0 CONTROLLO TRANSIZIONE G1 S La cellula può duplicarsi? NO? G 0 problemi risolvibili? SI NO PROLIFERAZIONE APOPTOSI (PCD)

5 Ser-Thr kinases Attivate dalla interazione con ciclina. Fosforilazione di substrati specifici G1 LA QUANTITA DI CICLINE VARIA LE CDK SEMPRE PRESENTI APC/C Anafase Promoting Complex elimina le cicline S e M G1-Cdk

6 Meccanismo di ATTIVAZIONE Intervento di un altra chinasi 1 2 AZIONE SU SUBSTRATI SPECIFICI Ansa T Meccanismi di INIBIZIONE Interazione con proteine inibitorie fosforilazione

7 APC/C Anafase Promoting Complex Degrada proteine nucleari (securina) rendendo possibile la separazione dei cromatidi. Degrada Cicline S e M Degradazione cicline S e M Inattivazione Cdk APC/C G1-Cdk

8 Parametri di controllo Check point start

9 Parametri di controllo INIBITORI DEI COMPLESSI CICLINA/Cdk Check point start

10 INDUZIONE della FASE S Aumento di S-Cdk attive ORC sempre legato all origine La fosforilazione di ORC previene il re-inizio GEMININ è bersaglio di APC/C Eliminato solo a mitosi iniziata

11

12

13 S-Cdk stimola fortemente la sintesi degli ISTONI

14 Replicatori multipli in cromosoma eucariotico Pre-RC NON si riforma Replicazione Passiva Pre-RC Eliminato Ricostituzione Pre-RC

15

16 MITOSI

17 Primo Check point INDUZIONE della MITOSI cromatide Secondo Check point cetromero Ciclina M M-Cdk attiva APC/C G1-Cdk

18 Check point INDUZIONE della MITOSI Aumento di ciclina M e attivazione di M-Cdk M-Cdk induce: Fattore scatenante Assemblaggio fuso mitotico Aggancio dei cromatidi Condesazione cromosomi Demolizione involucro nucleare

19 INDUZIONE della ANAFASE e completamento della MITOSI Primo Check point Secondo Check point Terzo check point APC/C APC/C G1-Cdk

20 INDUZIONE della ANAFASE e completamento della MITOSI APC/C SECURINA APC/C 1 Ubiquitinazione di proteine mitotiche regolatrici 2 Ubiquitinazione di CICLINE S e M Fattori Cdc Cell Division Cycle SECURINA attivatore SEPARASI COESINA

21 COESINA APC/C agisce (indirettamente) Distacco dei cromatidi fratelli su Scc1

22 APC/C è una UBIQUITINA-LIGASI

23 UBIQUITINA 76 aa Specifica per vari segnali di Ubiquitinazione p.e. ACP/P DEGRADAZIONE AL PROTEASOMA

24 Proteasoma 20S Sia nucleare che citoplasmatico -Turn-over delle proteine - Degradazione proteine aberranti (retrotrasposrto da ER)

25 Superamento primo check point Attivazione del complesso pre-rc. INIZIO REPLICAZIONE GENOMA RIEPILOGO CICLO CELLULARE S-Cdk Superamento secondo check point Assemblaggio fuso mitotico Aggancio dei cromatidi Condesazione cromosomi Demolizione involucro nucleare INIZIO MITOSI M-Cdk Superamento terzo check point Eliminazione di SECURINA e di CICLINE S e M APC/C COMPLETAMENTO della MITOSI e del CICLO CELLULARE Check point Check point Check point G0 start AUMENTO AUMENTO DI VOLUME DI VOLUME

26 FATTORI DI CRESCITA La dimensione di un organo (e di un organismo) èdovuta a CRESCITA CELLULARE (aumento del volume) MITOGENI G1- e G1/S-Cdk PROLIFERAZIONE (aumento del numero) APOPTOSI (morte cellulare programmata) FATTORI DI SOPRAVVIVENZA VARI FATTORI HANNO ATTIVITA MULTIPLE Brutte abitudini: CRESCITA cellulare invece di PROLIFERAZIONE!! FATTORE DI CRESCITA anche se è un mitogeno

