Malattie Genetiche Classificazione????????????
GCGGCGGCGGGCGGGTACTGGCTTCTGGGGCCAGGGGCCAGGGGCGGTGGGCGCCGGGACCGCGGAGCTGAGGA GCGGGGCCCGGCCAGGGCTGGAGACTTTGCGCCCGGGGGCACCGGGGCTGCGCGCGGTCGCACACATCCACCGGC GCGGCTTCCCTCGGCGGCCCGGGCTCCGCTCATCCTGCGGCGGGCGGCGCCGCTCAGGGGCGGGAAGAGGAGGCG GTAGACGCGACCACAGAAGATGTCGGGCCAAACGCTCACGGATCGGATCGCCGCCGCTCAGTACAGCGTTACAGGCT CTGCTGTAGCAAGAGCGGTCTGCAAAGCCACTACTCATGAAGTAATGGGCCCCAAGAAAAAGCACCTGGACTATTTGAT CCAGGCTACCAACGAGACCAATGTTAATATTCCTCAGATGGCCGACACTCTCTTTGAGCGGGCAACAAACAGTAGCTGG GTGGTTGTGTTTAAGGCTTTAGTGACAACACATCATCTCATGGTGCATGGAAATGAGAGATTTATTCAATATTTGGCTTC TAGAAATACACTATTCAATCTCAGCAATTTTTTGGACAAAAGTGGATCCCATGGTTATGATATGTCTACCTTCATAAGGCG CTATAGTAGATATTTGAATGAAAAGGCTTTTTCTTACAGACAGATGGCCTTTGATTTTGCCAGGGTGAAGAAAGGGGCC GATGGTGTAATGAGGACAATGGCTCCCGAAAAGCTGCTAAAGAGTATGCCAATACTACAGGGACAAATTGATGCACTGC TTGAATTTGATGTGCATCCAAATGAACTAACAAATGGTGTCATAAATGCAGCATTTATGCTTCTTTTCAAAGATCTTATCA AACTTTTTGCTTGCTACAATGATGGTGTTATTAACTTACTCGAAAAGTTTTTTGAAATGAAGAAAGGACAATGTAAAGATG CTCTAGAAATTTACAAACGATTTCTAACTAGAATGACACGAGTGTCTGAATTTCTCAAGGTTGCAGAGCAAGTTGGTATT GATAAAGGTGACATTCCTGACCTCACACAGGCTCCCAGCAGTCTTATGGAGACGCTTGAACAGCATCTAAATACATTAG AAGGAAAGAAACCTGGAAACAATGAAGGATCTGGTGCTCCCTCTCCATTAAGTAAGTCTTCTCCAGCCACAACTGTTAC GTCTCCTAATTCTACACCAGCTAAAACTATTGACACATCCCCACCGGTTGATTTATTTGCAACTGCATCTGCGGCTGTCC CAGTCAGCACTTCTAAACCATCTAGTGATCTCCTGGACCTCCAGCCAGACTTTTCCTCTGGAGGGGCAGCAGCAGCCG CAGCACCAGCACCACCACCACCTGCTGGAGGAGCCACTGCATGGGGAGACCTTTTGGGAGAGGATTCTTTGGCTGCA CTTTCCTCTGTTCCCTCTGAAGCACAGATTTCAGATCCATTTGCACCAGAACCTACCCCTCCTACTACAACTGCTGAAAT TGCAACCACTACTGCTGCCACCGCCGCTGCCACCACCACTACCATTCATCTCTTGCCAGCTTAGTAGGCAATCTTGGAA TTTCTGGTACCACAACAAAAAAGGGAGATCTTCAGTGGAATGCTGGAGAGAAAAAGTTGACTGGTGGAGCCAACTGGC AGCCTAAAGTAGCTCCAGCAACCTGGTCAGCAGGCGTTCCACCAAGTGCACCTTTGCAAGGAGCTGTACCTCCAACCA 3*10 9 bp GTTCAGTTCCTCCTGTTGCCGGGGCCCCATCGGTTGGACAACCTGGAGCAGGATTTGGAATGCCTCCTGCTGGGACAG GCATGCCCATGATGCCTCAGCAGCCGGTCATGTTTGCACAGCCCATGATGAGGCCCCCCTTTGGAGCTGCCGCTGTAC CTGGCACGCAGCTTTCTCCAAGCCCTACACCTGCCAGTCAGAGTCCCAAGAAACCTCCAGCAAAGGACCCATTAGCGG ATCTTAACATCAAGGATTTCTTGTAAACAATTTAAGCTGCAATATTTGTGACTGAATAGGAAAATAAATGAGTTTGGAGAC TTCAAATAAGATTGATGCTGAGTTTCAAAGGGAGCCACCAGTACCAAACCCAATACTTACTCATAACTTCTCTTCCAAAAT GTGTAACACAGCCGTGAAAGTGAACATTAGGAATATGTACTACCTTAGCTGTTATCCCTACTCTTGAAATTGTAGTGTAT TTGGATTATTTGTGTATTGTACGATGTAAACAATGAATGGATGTTACTGATGCCGTTAGTGCTTTTTTGGACTTCACCTGA GGACAGATGATGCAGCTGTTGTGTGGCGAGCTATTTGGAAAGACGTCTGTGTTTTTGAAGGTTTCAATGTACATATAAC TTTTGAACAAACCCCAAACTCTTCCCATAAATTATCTTTTCTTCTGTATCTCTGTTACAAGCGTAGTGTGATAATACCAGA TAATAAGGAAAACACTCATAAATATACAAAACTTTTTCAGTGTGGAGTACATTTTTCCAATCACAGGAACTTCAACTGTTG 150*10 6 bp 1-5*10 6 bp TGAGAAATGTTTATTTTTGTGGCACTGTATATGTTAAGAAATTTTATTTTAAAAAATATAAAGGTTAACGTCCATAATAAAT ACTTCTCTTTGAAGCTACCTTATCAAGAACGAAAAATCGTATGGGAAGAATCCCCTATTTATCACTGCTATATTAAAATAT ATATATTTTAATTATATTTGACAGGTTTTGCATCTAAATTGACCTATTTATTCATTCTTGATTAAATGCACTGAAAAGTAAAA TTTAAAAGTGGTTGTATCTGAATTTACTGTGGGGATAACATACACTGTAATGGGGAAAAATTACCTAAAACCAATTTCAAA ATGGCTTTCTTTGTATTTCAGTTTAAAAACCCAGTGCATGTACGCCCTCTGAGATGCAATAAACACCTTGAACAAAG
Tipo cellulare Numero di geni Funzione del gene interessato
Mutazioni somatiche e germinali
Mutazioni germinali Mutazioni geniche Alterazioni complesse del genoma (mutazioni cromosomiche)
Fenotipi Complessi Cancro Malattie degenerative Mutazioni somatiche mutazioni germinali molti geni coinvolti
Presenti nello zigote Alterazioni di un singolo gene Malattie ad eredità Mendeliana
This database is a catalog of human genes and genetic disorders authored and edited by Dr. Victor A. McKusick and his colleagues at Johns Hopkins and elsewhere, and developed for the World Wide Web by NCBI, the National Center for Biotechnology Information. The database contains textual information and references. It also contains copious links to MEDLINE and sequence records in the Entrez system, and links to additional related resources at NCBI and elsewhere. http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=omim
