Le cellule e le divisioni cellulari

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Le cellule e le divisioni cellulari"

Transcript

1 Le cellule e le divisioni cellulari

2 ttp://

3 Tutti gli esseri viventi, ad eccezione dei virus, sono formati da cellule

4 La cellula procariotica -Parete cellulare peptidoglicano Nucleoide -batteri -replicazione in 20 1 batterio Non c e una distinta organizzazione intracellulare 6 miliardi di cellule figlie in 11 ore

5 I batteri

6 ganelli La cellula eucariotica

7

8 Il nucleo delle cellule eucariotiche

9 Nel nucleo delle cellule eucariotiche: i cromosomi

10 I cromosomi sono : -Composti di DNA a doppia elica, in una forma fortemente superavvolta ed impaccata in una matrice proteica -Coinvolti nella trasmissione dell informazione genetica -Coinvolti nella corretta espressione dell informazione genetica nel tempo e nello spazio

11 I cromosomi sono fatti di DNA DNA di 1 cromosoma lungo da 2,5 e 5 cm Il DNA di tutti i cromosomi umani e lungo piu di 1 metro!

12 I cromosomi sono filamentosi Nucleo di una cellula di stomaco di ratto

13 Struttura dei cromosomi

14 I cromosomi variano in numero tra specie diverse. Organism Bacteria Number or chromosomes (n) 1 Genome size in base pairs ~400,000 - ~10,000,000 Yeast Worm Fly Weed Human ,000, ,000, ,000, ,000,000 3,000,000,000

15 Numero di cromosomi (2n) in alcuni animali Species # Species # Common fruit fly 8 Guinea Pig [24] 64 Dove [citation needed] 16 Garden snail [25] 54 Earthworm Octodrilus complanatus [26] Domestic cat Domestic pig Lab mouse 40 Lab rat 42 Rabbit [citation needed] 44 Syrian hamster 44 [citation needed] Hare 46 Human [27] 46 Gorillas, Chimpanzees [27] 48 Domestic sheep 54 Elephants [28] 56 Cow 60 Donkey 62 Horse 64 Dog [29] 78 Kingfisher [30] 13 2 Goldfish [31] Silkworm [32] Tibetan fox 36 38

16 e per dimensioni Cromosomi omologhi -> coppia di ciascun cromosoma, ereditati uno dal padre e uno dalla madre, uguali per struttura e distribuzione di loci genici ma non identici

17 Centromero vi si attaccano le fibre del fuso Centromero

18 Posizione del Centromero

19 Le colorazioni dei cromosomi Giemsa, reagisce col DNA dopo proteolisi Bande G-light (geni piu attivi) Bande G-Dark (DNA piu densamente spiralizzato) Utili per distinguere le diverse regioni cromosomali

20 Il cariotipo spettrale (SKY)

21 I cromosomi politenici di Drosophila cromocentro

22 I cromosomi sono finemente impacchettati Ogni cellula contiene 2m di DNA In totale abbiamo circa cellule In totale abbiamo 2x10 13 m di DNA Distanza Terra-Sole 1.5x10 11 m 50 volte la distanza Terra-Sole! Il DNA della cellula umana e impacchettato in modo da formare 46 cromosomi condensati nel nucleo

23 Ad ogni cromosoma corrisponde una molecola di DNA Elettroforesi in campo pulsato I 16 cromosomi di Saccaromyces Cerevisiae

24 I cromosomi sono fatti di cromatina

25 Le proteine istoniche Vari gradi di impaccamento I grado. Trattamento salino solenoide H4 Trattamento con DNA-asi stacca le perle H1 sostegno ed impalcatura degli ottameri

26 Il nucleosoma

27 Vari gradi di impaccamento II grado. Trattamento salino ad alta concentrazione Solenoide (30 nm), ulteriore grado di condensazione organizzato da H1 Nei cromosomi metafasici il solenoide si spiralizza ancora attorno ad un impalcatura a livello delle regioni SAR, o regioni di attacco dell impalcatura SAR

28 Eucromatina ed eterocromatina Bande scure Eterocromatina Bande chiare Eucromatina

29 Anatomia di un cromosoma Zone inattive Zone attive

30 Eucromatina.impacchettamento piu lasso.geni attivi Eterocromatina.Costitutiva sempre spenta.facoltativa si puo riattivare