27 Via di segnalazione per fattori MITOGENI start Retinoblastoma Rb

28 Danni da radiazioni bloccano l entrata in fase S in attesa di riparazione. SI NO P53 GUARDIANO DEL GENOMA CKI Inibitore di Cdk Rimozione di p21 e proliferazione p53 induce apoptosi

29 FORCA REPLICATIVA TELOMERO

30 SENESCENZA CELLULARE REPLICATIVA

31 FATTORI DI CRESCITA Attivazione di fosfoinositolo 3 chinasi Inositolo-fosfolipide Fosfoinositolo 3 fosfato Sintesi proteica e crescita cellulare COORDINAMENTO TRA CRESCITA E PROLIFERAZIONE

32

33 LIEVITI

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

REGOLAZIONE DEL CICLO CELLULARE

REGOLAZIONE DEL CICLO CELLULARE REGOLAZIONE DEL CICLO CELLULARE Il sistema di controllo che regola la progressione del ciclo cellulare deve: 1) Garantire che tutti i processi associati con le diverse fasi siano portati a termine al tempo

Dettagli

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi

- Assenza di mitogeni - Presenza di segnali conflittuali ( se durano troppo va incontro ad apoptosi) - Segnali differenziativi Ciclo Cellulare M --> G1--> S --> G2 --> M S, G2 e M hanno durata sempre uguale mentre la fase G1 (in media 10 ore) può subire enormi variazioni da tessuto a tessuto (fino a migliaia di ore per i neuroni).

Dettagli

Trasmissione della informazione: livello cellulare

Trasmissione della informazione: livello cellulare Trasmissione della informazione: livello cellulare Prof.ssa Flavia Frabetti aa.2010-11 ACCRESCIMENTO E DIVISIONE DIVISIONE CELLULARE CRESCITA CELLULARE E DUPLICAZIONE DEI CROMOSOMI SEGREGAZIONE DEI CROMOSOMI

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare Riproduzione e ciclo cellulare La capacità di riprodursi è carattere fondamentale dei viventi. Gli organismi unicellulari più semplici (es batteri ma anche eucarioti unicellulari) si riproducono per divisione

Dettagli

Il SAC, sistema di controllo nella divisione cellulare

Il SAC, sistema di controllo nella divisione cellulare Il SAC, sistema di controllo nella divisione cellulare IFOM per la scuola Lo Studente Ricercatore 2011 Villani Yuri Liceo Scientifico Tecnologico Chimico-Biologico IIS A. Maserati - Voghera(PV) Gruppo:

Dettagli

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare)

Il checkpoint del fuso mitotico. (Pietro Perini-gruppo ciclo cellulare) Il checkpoint del fuso mitotico (Pietro Perini-gruppo ciclo cellulare) 1) Prima di approfondire la funzione del checkpoint del fuso mitotico, è opportuno ricordare quali sono le caratteristiche e le funzioni

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata. Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata. Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

MORTE CELLULARE PROGRAMMATA (PCD)

MORTE CELLULARE PROGRAMMATA (PCD) MORTE CELLULARE PROGRAMMATA (PCD) APOPTOSI Eliminazione di cellule non desiderate SERVE PER Rimodellamento di organi e tessuti Regolazione del numero di cellule Eliminazione di linfociti (tolleranza) Turn-over

Dettagli

Normale controllo della crescita cellulare

Normale controllo della crescita cellulare Normale controllo della crescita cellulare STOP STOP Cellula normale STOP Alterato controllo della crescita cellulare X STOP STOP Cellula tumorale STOP X Le cellule tumorali presentano alterazioni cromosomiche

Dettagli

Proliferazione e morte cellulare sono eventi fisiologici

Proliferazione e morte cellulare sono eventi fisiologici MORTE CELLULARE Proliferazione e morte cellulare sono eventi fisiologici Omeostasi tissutale (di tessuti dinamici) Sviluppo embrionale Eliminazione di strutture corporee inutili - Fasi di scultura/rimodellamento