Il cancro è una malattia genetica. Differentemente da altre malattie genetiche, a trasmissione mendeliana oppure ad eziologia multifattoriale, esso è principalmente causato da mutazioni de novo che avvengono nel genoma di cellule somatiche. 11
12
Figure 20-11 Molecular Biology of the Cell ( Garland Science 2008) 13
14
Figure 20-20b Molecular Biology of the Cell ( Garland Science 2008) 15
Figure 20-2 Molecular Biology of the Cell ( Garland Science 2008) 16
Quali sono i geni le cui mutazioni possono contribuire all insorgenza del fenotipo neoplastico? 17
18
Fattori di crescita Recettori per i fattori di crescita Proteine coinvolte trasduzione del segnale Fattori di trascrizione Proteine pro- apoptotiche oppure anti-apoptotiche Proteine che controllano il ciclo cellulare Proteine coinvolte nella riparazione del DNA 19
Figure 20-14 Molecular Biology of the Cell ( Garland Science 2008) 20
Geni coinvolti nell insorgenza e nella progressione della neoplasia Protooncogeni Oncosoppressori Geni codificanti proteine coinvolte nella riparazione del DNA 21
What are the genes responsible for tumorigenic cell growth? Normal Proto-oncogenes Tumor suppressor genes + - Cell growth and proliferation Cancer Mutated or activated oncogenes Loss or mutation of Tumor suppressor genes ++ Malignant transformation 22
23
Le mutazioni dei protooncogèni (che diventano oncogèni) alterano la struttura e le funzioni del gene, e della proteina codificata, in modo tale da determinare un cambiamento del fenotipo anche in condizione di eterozigosi (gain of function mutations): si comportano, quindi, in maniera dominante. 24
D altra parte, le mutazioni dei geni oncosoppressori (cioè, geni che modulano negativamente la proliferazione cellulare), causano perdita della funzione del gene e della proteina codificata, si comportano in modo recessivo (loss of function mutations). 25
La Predisposizione familiare In alcuni tipi di tumori, gli individui affetti ereditano dai genitori alcune delle mutazioni, che possono contribuire all insorgenza di un determinato fenotipo neoplastico. 26
Sporadic and familial (Mendelian) forms of cancer Knudson s two-hit hypothesis Sporadic Normal tumor suppressor gene Somatic mutation in one allele Somatic mutation in other allele Single tumors, unilateral, later-onset two mutations (two hits) are required for loss of tumor suppressor function 27
Sporadic and familial (Mendelian) forms of cancer Knudson s two-hit hypothesis Familial Tumor suppressor gene containing a germline mutation in one allele - heterozygous for the mutation Somatic mutation in other allele Multiple tumors, bilateral, early-onset two mutations (two hits) are required for loss of tumor suppressor function 28 the first hit is inherited and the second hit is somatic
29
30
31
Oncogenes in human tumors Mechanisms of activation of proto-oncogenes point mutations chromosomal rearrangements or translocations gene amplifications 32
1. Point mutations in a proto-oncogene that result in a constitutively acting protein product 2. Localized reduplication (gene amplification) of a DNA segment that includes a proto-oncogene, leading to overexpression of the encoded protein 3. Chromosomal translocation that brings a growthregulatory gene under the control of a different promoter and that causes inappropriate expression of the gene 33
An oncogene formed by the first mechanism encodes an oncoprotein that differs slightly from the normal protein encoded by the corresponding proto-oncogene. In contrast, the latter two mechanisms, usually, generate oncogenes whose protein products are identical with the normal proteins; their oncogenic effect is due to their being expressed at higher-thannormal levels or in cells where they normally are not expressed. 34
35
36