31 I cromosomi contengono diversi tipi di DNA DNA eucariotico Geni attivi DNA ripetitivo DNA spaziatore Sequenze funzionali Sequenze prive di funzione nota Pseudogeni e sequenze non codificanti ma funzionali Eterocromatina del centromero, ripetizioni in tandem e sequenze trasposte

32 La teoria cromosomica dell eredita I cromosomi si mantengono costanti in numero -nelle cellule dello stesso organismo, -da un organismo all altro della stessa specie -di generazione in generazione nell ambito di una specie In che modo i cromosomi si mantengono costanti?

33 Nella Mitosi la cellula riproduce se stessa ed il numero dei cromosomi per cellula si mantiene uguale alla cellula originale Mitosi: divisione cellulare delle cellule somatiche

34 Il ciclo cellulare G0

35 MITOSI Interfase.si replica il DNA:ogni cromosoma duplica se stesso in 2 cromatidi fratelli Profase.i cromosomi cominciano a condensarsi e a diventare visibili Metafase.i cromatidi fratelli si dispongono sul piano equatoriale della cellula Anafase.i cromatidi fratelli sono tirati verso i poli opposti della cellula Telofase.i cromosomi fratelli separati si trovano ai poli opposti della cellula e si formano 2 nuclei Citocinesi.si separa il citoplasma e si completa la formazione di 2 cellule

36 Differenze nella Citocinesi tra cellula vegetale ed animale

37 Centrosomi ai poli opposti della cellula da cui si diffonde l aster dei microtubuli Massimo grado di condensazione dei

38 MEIOSI Nel1883 Eduard Van Beneden, lavorando con cellule uovo di un nematode osservo che conteneva la meta dei cromosomi delle cellule somatiche e che il numero originale dei cromosomi veniva ristabilito alla fecondazione Cellule diploidi Cellule aploidi

39 iploide-> 2 assetti di cromosomi omologhi per cellula (2n) ploide-> 1 solo assetto di cromosomi (n)

40 Con la meiosi una cellula diploide (2n) divanta aploide (n) Se non ci fosse la meiosi la fusione di 2 gameti diploidi umani produrrebbe 46 (2n) 46 (2n) x 92 (4n) 92 (4n) 92 (4n) x 184 (8n)

41 La meiosi assicura il mantenimento del numero corretto dei cromosomi attraverso le generazioni e genera variabilita genica 23 (n) 23 (n) x 46 (2n) meiosi 23 (n) 23 (n) x 46 (2n)

42 MEIOSI I divisione. Riduzionale si separano i cromosomi omologhi II divisione. Equazionale si separano i cromatidi fratelli

43 elomeri sono taccati alla embrana cleare 2n Profase I Bivalenti, cromosomi omologhi appaiati, 4 molecole di DNA o tetrade ossing-over ase in ui sono loccati li oociti (n) (n) orredo omosomale loide (n) (n) (n) (n) (n)

44 Il complesso sinaptinemale hiasma

45 Crossing-over scambio di pezzi di DNA fra i cromatidi non fratelli-> mescolamento genico aterno aterno

46 Errori meiotici

47 Errori meiotici Non disgiunzione cromosomale alla divisione meiotica I o II Cariotipo di Sindrome di Down

48 Non disgiunzioni meiotiche del cromosoma 21 oocita Cellula uovo oocita Cellula uovo normale Sindrome di Down

49 Non disgiunzioni meiotiche dei cromosomi sessuali XY: Sindrome di Turner e Klinefelter Aneuploidie

50 se il corredo cromosomale fosse 3n? Caso di poliploidie comune nelle piante che si possono riprodurre anche asessualmente (es per talea, bulbi etc. ), ma raro negli animali

51 Problema nella meiosi?

52 La formazione dei gameti Inizia alla puberta si duplicano per mitosi e gia nella vita embrionale iniziano la meiosi Bloccato in diplotene fino alla puberta Differenziamento lungo i tubuli seminiferi

53 Alternanza di generazioni nelle piante

54 Ciclo vitale di Saccharomyces Cerevisiae Riproduzione asessuale per gemmazione aploide Tipi sessuali opposti a e α

55 Ciclo vitale di Drosophila Melanogaster -28 C, 7 days -30 C, 11 days -25 C, 8.5 days

Qualche cenno di genetica.