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

RIPRODUZIONE E CICLO CELLULARE

RIPRODUZIONE E CICLO CELLULARE RIPRODUZIONE E CICLO CELLULARE Divisione cellulare La divisione cellulare è un processo che porta alla formazione di due o più cellule figlie a partire da una cellula genitore. E un processo molto rapido-

Dettagli

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b)

Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Considerando la definizione di introni indicare il rapporto corretto in ogni gene tra il numero degli esoni e degli introni: a) Esoni= introni +1 b) Esoni=introni c) Esoni= introni 1 d) Esoni= 2 volte

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

Ciclo Cellulare 18/01/2015

Ciclo Cellulare 18/01/2015 Ciclo Cellulare Biotecnologie http://upload.wikimedia.org/wikipedia/commons/e/e3/mitosis_%28261_13%29_pressed%3b_root_meristem_of_onion_%28cells_in_ prophase,_metaphase,_anaphase,_telophase%29.jpg http://270c81.medialib.glogster.com/media/3b/3b966af047cca0605f106aa1a34dd3451287c5e41a0c7ce8ce537f74bbb795eb/main

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Crescita e divisione cellulare

Crescita e divisione cellulare 08-04-14 CANCRO Crescita e divisione cellulare ogni cellula deve essere in grado di crescere e riprodursi una cellula che cresce e si divide genera due nuove cellule figlie gene4camente iden4che alla cellula

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Le sei suddivisioni della mitosi:

Le sei suddivisioni della mitosi: Le sei suddivisioni della mitosi: I cromosomi, replicati nella fase S dell interfase, vengono condensati in profase. I due cromatidi che compongono ciascun cromosoma si presentano uniti per tutta la

Dettagli

CICLO CELLULARE 12/12/16 BIOTECNOLOGIE CICLO CELLULARE FASI DEL CICLO CELLULARE

CICLO CELLULARE 12/12/16 BIOTECNOLOGIE CICLO CELLULARE FASI DEL CICLO CELLULARE CICLO CELLULARE Le cellule si riproducono svolgendo una sequenza ordinata di eventi in cui duplicano il loro contenuto e poi si dividono in due cellule figlie, per cui tutte le cellule derivano da altre

Dettagli

REGOLAZIONE DEL CICLO CELLULARE.

REGOLAZIONE DEL CICLO CELLULARE. REGOLAZIONE DEL CICLO CELLULARE www.fisiokinesiterapia.biz Siti utili Animazione sul ciclo cellulare e su come è stata scoperta la sua regolazione: http://www.usask.ca/biology/biol316/visgen/cell.mov Sito

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

La crescita delle piante

La crescita delle piante La crescita delle piante Figure 1. The structure and function of meristems during plant development.(a) Activation of apical meristems at germination initiates postembryonic growth and organogenesis. (B)

Dettagli

scaricato da www.sunhope.it

scaricato da www.sunhope.it Recettori a tirosina chinasi I recettori a tirosina chinasi presentano vari domini Una regione di legame (extracellulare) Una regione transmembrana Una coda intracellulare con numerose tirosine scaricato

Dettagli

Indice. Introduzione 1

Indice. Introduzione 1 Indice Introduzione 1 1 Segregazione cromosomica 4 1.1 Cicli di divisione cellulare............................ 4 1.1.1 Mitosi................................... 4 1.1.2 Meiosi..................................

Dettagli

I GENI ONCOSOPPRESSORI

I GENI ONCOSOPPRESSORI I GENI ONCOSOPPRESSORI Freno alla proliferazione; Regolazione della crescita cellulare e NON prevenzione dei tumori; L alterazione nella struttura o nell'espressione di questi geni (inattivazione) se è

Dettagli

Regolazione del ciclo cellulare negli eucarioti. Copyright (c) by W. H. Freeman and Company

Regolazione del ciclo cellulare negli eucarioti. Copyright (c) by W. H. Freeman and Company Regolazione del ciclo cellulare negli eucarioti Il ciclo vitale delle cellule La divisione cellulare avviene quando una cellula, dopo un periodo di crescita, si divide e dà vita a due cellule figlie. La