Cell-cycle dependent phosphorylation of Rb Phosphorylation of Rb allows cells to transit the restriction point and enter S phase p p Hyperphosphorylated Rb Rb p p p p Rb p p Restriction point p Rb G0 Quiescent cells Hypophosphorylated Rb p p Rb G1 phase p p p M phase Rb S phase p p G2 phase p p Rb 37 p p
Il passaggio attraverso il punto di restrizione G0 richiede l attività del fattore E2F, il quale promuove la trascrizione di geni codificanti le proteine necessarie per la duplicazione del DNA cellulare. Questo fattore è attivato da Cdk2, Ciclina E e Ciclina A. L attività di E2F è inibita dal legame con la proteina Rb ipofosforilata, presente durante la fase M. Le Cdk 4/6, la Ciclina D, e successivamente la Cdk2 e la ciclina E, fosforilano Rb provocando il rilascio e la conseguente attivazione di E2F 38
39
40
Figure 20-40 Molecular Biology of the Cell ( Garland Science 2008) 41
42
I danni subiti dal DNA nucleare sono identificati da un sistema di controllo, attivo durante G1 e G2, che si basa sulla attivazione di p53, un fattore di trascrizione che stimola l espressione di p21 CIP. Questo cyclin-kinase inhibitor (CKI) si lega ai complessi Cdk-Ciclina e li inibisce, causando l arresto del ciclo in G1 oppure in G2 finchè il danno non sia stato riparato 43
p53 is the guardian of the genome germline p53 mutations are found in Li-Fraumeni syndrome p53 is frequently found mutated in human tumors the p53 protein functions as a transcription factor that regulates cell-cycle and DNA repair genes UV irradiation causes cell-cycle arrest in G1 that is dependent on p53; cells that contain a mutated p53 cannot arrest and go into S phase and replicate damaged DNA p53 loss-of-function mutations result in the replication of cells with damaged DNA and to the further accumulation of other mutations affecting oncogenes and tumor suppressor genes, and to an increased likelihood of cancer 44
Functions of selected proto-oncogenes Proto-oncogene 1. Secreted growth factors c-sis 2. Growth factor receptors c-erbb 3. Signal transduction proteins c-abl c-src H-ras K-ras Biochemical property Platelet derived growth factor Epidermal growth factor receptor Protein kinase Protein kinase Small G-protein Small G-protein 4. Nuclear proteins c-myc c-fos Transcription factor Transcription factor 45
Guadagno di funzione Le mutazioni a carico delle proteine Ras costituiscono un tipico esempio: infatti, una mutazione puntiforme nel gene, che codifica per questa proteina, riduce la sua attività GTPasica rendendola costitutivamente attiva. 46
Ras family proteins the c-ras family contains three genes: H-ras, K-ras, and N-ras the Ras proteins encoded by these genes are small G-proteins the proteins transmit growth signals from cell surface receptors the Ras proteins are activated by binding GTP the proteins are inactivated by GTP to GDP hydrolysis mutations in the c-ras genes inactivate the Ras GTPase mutated Ras proteins are constitutively active constitutively active Ras proteins result in uncontrolled cell growth 47
Amino acid substitutions in Ras family proteins amino acid position Ras gene 12 59 61 Tumor c-ras (H, K, N) Gly Ala Gln normal cells H-ras Gly Ala Leu lung carcinoma Val Ala Gln bladder carcinoma K-ras Cys Ala Gln lung carcinoma Arg Ala Gln lung carcinoma Val Ala Gln colon carcinoma N-ras Gly Ala Lys neuroblastoma Gly Ala Arg lung carcinoma Murine sarcoma virus H-ras Arg Thr Gln Harvey strain K-ras Ser Thr Gln Kirsten strain 48
Le ricerche sono state condotte sul cetuximab, un anticorpo monoclonale utilizzato per il trattamento del cancro del colon-retto metastatico ed è stato individuato un gene (KRAS) che predice l'efficacia di questa molecola sul paziente. I risultati mostrano che il cetuximab funziona meglio nei pazienti che non presentano mutazioni in questo marcatore. Questa scoperta è un altro decisivo passo avanti verso la messa a punto di terapie 49 sempre più mirate e su misura per il paziente.
50
Una mutazione puntiforme nel gene, che codifica per la proteina Ras, riduce la sua attività GTPasica rendendola costitutivamente attiva. 51
Cetuximab è un anticorpo monoclonale che blocca il recettore dell EGF. La proteina Ras si trova a valle di EGFR, quindi anche bloccando il recettore non si ottiene la risposta desiderata (blocco della proliferazione cellulare) 52
Ricerca delle mutazioni del gene K-Ras nella biopsia del paziente 53
Metodologia Preparazione del DNA dalla biopsia Amplificazione (PCR) della regione genomica di interesse Sequenziamento dei frammenti ottenuti Saggi di discriminazione allelica mediante Real-Time PCR 54
55
Chromosomal rearrangements or translocations Neoplasm Translocation Proto-oncogene Burkitt lymphoma t(8;14) 80% of cases c-myc 1 t(8;22) 15% of cases t(2;8) 5% of cases Chronic myelogenous t(9;22) 90-95% of cases bcr-abl 2 leukemia Acute lymphocytic t(9;22) 10-15% of cases bcr-abl 2 leukemia 1 c-myc is translocated to the IgG locus, which results in its activated expression 2 bcr-abl fusion protein is produced, which results in a constitutively active abl kinase 56
La proteina, codificata da c-myc attiva la trascrizione di geni che controllano la progressione del ciclo cellulare dalla fase G1 alla fase S. Normalmente, sia l mrna trascritto dal protooncogene, che la proteina sono molto instabili. Le cellule il cui genoma contiene le mutazioni sono costitutivamente indotte a proliferare. 57
sono tipiche le traslocazioni che interessano il cromosoma 8, dove è localizzato il gene c-myc, ed uno dei tre cromosomi in cui sono localizzati i geni che codificano per le catene pesanti e leggere delle immunoglobuline. La traslocazione più frequente è la [t (8:14)], che si riscontra nel 90% dei BL: la traslocazione, spostando cmyc in prossimità dell enhancer del gene che codifica per una delle catene delle immunoglobuline, causa la sua continua espressione e di conseguenza le cellule sono costitutivamente stimolate a proliferare. 58
c-myc is translocated to the IgG locus, which results in its activated expression c-myc c-myc is activated by the IgG enhancer in lymphocytes IgG enhancer IgG bcr-abl fusion protein is produced, which results in a constitutively active abl kinase bcr abl bcr-abl 59
A chromosome translocation that forms Bcr-Abl in a hematopoietic stem cell forms the diagnostic Philadelphia chromosome and results in the initial chronic phase of human chronic myelogenous leukemia (CML), characterized by an expansion in the number of well-differentiated granulocytes, a type of white blood cell. A second mutation in one such cell (e.g., in p53) leads to acute leukemia. 60
61
The chromosomal translocation results in fusion of a portion of the bcr gene (whose function is unknown but whose N-terminal segment forms a coiled-coil domain that links several bcr polypeptides together) with part of the c-abl gene, which encodes a proteintyrosine kinase whose normal substrates are not known. The chimeric polypeptides expressed from the resulting Bcr-Abl oncogene form a tetramer that exhibits constitutive Abl kinase activity. Although Abl is normally localized to the nucleus, addition of the Bcr segment causes the Bcr-Abl oncoprotein to be localized to the cytosol. Bcr-Abl binds to many intracellular signal-transduction proteins and then phosporylates them, proteins that Abl would not normally activate. As a consequence, these signaling proteins become activated in 62 the absence of growth factors.
63
micrornas CAN FUNCTION AS TS AND OG 64
65