Qualche cenno di genetica. Qualche cenno di genetica. Il numero dei cromosomi è tipico per ogni specie. Specie umana: 46 cromosomi OGNI COPPIA DI CROMOSOMI CONTIENE UN CROMOSOMA DI ORIGINE PATERNA E UN CROMOSOMA DI ORIGINE MATERNA

Dettagli

La divisione cellulare è implicata nella riproduzione asessuata e sessuata

La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare è implicata nella riproduzione asessuata e sessuata La divisione cellulare avviene quando una cellula «madre» si divide producendo due nuove cellule «figlie». La divisione cellulare

Dettagli

Riferimento bibliografico :

Riferimento bibliografico : Riferimento bibliografico : A Helix for the Final Cut Camilla Raiborg and Harald Stenmark Science 25 March 2011: 1533-1534. La Meiosi Un processo di divisione cellulare indispensabile per la riproduzione

Dettagli

La riproduzione cellulare. Mitosi e meiosi

La riproduzione cellulare. Mitosi e meiosi La riproduzione cellulare Mitosi e meiosi La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione. 2 Negli organismi procarioti Divisione

Dettagli

Caratteristiche della meiosi

Caratteristiche della meiosi Caratteristiche della meiosi 1) 1 ciclo di replicazione del DNA + 2 cicli di divisione nucleare: numero cromosomico dimezzato 2) Separazione dei centromeri in 1 a divisione = assortimento indipendente

Dettagli

Invito alla biologia.blu

Invito alla biologia.blu 1 H. Curtis, N. S. Barnes, A. Schnek, G. Flores Invito alla biologia.blu Dagli organismi alle cellule 2 Capitolo A8 La divisione cellulare: mitosi e meiosi 3 La divisione delle cellule Nei procarioti e

Dettagli

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi

L informazione genetica è organizzata nel genoma = cromosomi. Da Mauseth (Botanica) Idelson-Gnocchi Mitosi e Meiosi L informazione genetica è organizzata nel genoma = cromosomi Da Mauseth (Botanica) Idelson-Gnocchi Corredo cromosomico delle cellule somatiche 2 corredi cromosomici (2n) 2 cromosomi omologhi

Dettagli

La nuova biologia.blu

La nuova biologia.blu 1 David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Le cellule e i viventi PLUS 2 Capitolo A7 La divisione cellulare e la riproduzione 3 La divisione cellulare La divisione

Dettagli

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche

La meiosi MEIOSI: MITOSI: tra loro e diploidi ( doppio corredo ( singolo corredo cromosomico); -consta di due serie di divisioni meiotiche La meiosi La meiosi è quel processo mediante il quale, i gameti ( le cellule uovo femminili e gli spermatozoi maschili) maturano. Essa è detta, anche divisione riduzionale, poiché al termine del processo

Dettagli

Mitosi e meiosi: duplicazione cellulare

Mitosi e meiosi: duplicazione cellulare Mitosi e meiosi: duplicazione cellulare Mitosi: 4 fasi Profase Metafase Anafase Telofase Profase: i cromosomi si compattano e l involucro nucleare inizia a scomparire. I cromosomi si accorciano e si inspessiscono.

Dettagli

Il DNA, insieme a diverse proteine si organizza in una

Il DNA, insieme a diverse proteine si organizza in una MITOSI E MEIOSI Il DNA, insieme a diverse proteine si organizza in una struttura che è detta CROMOSOMA. I cromosomi sono costituiti da cromatina, che consiste di fibre contenenti DNA e proteine. Quando

Dettagli

La Genetica. La scienza dell ereditarietà

La Genetica. La scienza dell ereditarietà La Genetica La scienza dell ereditarietà La Genetica In che modo il patrimonio genetico è trasmesso alle nuove cellule che devono sostituire quelle che muoiono? (riproduzione cellulare) In che modo il

Dettagli

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE

UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE UNIVERSITA DEGLI STUDI DI CASSINO FACOLTA DI SCIENZE MOTORIE CORSO INTEGRATO DI BIOCHIMICA, BIOLOGIA & GENETICA MEDIA MODULO DI BIOLOGIA & GENETICA MEDICA CICLO VITALE & MEIOSI AA 2011-2012 Dott.ssa Veronica

Dettagli

1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico

1. Il ciclo cellulare si suddivide in mitosi, citodieresi, interfase: Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico 1. Il ciclo cellulare si suddivide in "mitosi", "citodieresi", "interfase": Vero Falso 2. Durante l'interfase: A)si duplica il materiale genetico B)l'attività nucleare è ferma C)i cromosomi sono visibili

Dettagli

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

L ORGANIZZAZIONE DEL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene L ORGANIZZAZIONE DEL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene TESSUTO DNA CELLULA NUCLEO CROMOSOMA GENOMA Il genoma è l insieme del materiale

Dettagli

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono.

La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. MITOSI E MEIOSI MITOSI La crescita degli organi del nostro corpo si basa sull aumento del numero delle cellule che li compongono. Una cellula normale, si definisce diploide (2n) ha cioè una coppia di cromosomi

Dettagli

Riproduzione e sessualità sono inscindibili?

Riproduzione e sessualità sono inscindibili? Riproduzione e sessualità sono inscindibili? Per biologia la risposta è NO Riproduzione: formazione di nuovi organismi da organismi pre-esistenti da cui ereditano i geni Sessualità: scambio o mescolamento

Dettagli

Cromosoma Una molecola molto lunga di DNA associata a proteine che porta l informazione genetica (geni)di un organismo. Un cromosoma deve contenere specifiche sequenze per: Origine di replicazione del

Dettagli

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

Mitosi e Meiosi. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Mitosi e Meiosi Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Trasmissione del materiale ereditario negli eucarioti Negli eucarioti si distinguono: Cellule somatiche n.

Dettagli

Cromosomi MITOSI MEIOSI

Cromosomi MITOSI MEIOSI Cromosomi MITOSI MEIOSI sezione di un nucleo Una visione semplificata del ciclo della cellula eucariote Il DNA con le proteine ad esso associate (cromatina) va incontro, durante il ciclo cellulare, ad

Dettagli

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase

Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Fasi della Mitosi: 1. Profase 2. Metafase 3. Anafase 4. Telofase Profase: Inizia quando i lunghi filamenti di cromatina cominciano a condensarsi mediante processi di spiralizzazione nel quale i cromosomi

Dettagli

VERIFICA La cellula si divide, gli organismi si riproducono

VERIFICA La cellula si divide, gli organismi si riproducono ERIICA La cellula si divide, gli organismi si riproducono Cognome Nome Classe Data I/1 ero o also? Il ciclo cellulare corrisponde alla vita di una cellula. La duplicazione del DNA avviene durante la divisione

Dettagli

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele

MITOSI - MEIOSI. Meccanismo d azione. Prof. Popolizio Raffaele MITOSI - MEIOSI Meccanismo d azione Prof. Popolizio Raffaele I protagonisti Fuso mitotico cromosoma DNA centrioli Cromosomi in fase di spiralizzazione cromatina dove avviene NUCLEOLO MEMBRANA PLASMATICA

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi CORREDO CROMOSOMICO E DIVISIONE CELLULARE NELL UOMO CROMOSOMI n:23 (22 somatici, 1 sessuale) CELLULE APLOIDI: 1n CELLULE DIPLOIDI: 2n Nelle cellule diploidi una serie di 23

Dettagli

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno

Il nucleo compartimento nucleare involucro nucleare la cromatina (DNA + proteine), uno Il nucleo Il compartimento nucleare, tipico delle cellule eucariote, segrega le attività del genoma (replicazione e trascrizione del DNA) dal rimanente metabolismo cellulare Il confine del compartimento

Dettagli

Lezione 12 Ciclo Cellulare Mitosi e Meiosi

Lezione 12 Ciclo Cellulare Mitosi e Meiosi Ciclo Cellulare CICLO CELLULARE Lo sviluppo di una singola cellula uovo fecondata fino alla formazione di un organismo complesso, multicellulare, implica la replicazione cellulare, la crescita e la progressiva

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Processo di fecondazione, la meiosi e la mitosi; La fecondazione nei mammiferi è il processo attraverso il quale l ovulo femminile viene fecondato dallo spermatozoo maschile. Dal processo di fecondazione

Dettagli

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita

Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Cromosomi, mitosi e meiosi, cromatina, epigenetica. Ereditarieta, variabilita, plasticita Walter Sutton e Theodore Boveri sono tra i primi ad esaminare i cromosomi e studiarne la distribuzione in cellule

Dettagli

Riproduzione cellulare: mitosi e meiosi

Riproduzione cellulare: mitosi e meiosi Riproduzione cellulare: mitosi e meiosi 1 Riproduzione cellulare La mitosi riguarda le cellule somatiche (le cellule del corpo) la meiosi le cellule germinali (cellule riproduttive o gameti) Svariati processi,

Dettagli

Tel

Tel silvia.bonaccorsi@uniroma1.it Tel. 06-49912473 Il sogno di ogni cellula è diventare due cellule! ovvero: oggi parleremo di Mitosi e Meiosi (e di come i cromosomi si distribuiscano durante certe divisioni

Dettagli

La Riproduzione e l Apparato Riproduttivo Umano

La Riproduzione e l Apparato Riproduttivo Umano La Riproduzione e l Apparato Riproduttivo Umano Perchè riprodursi? La riproduzione è il processo attraverso il quale gli esseri viventi generano nuovi individui della stessa specie: è il meccanismo per

Dettagli

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali

La divisione cellulare. Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Scissione binaria Mitosi e citodieresi Cellule staminali e tumorali La divisione cellulare Le cellule hanno la capacità di autoriprodursi. Il processo grazie al quale una cellula

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI

Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Le basi cellulari della riproduzione e dell ereditarietà. 1^ parte: La MITOSI Il simile genera (quasi) sempre il simile. Negli organismi in cui avviene la riproduzione asessuata, tutti i figli (e le cellule

Dettagli

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule.

Al contrario, l Apoptosi (morte cellulare programmata) diminuisce il numero delle cellule. Divisione Cellulare La Divisione Cellulare aumenta il numero delle cellule somatiche, e si realizza attraverso le fasi di: Mitosi (divisione del nucleo) Citodieresi (divisione del citoplasma) Al contrario,

Dettagli

Le basi cellulari della riproduzione e dell ereditarietà

Le basi cellulari della riproduzione e dell ereditarietà Le basi cellulari della riproduzione e dell ereditarietà riproduzione e divisione cellulare Negli organismi in cui avviene la riproduzione asessuata, la progenie è la copia genetica esatta dell unico genitore

Dettagli

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I

LA MEIOSI LA PRIMA DIVISIONE MEIOTICA PROFASE I LA MEIOSI Una coppia di cromosomi omologhi, presenti nel nucleo di una cellula diploide, è costituita da un primo cromosoma isolato di derivazione paterna e da un secondo cromosoma isolato di derivazione

Dettagli

Ciclo Cellulare Mitosi Meiosi

Ciclo Cellulare Mitosi Meiosi Ciclo Cellulare Mitosi Meiosi Omeostasi tissutale: equilibrio dinamico tra la perdita di cellule per morte cellulare e la loro sostituzione tramite la generazione di nuove cellule a partire da precursori

Dettagli

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina

CROMATINA ISTONI. Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina CROMATINA Complesso molecolare formato da DNA, istoni e proteine non istoniche ISTONI Proteine relativamente piccole, con forte carica positiva per la presenza degli aminoacidi lisina e arginina Si conoscono

Dettagli

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI

GENETICA. Modulo di 6 CFU. Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI GENETICA Modulo di 6 CFU Esame integrato di BIOCHIMICA&GENETICA Secondo anno del corso di laurea triennale in SCIENZE AMBIENTALI Docente: Flavia Cerrato Dip.to Scienze e Tecnologie Ambientali, Biologiche

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

DUPLICAZIONE DEL DNA

DUPLICAZIONE DEL DNA DUPLICAZIONE DEL DNA Nella duplicazione del DNA ciascun filamento della doppia elica aprendosi in corrispondenza del legame tra le basi, funge da stampo per la formazione di un nuovo filamento. Alla separazione

Dettagli

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno

= ca. 1,7 mt. 3*10 9 (devono rientrare in uno CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti.

La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. La divisione cellulare e la riproduzione degli organismi. Parte II: Ciclo vitale, Meiosi e Ricombinazione negli Eucarioti. Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti

Dettagli

MERISTEMI APICALI. Apice del germoglio. Apice radicale

MERISTEMI APICALI. Apice del germoglio. Apice radicale MERISTEMI APICALI Apice del germoglio Apice radicale CICLO CELLULARE CHECK POINT 3 CHECK POINT 2 CHECK POINT 1 Le cellule vegetali differentemente da quelle animali possono abbandonare il ciclo di divisione

Dettagli

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti.

CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. CAP. 5 Riproduzione cellulare: mitosi, meiosi. Formazione dei gameti. 5.1 La divisione cellulare La divisione cellulare è il processo in seguito al quale una cellula si divide in due cellule figlie; generalmente

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

CICLO CELLULARE MITOTICO

CICLO CELLULARE MITOTICO Cellula Procariotica La divisione cellulare è rapida e semplice. I batteri non hanno un nucleo e contengono un solo cromosoma di DNA circolare attaccato alla membrana plasmatica dove resta mentre si duplica.

Dettagli

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO!

18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! 18. LA CROMATINA E IL CONTROLLO TRASCRIZIONALE DELLA ESPRESSIONE GENICA! DR. GIUSEPPE LUPO! Il DNA Eʼ ORGANIZZATO IN CROMOSOMI! I CROMOSOMI SONO! COSTITUITI DA CROMATINA:! DNA ASSOCIATO A PROTEINE.! LO

Dettagli

LA DIVISIONE CELLULARE

LA DIVISIONE CELLULARE LA DIVISIONE CELLULARE Il mantenimento della VITA si basa sulla divisione cellulare UNICELLULARI - riproduzione dell intero organismo PLURICELLULARI - sviluppo dalla prima cellula (zigote) - rinnovamento

Dettagli

Omnis cellula e cellula

Omnis cellula e cellula ogni cellula deriva da un altra cellula Omnis cellula e cellula Virchow 1858 LA MAGGIOR PARTE DEI PROCESSI NUCLEARI E CELLULARI DURANTE LA MITOSI E INDISTINGUIBILE IN PIANTE,ANIMALI E FUNGHI. DIVISIONE

Dettagli

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà

Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Capitolo 8 Le basi cellulari della riproduzione e dell ereditarietà Il concetto di riproduzione e la divisione cellulare 8.1 Il simile genera (quasi) sempre il simile Negli organismi in cui avviene la

Dettagli

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura

Università di Bari. Teoria Cromosomica. Prof. Mario Ventura Università di Bari Teoria Cromosomica Alcune caratteristiche fenotipiche di D. melanogaster Incrocio di un maschio white con femmina selvatica in D. melanogaster P SE FOSSE IL SEMPLICE FATTORE MEDELIANO?

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Genetica e Biometria

Genetica e Biometria Genetica e Biometria Info utili 1. Corso a frequenza OBBLIGATORIA 2. Tutte le lezioni saranno disponibili sul sito biotech in format pdf dopo essere state tenute dal docente! 3. Sono previste 2 VERIFICHE:

Dettagli

Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso

Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso Esempi di trasmissione di caratteri ereditari legati al sesso e indipendenti dal sesso Nel DNA dei cromosomi sono codificati i caratteri specifici per ogni individuo, in settori detti geni un carattere

Dettagli

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni.

Qualsiasi cellula, unità vivente, contiene una informazione ereditabile, scritta nel suo DNA ed organizzata in unità di informazione, chiamati geni. I CROMOSOMI E LA MITOSI Introduzione Ogni cellula ha origine da una cellula preesistente, mediante un processo di divisione cellulare. In questo modo, gli organismi unicellulari procarioti ed eucarioti

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1.

Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Collega ciascun termine con la sua definizione A. Fenotipo B. B. Genotipo C. C. Carattere D. D. Omozigote E. E. Eterozigote 1. Insieme delle caratteristiche contenute nei geni, sia quelle manifeste, sia

Dettagli

GENETICA. La mappatura dei cromosomi eucariotici mediante la ricombinazione

GENETICA. La mappatura dei cromosomi eucariotici mediante la ricombinazione GENETICA La mappatura dei cromosomi eucariotici mediante la ricombinazione Mappatura: : domande Se 2 geni sono localizzati sullo stesso cromosoma (linked)) si possono scoprire nuove combinazioni di alleli

Dettagli

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare

IL CICLO CELLULARE. Generalità Interfase. Mitosi. Citodieresi Regolazione del ciclo cellulare Fattori che influenzano il ciclo cellulare IL CICLO CELLULARE Generalità Interfase Fase G1 Fase S FaseG2 Mitosi Struttura del cromosoma spiralizzato Struttura del fuso Profase Metafase Anafase Telofase Citodieresi Regolazione del ciclo cellulare

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Nucleo. Contiene il materiale genetico DNA associato a proteine

Nucleo. Contiene il materiale genetico DNA associato a proteine Nucleo Contiene il materiale genetico DNA associato a proteine I cromosomi Sono depositari del materiale genetico. Sono composti da una lunga molecola di DNA, che costituisce il materiale genetico,e da

Dettagli

MOLTIPLICAZIONE CELLULARE

MOLTIPLICAZIONE CELLULARE MOLTIPLICAZIONE CELLULARE by Alfio Francesco e Maria Cannone La moltiplicazione cellulare è il processo attraverso il quale piante e animali generano nuove cellule o individui e rappresenta una delle funzioni

Dettagli

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna

Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata Via Belmeloro, 8 Bologna GENETICA GENERALE - 1 CFU Modulo Biologia Applicata e Genetica generale CORSO INTEGRATO: SCIENZE BIOLOGICHE - 7 CFU Dott.ssa Raffaella Casadei Dipartimento di Istologia Embriologia e Biologia Applicata

Dettagli

La divisione cellulare

La divisione cellulare Per lo più le cellule hanno vita limitata nel tempo, in quanto cessano di essere un individualità quando si dividono in due cellule figlie dotate delle stesse caratteristiche della cellula madre. Tutte

Dettagli

Le mutazioni cromosomiche

Le mutazioni cromosomiche Le mutazioni cromosomiche Di numero Di forma poliploidie (3n, 4n, ecc.) Trisomie (2n + 1) aneuploidie Monosomie (2n - 1) delezione duplicazione inversione traslocazione Il materiale ereditario degli eucarioti

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA LINFOCITI B E T Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it,

Dettagli

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL

NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CEL CICLO CELLULARE, MITOSI E MEIOSI NEGLI EUCARIOTI PLURICELLULARI TRE PROCESSI SONO NECESSARI PER FAR SI CHE DA UNA CELLULA (ZIGOTE) SI SVILUPPI UN ORGANISMO COMPLETO: 1) LA SINGOLA CELLULA DEVE CRESCERE

Dettagli

MITOSI. Fasi della mitosi

MITOSI. Fasi della mitosi MITOSI La mitosi è un processo legato alla divisione cellulare. Attraverso la mitosi una cellula si divide in due cellule figlie che risultano geneticamente e morfologicamente identiche tra loro e alla

Dettagli

Riproduzione. tipica di piante e animali (eucarioti pluricellulari) ma anche di alcuni eucarioti unicellulari

Riproduzione. tipica di piante e animali (eucarioti pluricellulari) ma anche di alcuni eucarioti unicellulari Riproduzione ASESSUATA o AGAMICA: Si ottiene una progenie geneticamente identica (CLONE) a meno di fenomeni di mutazione o cambiamenti occasionali del materiale genetico tipica dei procarioti ed eucarioti

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo IL CROMOSOMA EILCARIOTIPO CORSO DI GENETICA IL CROMOSOMA EILCARIOTIPO Dal DNA ai cromosomi I cromosomi Il materiale ereditario degli eucarioti è organizzato in cromosomi il cui numero e la cui morfologia sono costanti nelle varie

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE

Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE Lezione 1 LA DIVISIONE CELLULARE E LA RIPRODUZIONE 1 4.1 Il simile genera (più o meno) il simile Gli organismi si riproducono secondo due modalità Riproduzione asessuata I figli ereditano il DNA di un

Dettagli

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME...

Progetto Tandem Biologia saperi minimi Anno accademico Marzo 2012 COGNOME... Progetto Tandem Biologia saperi minimi Anno accademico 2011-2012 2 Marzo 2012 COGNOME... NOME 1) Quali delle seguenti affermazioni sulla struttura primaria delle proteine è falsa? a) può essere ramificata

Dettagli

2. I cromosomi 16/03/15. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto

2. I cromosomi 16/03/15. Le dimensioni dell acido nucleico è molto maggiore delle dimensioni del compartimento in cui è contenuto 2. I cromosomi contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Le dimensioni dell acido nucleico è molto maggiore delle

Dettagli

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi!

Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Cosa succede alle cellule di un essere vivente in crescita? Come si formeranno le cellule sessuali? Scopriamolo con i seguenti esercizi! Esercizio 1 Di seguito puoi osservare il cariotipo (patrimonio cromosomico)

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

Allestimento di un cariotipo di cromosomi umani

Allestimento di un cariotipo di cromosomi umani Allestimento di un cariotipo di cromosomi umani The picture that established 46 as the chromosome number in man. Reproduced with permission from Ref. 1 (1956) Mendelian Society of Lund for the Scandinavian

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA

CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA PON di Scienze a.s. 2013/14 Esperto prof. C. Formica CICLO E DIVISIONE CELLULARE GENETICA MENDELIANA Immagini e testi tratti dai website di: genome.wellcome.ac.uk, dnaftb.org, unipv.it, unimi.it, wikipedia.it,

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

LA MEIOSI E LA RIPRODUZIONE

LA MEIOSI E LA RIPRODUZIONE LA MEIOSI E LA RIPRODUZIONE Gli organismi eucarioti si riproducono asessualmente o sessualmente. Nella riproduzione asessuata (o agamica o vegetativa), un singolo individuo si riproduce mediante mitosi

Dettagli

Ciclo cellulare. Mitosi

Ciclo cellulare. Mitosi Ciclo cellulare Mitosi Definizione Mitosisi è un processo dal quale si originano due cellule identiche Avviene nelle cellule somatiche (non nei gamenti) Le nuove cellule sono chiamate cellule figlie Il

Dettagli

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi

La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi La riproduzione cellulare - Ciclo cellulare, mitosi e meiosi Henrietta Lacks e le cellule HeLa Henrietta Lacks morì nel 1951 per un tumore al collo dell utero. Nella vita Henrietta non uscì mai dal Maryland

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita

MFN0366-A1 (I. Perroteau) - Ciclo cellulare. Solo per uso didattico, vietata la riproduzione, la diffusione o la vendita MFN0366-A1 (I. Perroteau) - Ciclo cellulare 1 MFN0366-A1 (I. Perroteau) - Ciclo cellulare G1 sta per gap 1 : intervallo o pre-sintesis, S per sintesi, G2 per gap 2, o postsintesi, M è la fase di divisione

Dettagli

RIPRODUZIONE SESSUATA (GAMICA)

RIPRODUZIONE SESSUATA (GAMICA) Meiosi CdL Ifermieristica Aa. 2011/12 Prof.ssa Frabetti RIPRODUZIONE SESSUATA (GAMICA) comporta l uioe di due cellule (i gameti), ciascua co il suo coteuto iformativo, il suo corredo aploide di cromosomi

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE

11 Meiosi: le basi cellulari della riproduzione sessuale PERCHÉ È IMPORTANTE Cromosomi appaiati durante la metafase della prima divisione meiotica, il meccanismo che produce i gameti, quali uova e spermatozoi (SEM colorata). Adrian T. Sumner/Science Photo Library/Photo Researchers,

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

La capacità di crescere è una caratteristica fondamentale degli esseri viventi

La capacità di crescere è una caratteristica fondamentale degli esseri viventi La capacità di crescere è una caratteristica fondamentale degli esseri viventi Negli organismi unicellulari, la divisione cellulare fa aumentare il numero totale degli individui di una popolazione Negli

Dettagli