Dettagli

DIVISIONE E CICLO CELLULARE

DIVISIONE E CICLO CELLULARE DIVISIONE E CICLO CELLULARE Il destino di una cellula Divisione cellulare La divisione cellulare è un processo che porta alla formazione di due o più cellule figlie a partire da una cellula genitore. Nei

Dettagli

DIVISIONE E CICLO CELLULARE

DIVISIONE E CICLO CELLULARE DIVISIONE E CICLO CELLULARE Divisione cellulare La divisione cellulare è un processo che porta alla formazione di due o più cellule figlie a partire da una cellula genitore. Nei procarioti la divisione

Dettagli

Ciclo cellulare fasi

Ciclo cellulare fasi Il Ciclo Cellulare Il ciclo cellulare conduce alla formazione di due nuove cellule figlie, dalla unica cella madre iniziale. Questo processo di divisione è definito MITOSI Divisione cellulare Quando le

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton)

Mutazioni nelle cellule somatiche e genetica del cancro. (Teoria Boveri - Sutton) Mutazioni nelle cellule somatiche e genetica del cancro (Teoria Boveri - Sutton) Walter Stanborough Sutton Theodor Boveri Walter S. Sutton: Teoria dell ereditarietà dei cromosomi 1914: Teoria cromosomica

Dettagli

Mitosi, ciclo cellulare e sua regolazione.

Mitosi, ciclo cellulare e sua regolazione. Mitosi, ciclo cellulare e sua regolazione www.fisiokinesiterapia.biz La dinamica del DNA nel corso della mitosi Schema delle fasi della mitosi Immagine al microscopio ottico di cellule vegetali in interfase

Dettagli

MORTE CELLULARE PROGRAMMATA (PCD) O APOPTOSI Eliminazione di cellule non desiderate

MORTE CELLULARE PROGRAMMATA (PCD) O APOPTOSI Eliminazione di cellule non desiderate MORTE CELLULARE PROGRAMMATA (PCD) O APOPTOSI Eliminazione di cellule non desiderate meccanismo comune a tutti gli organismi SERVE PER Rimodellamento di organi e tessuti Regolazione del numero di cellule

Dettagli

Maurizio Pianezza. La mia terapia anticancro. Maurizio Pianezza. Aspetti di

Maurizio Pianezza. La mia terapia anticancro. Maurizio Pianezza. Aspetti di Maurizio ianezza Aspetti di Biologia Molecolare Maurizio ianezza 1 - DUE ISOFROME IGF1 IGF2 IGF - INSULIN GROWTH FACTOR FATTORE INSULINICO - ISOFORMA RINCIALE IGF1 - ROTEINA FORMATA DA 70 AMINOACIDI SIMILE

Dettagli

CICLO CELLULARE FARMACIA

CICLO CELLULARE FARMACIA CICLO CELLULARE FARMACIA CICLO CELLULARE Le cellule si riproducono svolgendo una sequenza ordinata di eventi in cui duplicano il loro contenuto e poi si dividono in due cellule figlie, per cui tutte le

Dettagli

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Le chinasi ATM e ATR sono coordinatrici di un fine meccanismo di controllo noto come checkpoint del

Dettagli

C) ) I A n n r i e m al a c g e iln lsar siy g c n e a lls in fe w edhich (A) I i n nt ir o ens a p alc o so nasr m ee p ltleo x in n t e e t r

C) ) I A n n r i e m al a c g e iln lsar siy g c n e a lls in fe w edhich (A) I i n nt ir o ens a p alc o so nasr m ee p ltleo x in n t e e t r (C) (B) In An real imaginary cells signals cell feed in which (A)In into signals response a complex are linked to network internal to and of partially external responses redundant signals, by linear a

Dettagli

Evasione apoptosi. Angiogenesi

Evasione apoptosi. Angiogenesi Il cancro rappresenta un gruppo d malaae che comprende almeno 100 Bpi differenb di tumori. A secondo del tessuto di origne si classificano tre Bpi principali di tumori: in tessub epiteliali: Carcinoma

Dettagli

L IPOFISECTOMIA ED IL PROFESSORE DI MODENA

L IPOFISECTOMIA ED IL PROFESSORE DI MODENA L IPOFISECTOMIA ED IL PROFESSORE DI MODENA Praticando un ipofisectomia ad un essere vivente che è portatore di cancro questo regredisce. Su questa osservazione si è iniziato a considerare la possibilità

Dettagli

Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita.

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita. MFN0366-A1 (I. Perroteau) - Ciclo cellulare 21_bct_2011 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 7. Replicazione del DNA Preparazione alla divisione Citodieresi

De Leo - Fasano - Ginelli Biologia e Genetica, II Ed. Capitolo 7. Replicazione del DNA Preparazione alla divisione Citodieresi Replicazione del DNA Preparazione alla divisione Citodieresi Durata del ciclo cellulare: 24 ore nei fibroblasti; 2 ore nel lievito; 30 minuti nei procarioti Quando una cellula non si divide per un periodo

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

Recettori di superficie

Recettori di superficie Recettori di superficie Esistono 3 classi principali di recettori di superficie 1. Recettori annessi a canali ionici 2. Recettori accoppiati alle proteine G 3. Recettori associati ad enzimi Recettori

Dettagli

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL CICLO CELLULARE, MITOSI E MEIOSI NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CELLULA DEVE CRESCERE

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Cromosomi MITOSI MEIOSI

Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

Il glicogeno (riserva di glucosio) è immagazzinato nel fegato e nei muscoli (con finalità diverse )

Il glicogeno (riserva di glucosio) è immagazzinato nel fegato e nei muscoli (con finalità diverse ) Glicogeno Glicogeno...1 Glicogenolisi...3 Glicogenosintesi...7 Regolazione ormonale della glicogenolisi e delle glicogenosintesi...13 Il recettore del glucagone e quello dell adrenalina sono 2 GPCR (G-Protein

Dettagli

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi

Dettagli

Nucleo. Spesso è la struttura più evidente TEM

Nucleo. Spesso è la struttura più evidente TEM Nucleo Spesso è la struttura più evidente MO TEM è delimitato da una doppia membrana (involucro nucleare) interrotta da numerosi pori poro nucleare ( 30-100nm) vi passano le grandi molecole RNA, proteine

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Ruolo della risposta al danno al DNA nella carcinogenesi e nello sviluppo di terapie tumorali

Ruolo della risposta al danno al DNA nella carcinogenesi e nello sviluppo di terapie tumorali Ruolo della risposta al danno al DNA nella carcinogenesi e nello sviluppo di terapie tumorali Dr.ssa Daniela Barilà Risposta al danno del DNA: diversi tipi di danno Difetti nella risposta al danno del

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

UNIVERSITÀ DEGLI STUDI DELLA DIPARTIMENTO DI AGROBIOLOGIA E AGROCHIMICA. CORSO DI DOTTORATO DI RICERCA EVOLUZIONE BIOLOGICA E BIOCHIMICA XXIII Ciclo

UNIVERSITÀ DEGLI STUDI DELLA DIPARTIMENTO DI AGROBIOLOGIA E AGROCHIMICA. CORSO DI DOTTORATO DI RICERCA EVOLUZIONE BIOLOGICA E BIOCHIMICA XXIII Ciclo UNIVERSITÀ DEGLI STUDI DELLA Tuscia DIPARTIMENTO DI AGROBIOLOGIA E AGROCHIMICA CORSO DI DOTTORATO DI RICERCA EVOLUZIONE BIOLOGICA E BIOCHIMICA XXIII Ciclo RELAZIONE TRA IL BACKGROUND GENETICO E LA RISPOSTA

Dettagli

Geni che regolano la divisione cellulare

Geni che regolano la divisione cellulare Geni che regolano la divisione cellulare!geni il cui prodotto proteico promuove un aumento del numero di cellule (oncogeni) Oncogeni = acceleratori!geni il cui prodotto proteico induce una riduzione del

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

RIPRODUZIONE E CICLO CELLULARE

RIPRODUZIONE E CICLO CELLULARE RIPRODUZIONE E CICLO CELLULARE Divisione cellulare La divisione cellulare è un processo che porta alla formazione di due o più cellule figlie a partire da una cellula genitore. Nei procarioti è un processo

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

E IL MECCANISMO ESSENZIALE PER CUI TUTTI GLI ORGA= NISMI SI RIPRODUCONO. NELLE SPECIE UNICELLULARI (BATTERI, LIEVITI ) CIA= SCUNA DIVISIONE CELLULARE

E IL MECCANISMO ESSENZIALE PER CUI TUTTI GLI ORGA= NISMI SI RIPRODUCONO. NELLE SPECIE UNICELLULARI (BATTERI, LIEVITI ) CIA= SCUNA DIVISIONE CELLULARE CICLO CELLULARE E IL MECCANISMO ESSENZIALE PER CUI TUTTI GLI ORGA= NISMI SI RIPRODUCONO. NELLE SPECIE UNICELLULARI (BATTERI, LIEVITI ) CIA= SCUNA DIVISIONE CELLULARE GENERA UN NUOVO ORGA= NISMO COMPLETO.

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

INTRODUZIONE. Il cancro rappresenta oggi la seconda causa di morte dopo le malattie

INTRODUZIONE. Il cancro rappresenta oggi la seconda causa di morte dopo le malattie INTRODUZIONE Il cancro rappresenta oggi la seconda causa di morte dopo le malattie cardiovascolari. Il termine tumore ( ma anche neoplasia) è utilizzato per indicare una neoformazione di tessuto costituito

Dettagli

La biostimolazione, alcuni passaggi obbligati. Durante l invecchiamento

La biostimolazione, alcuni passaggi obbligati. Durante l invecchiamento La biostimolazione, alcuni passaggi obbligati Durante l invecchiamento L invecchiamento è l incapacità di organi, tessuti, cellule e molecole a mantenere la propria integrità funzionale e strutturale perturbata

Dettagli

Sviluppo dei linfociti B

Sviluppo dei linfociti B Sviluppo dei linfociti B Checkpoints multipli nella maturazione dei linfociti Durante lo sviluppo i linfociti che esprimono recettori per l antigene funzionali sono selezionati e sopravvivono, gli altri

Dettagli

CICLO CELLULARE MITOTICO

CICLO CELLULARE MITOTICO Cellula Procariotica La divisione cellulare è rapida e semplice. I batteri non hanno un nucleo e contengono un solo cromosoma di DNA circolare attaccato alla membrana plasmatica dove resta mentre si duplica.

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI

ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI ORIGINE DI UN NUOVO ORGANISMO FECONDAZIONE SEGMENTAZIONE GASTRULAZIONE ORGANOGENESI La Fecondazione Processo con cui due cellule sessuali (gameti) si uniscono per formare un nuovo individuo cha ha un genoma

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita.

La durata del ciclo cellulare varia col variare della specie, del tipo di cellula e delle condizioni di crescita. IL CICLO CELLULARE Il ciclo cellulare, o ciclo di divisione cellulare (CDC), è la serie di eventi che avvengono in una cellula tra una divisione cellulare e quella successiva. La durata del ciclo cellulare

Dettagli

Caratteristiche generali dei sistemi viventi

Caratteristiche generali dei sistemi viventi Caratteristiche generali dei sistemi viventi 1 Unicità chimica 2 Complessità ed organizzazione gerarchica 3 Metabolismo 4 Interazione ambientale: Regolazione e omeostasi 5 Riproduzione 6 Sviluppo 7 Evoluzione

Dettagli

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL CICLO CELLULARE, MITOSI E MEIOSI NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CELLULA DEVE CRESCERE

Dettagli

La pompa Na + /Glucosio: simporto

La pompa Na + /Glucosio: simporto MFN0366-A1 (I. Perroteau) - trasportatori e canali La pompa Na + /Glucosio: simporto Il trasportatore oscilla fra due stati alternativi (A e B); nello stato A la proteina è aperta nello spazio extracellulare,

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli