Dimensione: px
Iniziare la visualizzazioe della pagina:




2 IX CONVEGNO NAZIONALE BIODIVERSITÀ Atti del convegno Vol. 2 Biodiversità, Alimenti e Salute A cura di: Generosa Calabrese Carmela Pacucci Wanda Occhialini Girolamo Russo 5-7 settembre 2012 Istituto Agronomico Mediterraneo di Bari Valenzano, Bari (Italia) CIHEAM-IAMB, 2013

3 ORGANIZZATORI CIGM Centro Interuniversitario del Germoplasma Mediterraneo Uni Ba Università di Bari CIHEAM- IAMB Istituto Agronomico Mediterraneo di Bari CON IL PATROCINIO DI Uni Ba Università di Bari CIHEAM- IAMB Istituto Agronomico Mediterraneo di Bari UniBas Università della Basilicata CNR Consiglio Nazionale delle Ricerche SISA Società Italiana di Scienza dell Alimentazione AISSA Associazione Italiana Società Scientifiche Agrarie Regione Puglia Assessorato alle Risorse Agroalimentari Consiglio Regionale della Puglia MiPAAF Ministero delle Politiche Agricole Alimentari e Forestali CON IL CONTRIBUTO DI Uni Ba Università di Bari CIHEAM- IAMB Istituto Agronomico Mediterraneo di Bari Life + Dinamo Villafrut Fondazione Cassa di Risparmio di Puglia Banca Carime (Cassa di Risparmio Meridionale) Regione Puglia Assessorato alle Risorse Agroalimentari

4 COMITATO SCIENTIFICO Elio ALBA Università della Basilicata Antonio BLANCO Università di Bari Aldo Moro Ferdinando BRANCA Università di Catania Generosa CALABRESE CIHEAM IAMB Tiziano CARUSO Università di Palermo Innocenza CHESSA Università di Sassari Luigi DE BELLIS Università del Salento Stefania DE PASCALE Università di Napoli Federico II Antonio ELIA Università di Foggia Cosimo LACIRIGNOLA CIHEAM IAMB Claudio LETO Università di Palermo Silvano MARCHIORI Università del Salento Vito MICCOLIS Università della Basilicata Giambattista POLIGNANO CNR-IGV - Bari Francesco SUNSERI Università di Reggio Calabria Angelo TURSI Università di Bari Aldo Moro COMITATO ORGANIZZATORE Girolamo RUSSO (Presidente) Università di Bari Aldo Moro Claudia BAUBLYS CIHEAM IAMB Venturino BISIGNANO CNR-IGV - Bari Laura D ANDREA Università di Bari Aldo Moro Giuseppe FERRARA Università di Bari Aldo Moro Mario GALANTE Università della Basilicata Angela Maria Stella MATARRESE Università di Bari Aldo Moro Carmela PACUCCI Università di Bari Aldo Moro Anna Rita SOMMA Biblioteca Consiglio Regione Puglia SEGRETERIA ORGANIZZATIVA DEL CONVEGNO Carmela PACUCCI (Segretaria) Università di Bari Aldo Moro Laura D ANDREA Università di Bari Aldo Moro Angela Maria Stella MATARRESE Università di Bari Aldo Moro CIHEAM-IAMB, VALENZANO, 2013






10 IX

11 X

12 INTRODUZIONE La valorizzazione delle risorse genetiche, la sicurezza alimentare, il cambiamento climatico e la conservazione dell agro-biodiversità sono tematiche strettamente interconnesse e costituiscono sfide strategiche nello scenario futuro dell agricoltura mediterranea. La biodiversità del territorio e del paesaggio ed i servizi eco-sistemici che ne derivano sono temi da sempre al centro delle analisi di sistema e della ricerca, al fine di promuovere la gestione sostenibile delle risorse e del territorio, la tutela del paesaggio autoctono e degli habitat, mediante pratiche agricole sostenibili, pur mantenendo, al tempo stesso, uno sguardo lucido e attento alle esigenze produttive del settore primario. In merito a tali tematiche, l Istituto Agronomico Mediterraneo di Bari (CIHEAM - IAMB), in collaborazione con il Centro Interuniversitario per il Germoplasma Mediterraneo (CIGM) e l Università degli Studi di Bari, ha avuto l onore di organizzare ed ospitare il IX Convegno Nazionale sulla Biodiversità, tenutosi dal 5 al 7 settembre L evento, articolato in tre giornate, ha visto a confronto scienziati, referenti istituzionali e politici, su tematiche relative alla tutela e valorizzazione della biodiversità, quale valida risorsa economica per lo sviluppo sostenibile dei territori. Il Convegno ha inteso declinare la tematica della biodiversità nei diversi e complementari ambiti delle risorse naturali, delle risorse genetiche, della pianificazione territoriale e del rapporto con il mondo dell agricoltura, favorendo il dialogo tra istituzioni e ricerca, per contribuire alla nascita di azioni coordinate rispetto alle necessità derivanti dalle più recenti analisi di scenario. Tale meeting ha rappresentato un utile occasione per riflettere sui nuovi indirizzi della politica di settore e le necessità della ricerca scientifica in considerazione degli scenari -nazionale e internazionale- delineati dalla Strategia Nazionale sulla Diversità Biologica, dall implementazione della Strategia Nazionale per la Biodiversità Agraria e dalla nuova Politica Agricola Comunitaria (PAC). Proprio muovendo dalla Strategia Nazionale sulla Biodiversità del Ministero dell Ambiente e grazie all implementazione del Trattato FAO sulle Risorse genetiche delle piante per l alimentazione e l agricoltura (PGRFA), numerosi relatori hanno sottolineato la valenza economica della biodiversità, risorsa da recuperare e conservare, in quanto binomio inscindibile con la sostenibilità. Uno spazio a parte è stato rivolto al rapporto tra biodiversità, alimenti e salute con riferimento allo stretto rapporto tra cibo e identità, diete sostenibili, territorio e valorizzazione dei prodotti tipici. Inoltre, particolare attenzione è stata dedicata all analisi del contesto relativo all interazione tra risorse naturali, pianificazione territoriale e rapporto con il mondo dell agricoltura. Tali tematiche, sviluppate nel corso di tre sessioni di studio, sono presentate nei tre volumi che costituiscono gli Atti. Il CIHEAM IAMB è da tempo impegnato a vario titolo su tali tematiche, in quanto l agrobiodiversità e la caratterizzazione delle risorse genetiche sono alla base della valorizzazione del territorio mediterraneo, che passa anche attraverso la salvaguardia del germoplasma di alberi da frutto autoctoni, di cui gli olivi monumentali pugliesi sono prestigiosi ambasciatori. Inoltre, la biodiversità gioca un ruolo chiave in tema di alimentazione sostenibile ed in tale ottica si inserisce l impegno dello IAMB per promuovere un sistema regionale di produzione alimentare sano e sostenibile, secondo gli standard della dieta mediterranea e per favorire il consumo di prodotti locali e stagionali, in particolare incoraggiando le reti regionali a XI

13 supporto delle decisioni pubbliche per la protezione, promozione e commercializzazione di prodotti mediterranei e lo sviluppo di sistemi produttivi sostenibili. Come Direttore dell Istituto Agronomico Mediterraneo di Bari, sono, pertanto, particolarmente lieto che gli Atti di questo Convegno possano arricchire e promuovere ulteriormente il dibattito tecnico tra le istituzioni, il mondo della ricerca scientifica, la società civile e tutti coloro che hanno a cuore il futuro del nostro pianeta. Cosimo Lacirignola Direttore CIHEAM - IAMB XII

14 PRESENTAZIONE Biodiversità e Sostenibilità formano un binomio inscindibile per la salvaguardia e la valorizzazione delle specie viventi. Nel 1992, dopo la Conferenza di Rio sulla Biodiversità che ha sottolineato l urgenza e la necessità della tematica, è nato il Centro Interuniversitario per le Ricerche Conservazione ed Utilizzazione del Germoplasma Mediterraneo (CIGM), con la finalità di agire soprattutto in relazione al difficile rapporto tra agricoltura e ambiente. A partire dalla metà del secolo scorso grazie a nuove tecniche e tecnologie, oggi anche nanotecnologie, il settore agro-alimentare-ambientale ha subìto molte trasformazioni. Tra le conseguenze di tali cambiamenti c è anche l abbandono dei sistemi produttivi ecocompatibili e la diffusione di sistemi prevalentemente monocolturali. Pertanto un gran numero di specie con potenzialità sconosciute si è estinto o ha subito gravi impoverimenti dei pool genici. D altro canto la diffusione delle abitudini alimentari dei Paesi industrializzati, con l eccessivo ricorso a prodotti alimentari sofisticati ma spesso qualitativamente poveri, ha determinato l insorgenza di malattie degenerative che oggi rappresentano gli aspetti fondamentali della problematica agro-alimentare-nutraceutica. Il recupero, la conservazione, la salvaguardia e la valorizzazione della Biodiversità facilitano la sostenibilità dell ecosistema, in quanto essa annovera aspetti ambientali, tecnologici, economici e sociali che favoriscono il recupero dei sistemi produttivi ecocompatibili ed il superamento del modello produttivo intensivo/superintensivo. In questo Convegno, giunto alla sua IX edizione, organizzato dall Università degli Studi di Bari Aldo Moro, dal CIHEAM - IAMB e dal CIGM, che segue quelli svoltisi a Massafra (1995), Matera (1996), Reggio Calabria (1997), Alghero (1998), Caserta (1999), Bari (2001), Catania (2005) e Lecce (2008), verranno illustrati lo stato dell arte della ricerca in Italia, il suo grado di applicabilità per la valorizzazione dei sistemi produttivi nell ambito di uno sviluppo sostenibile. Come già avvenuto nelle edizioni precedenti, sarà un occasione di incontro tra ricercatori e studiosi del settore per stimolare ricerche innovative mirate alla riconciliazione del rapporto fra natura e umanità per lungo tempo conflittuale, in un percorso multidisciplinare in cui si possa trovare l essenza dell eco-sostenibilità. Infine colgo l occasione di ringraziare tutti coloro che sono stati coinvolti nell organizzazione di questo Convegno, come pure tutte le Istituzioni e gli Enti pubblici e privati che hanno concesso un supporto finanziario senza il quale questa manifestazione non si sarebbe potuta realizzare. Girolamo Russo Il Presidente del Comitato Organizzatore XIII

15 CIBO, TERRITORIO, IDENTITÀ: LA VALORIZZAZIONE SOSTENIBILE L'idea di valorizzazione si situa su un crinale un po' pericoloso, per via della tentazione quasi un automatismo di collegare l'idea di valore all'idea del denaro, e quindi l'idea della valorizzazione ad attività che abbiano come obiettivo il profitto. Questo ha portato spesso ad iniziative quantomeno opinabili, a sbandieramenti di tipicità improvvisate e di tradizioni che le comunità locali non avevano mai nemmeno sentito nominare. E altrettanto spesso ha portato a concentrarsi su un prodotto, magari anche effettivamente radicato su quel territorio, ma che veniva comunicato senza considerare la rete delle competenze, delle conoscenze, delle condizioni e quasi sempre di ulteriori prodotti, che quella tipicità portava con sé, o di cui era più correttamente il risultato. Se il successo si misura in numero di turisti, in introiti per gli esercenti locali e quantità di citazioni sulla stampa di zona, sicuramente quelle operazioni sono anche state e continuano ad essere di successo. Se invece il successo si misura in grado di consapevolezza tra le comunità locali, in capacità di disseminare le informazioni, in robustezza di un tessuto culturale che intreccia in sé fili che arrivano da tante sorgenti diverse, allora le esperienze di successo sono sicuramente di meno, e soprattutto ci accorgiamo di quanta riflessione sia ancora necessaria, e di quanta formazione, affinché quella che chiamiamo valorizzazione assomigli più a una riconquista di senso (che prima o poi certamente si accompagnerà anche a benefici economici) che a una conquista di fette di mercato. Il caso della dieta mediterranea ci può essere d'aiuto, perché ha avuto, tra i suoi pregi, quello di stimolare riflessioni importanti e profonde. La dieta mediterranea è stata dichiarata dall'unesco Patrimonio immateriale dell'umanità, il che per un verso riconosce la saggezza di un atteggiamento culturale complessivo che riguarda le relazioni sociali, il senso del tempo, del bello, il rapporto uomo-natura e molto altro ancora. È di questa cultura che siamo figli, noi donne e uomini del Mediterraneo, anzi di queste culture, perché il Mediterraneo è un luogo plurale (il vino o la pasta, appartengono solo a un pezzetto di Mediterraneo, per esempio) e dunque abbiamo accolto con soddisfazione questo riconoscimento. Tuttavia in quella parola immateriale si celava anche un pericolo: considerare la dieta mediterranea come un fatto puramente formale, mentre stiamo parlando di un regime alimentare basato su prodotti dell'agricoltura: riuscite ad immaginare qualcosa di più materiale? Nel secondo dopoguerra, quando Ancel Keys codificò la dieta mediterranea, il problema dell'alimentazione non si poneva in termini di sicurezza, né termini di qualità. Oggi, con un mercato globalizzato e la cultura alimentare ridotta a livelli di guardia, rischiamo che le regole auree della dieta mediterranea (prevalenza di cereali, frutta e verdura, moderato consumo di prodotti animali, rari dolci, presenza di olio di oliva) divengano scatole vuote: quale frutta e quale verdura mangeremo, coltivata come, quanto raffinati saranno i cereali (che più sono raffinati e più assomigliano a zuccheri semplici per il nostro organismo) e da che allevamenti provengono i prodotti animali? Se non riportiamo l'attenzione sulla produzione, anche la dieta mediterranea perderà significato e valore, e seguirla non sarà garanzia di salute. Così come occorre riportare l'attenzione su quando NON si mangia: quanto ci si muove, come ci si sposta, che tipo di qualità dell'esistenza abbiamo. XIV

16 Riportare l'attenzione sulla produzione significa necessariamente riportarla sulla cultura, sugli stili di vita (a loro volta risultato di geografie e storie, ma anche di scelte politiche e intellettuali) che generano un determinato tipo di produzione. Ai tempi di Ancel Keys in qualche modo la sostenibilità non richiedeva scelte. Oggi siamo in una situazione completamente diversa: il ventaglio delle opzioni produttive e dunque alimentari che ci viene offerto è amplissimo, ma solo le scelte orientate alla sostenibilità sono scelte che riguardano, nella sua complessità, tutto un territorio e tutta una comunità. Bisogna stare attenti a non far diventare le idee delle etichette: le etichette servono per vendere e se questo è l'obiettivo possono funzionare; ma le idee servono per vivere, per crescere, e si possono semplificare ma solo fino al un certo punto, oltre il quale si tradiscono. Un esempio operativo di quanto detto finora ci viene dal progetto dei presidi di Slow Food. Dal punto di vista formale un Presidio è un'attività di valorizzazione di un territorio. La cosa più importante è che un Presidio inizia da un'esigenza di quel territorio e da un elemento di realtà di una comunità. Un prodotto a rischio di scomparsa che ha intorno un gruppo di produttori che pensano di poterlo salvare. Da lì muove i primi passi ogni progetto di Presidio Slow Food. Coinvolgendo le comunità, le istituzioni, le risorse del territorio e comunicando il senso di quel prodotto e il significato complessivo della sua scomparsa o della sua ripresa. Occorre dunque riconsiderare la nostra idea di benessere, di successo, di salute e di crescita per comprendere che portare a valore tutto questo è una delle sfide più importanti che oggi i territori sono chiamati a raccogliere. Cinzia Scaffidi Università di Scienze Gastronomiche Bra (CN) XV

17 RISORSE NATURALI E DIETE SOSTENIBILI L'agricoltura negli ultimi decenni ha fatto registrare notevoli passi avanti, anche se è evidente a tutti che gli attuali sistemi alimentari e le diete continuano a non essere sostenibili. Essi purtroppo hanno dimostrato per differenti motivi di essere inadeguati e non solo non hanno risolto il problema della fame e della malnutrizione nel mondo, ma hanno generato problemi di sovrappeso ed obesità che non hanno risparmiato nemmeno i paesi del sud dove è in corso una vera e propria deriva alimentare. Questo perché i meccanismi che regolano l'alimentazione seguono sempre più il criterio della quantità piuttosto che quello della qualità. L'industrializzazione dell agricoltura ed i trasporti su lunghe distanze, inoltre, hanno contribuito a far sì che la dieta che oggi la maggior parte del mondo moderno segue sia ricca di carne, prodotti caseari, grassi e zuccheri. Ma produrre della carne ha un impatto ambientale molto più alto rispetto alla produzione di vegetali e dunque il regime alimentare che noi tutti seguiamo ha inevitabili conseguenze sulle Risorse Naturali in termini di consumi idrici, emissioni di gas serra, perdita di biodiversità, etc. La produzione ed il consumo di cibo, infatti, generano un impatto ambientale in termini di emissioni di CO2, di consumo di terra e di risorse idriche. Se associamo questi elementi all allarmante rapidità con cui la biodiversità agricola si sta riducendo e con cui gli ecosistemi si stanno deteriorando, un riesame dei sistemi alimentari e delle diete risulta quindi assolutamente imprescindibile. È necessario promuovere e diffondere il concetto di Diete Sostenibili (DS) sia nei Paesi industrializzati che in quelli in via di sviluppo. Le DS raccomandano stili alimentari più sani per l ambiente e per i consumatori, qualità del cibo, sicurezza qualitativa e quantitativa degli alimenti, in un contesto di globalizzazione e crescente industrializzazione che non pone alcuna attenzione alla biodiversità ed alla sostenibilità degli ecosistemi alimentari. Roberto Capone Amministratore principale - CIHEAM-Bari XVI



20 2.1. RISORSE ALIMENTARI E DIETA MEDITERRANEA FOOD RESOURCES AND MEDITERRANEAN DIET Giuseppe MAIANI, Angela POLITO, Elena AZZINI, Donatella CIARAPICA, Alessandra DURAZZO, Maria Stella FODDAI, Federica INTORRE, Beatrice MAURO, Lara PALOMBA, Eugenia VENNERIA, Maria ZACCARIA Istituto Nazionale di Ricerca per gli Alimenti e la Nutrizione, Via Ardeatina 546, 00178, Roma, Riassunto Il cibo, sano e vario è garanzia di buona salute e rappresenta un elemento di identità sociale e culturale di un popolo. Nell ambito della popolazione italiana dal 1930 sino ad oggi, da paese agricolo a paese industrializzato, si riscontra una forte disponibilità alimentare, tuttavia oggi, si nota una forte diminuzione nel consumo di cereali, un aumento del consumo di frutta e vegetali e un aumento nel consumo di latte e derivati. In Italia, come nel resto dei paesi industrializzati, le strategie di marketing scoraggiano i produttori agricoli a coltivare ciò che il mercato non richiede spesso a scapito della qualità favorendo la riduzione della biodiversità. Inoltre, i flussi migratori in continua crescita, implicano delle modifiche nello stato sociale ed economico, nello stile di vita e nelle abitudini alimentari dell intera popolazione. Infatti, alimenti che provengono da una produzione agricola industriale e alimenti etnici sono divenuti sempre più popolari e facilmente disponibili in molti supermarket, ristoranti e negozi ciò a causa di una distribuzione a largo raggio e costi minori. L Italia, per la singolare conformazione geomorfologica, per le molteplici tipologie ambientali e per la diversità climatica, è il paese europeo più ricco di biodiversità e la conservazione del patrimonio biologico agroalimentare tradizionale per preservare le varietà locali andrebbe incentivata. I nostri risultati ottenuti nell espletamento di diversi progetti di ricerca hanno evidenziato una stretta correlazione tra il potenziale salutistico, la possibile funzionalità di un alimento e il territorio. Il territorio sta diventando un importante fattore strategico di produzione e di mercato : la promozione dei prodotti dovrebbe essere indirizzata verso un sistema di produzione sostenibile, che rispetti l ambiente e i principi di tracciabilità/rintracciabilità a partire dalla reintroduzione e dalla valorizzazione di specie locali coltivate in passato e ora trascurate, tutelando le scelte del consumatore. La dieta mediterranea, che si caratterizza come vero e proprio stile di vita, è un modello nutrizionale caratteristico rimasto pressoché inalterato nel tempo, basato sul consumo di prodotti strettamente connessi con il territorio di produzione, spesso consumati in un ambiente conviviale dopo preparazioni culinarie tradizionali. Dati di letteratura hanno evidenziato che gruppi di popolazione che vivono nell area mediterranea hanno una bassa incidenza di malattie CVD e delle cosiddette malattie del benessere (arteriosclerosi, ipertensione, diabete, obesità). Le nostre ricerche hanno dimostrano che soggetti sani in regime alimentare abituale mediterraneo presentano un aumento dei livelli plasmatici di composti antiossidanti e della capacità antiossidante plasmatica totale associati a una diminuzione di indicatori dello stato infiammatorio. In conclusione occorre studiare e preservare i prodotti tipici, specchio fedele delle tradizioni di un popolo, e il modello alimentare mediterraneo per sfruttarne al meglio le potenzialità 3

21 benefiche e salutistiche e sostenere le istituzioni locali dell agrobiodiversità. Parole chiave: Prodotti tradizionali, biodiversità, dieta mediterranea, antiossidanti, proprietà benefiche QUESTO LAVORO DI RICERCA È STATO REALIZZATO NELL AMBITO DEL PROGETTO BIODIVERSITÀ E AGROALIMENTARE: STRUMENTI PER DESCRIVERE LA REALTÀ ITALIANA BIOVITA FINANZIATO DAL MIPAAF. Abstract The food is an element of social and cultural identity of a people. Nowadays, there is a sharp decline in cereal consumption, increased consumption of fruits and vegetables and an increase consumption of milk and dairy products. In Italy, as in the rest of the industrialized countries, the marketing strategies discourage farmers to grow what the market does not require, and this may lead to the loss of quality and biodiversity. In addition, migration continues to grow and this involves changes in social and economic status, lifestyle and food habits of the population. In fact, foods that come from industrial production and ethnic foods have become increasingly popular and easily available in many supermarkets, restaurants and shops so because of a wide-ranging distribution and lower costs. Italy is Europe's richest country in biodiversity for its unique geomorphological configuration, for different types of environment or ecosystem and climatic conditions, and the preservation of traditional local varieties should be encouraged. Our results obtained in carrying out several research projects have shown a close correlation between the potential health benefit and the territory; the territory is becoming an important "strategic factor of production system and market": the promotion of products should be aimed at a sustainable production system based on the environment preservation, on the reintroduction and valorization of local species and varieties, on the principles of traceability and by taking into account the consumer choices. The Mediterranean diet is a nutritional model, remained almost unchanged over time, based on the consumption of products closely related to the production area and often consumed in a convivial atmosphere after traditional culinary preparations. Literature data have shown that people living in the Mediterranean area have a low incidence of CVD disease and the so-called "diseases of affluence" (atherosclerosis, hypertension, diabetes, obesity). Our studies show that healthy subjects in normal Mediterranean diet exhibited increased plasma levels of antioxidant compounds and total plasma antioxidant capacity associated with a decrease in markers of inflammation. In conclusion, it is important the investigation and valorization of traditional products and the Mediterranean diet model for the optimization of their potential beneficial and healthy properties and for the preservation of agro biodiversity. Keywords: traditional products, biodiversity, Mediterranean diet, antioxidants, beneficial properties Introduzione La qualità dei prodotti agroalimentari si colloca all interno di un nuovo modo di fare agricoltura e di un mercato dei prodotti alimentari diversamente connotato e regolamentato. I 4

22 cambiamenti dei prodotti mediterranei riflettono l evoluzione del contesto produttivo delle filiere agricole e sono connessi alle dinamiche economiche e sociali che interessano le aree agricole e rurali mediterranee. Proprio il territorio e le risorse ambientali dei Paesi del bacino mediterraneo consentono di praticare l attività agricola secondo un ottica multifunzionale. Oggi si tende ad un agricoltura sostenibile, competitiva e multifunzionale attraverso l utilizzo di risorse naturali e l attenzione alle esigenze del consumatore. Alla sostenibilità ambientale viene così associata, di riflesso, quella economica (alti livelli occupazionali, bassi tassi di inflazione e stabilità nel commercio internazionale) e sociale (equità dei diritti umani e civili, immigrazione, rapporti tra le nazioni). Attualmente, la ricerca italiana del settore agro-alimentare è finalizzata alla valorizzazione della biodiversità per ottimizzare e promuovere il consumo delle varietà minori la cui scomparsa porterebbe ad una ulteriore riduzione di biodiversità. Un analisi comprensiva della relazione tra il consumo e la produzione alimentare è necessaria per incoraggiare patterns di consumi alimentari equilibrati che garantiscano sicurezza ed alta qualità nutrizionale e nel contempo un basso impatto ambientale. Tra gli alimenti peculiari del modello alimentare mediterraneo che si possono consumare crudi troviamo la frutta e la verdura, evidenziati da diversi studi (Vioque et al., 2008) come punto focale della qualità della dieta mediterranea, grazie alla presenza e all azione sinergica dei composti fitochimici. Queste componenti, che includono vitamine, polifenoli, glucosinolati e carotenoidi, pur presenti in piccole quantità giocano, nell'alimentazione umana, un ruolo fondamentale nell assicurare una migliore qualità e una maggiore durata della vita (Trichopolou e Vasilopoulou, 2000; Shahar e Grotto, 2006; Perez-Lopez et al., 2009). Oggi la dieta mediterranea si presenta come un valido modello di sostenibilità dal punto di vista salutistico, ambientale ed economico, contribuendo a preservare la qualità, la sicurezza alimentare e nel contempo a promuovere la gestione delle risorse ambientali attraverso sistemi di produzione agricola legati al territorio ed al patrimonio locale culturale. La dieta mediterranea appare una dieta sana, universalmente riconosciuta come un modello alimentare capace di garantire al nostro organismo salute e benessere. Una corretta alimentazione dovrebbe permettere un adeguato contributo di nutrienti per soddisfare le esigenze metaboliche dell organismo e garantire al consumatore sicurezza, qualità e varietà. Il regime alimentare mediterraneo sembra in grado di fornire una dieta equilibrata, adatta per tutte le età e si pensa possa ridurre significativamente il rischio di malattie croniche (WHO/FAO, 2003). La dieta mediterranea, che si caratterizza come vero e proprio stile di vita, è un modello nutrizionale caratteristico rimasto pressoché inalterato nel tempo, basato sul consumo di prodotti strettamente connessi con il territorio di produzione, spesso consumati in un ambiente conviviale dopo preparazioni culinarie tradizionali. Con l occidentalizzazione del regime alimentare, soprattutto tra le giovani generazioni, caratterizzato dal consumo di grandi quantità di carne, alimenti altamente trasformati e dolci, diventato molto più comune in Italia, la peculiarità di questo modello nutrizionale si va perdendo. Lo stile alimentare mediterraneo tradizionale che garantisce un adeguato apporto di carboidrati, proteine, grassi, vitamine, sali minerali, antiossidanti e fibre, può essere identificato in un elevato consumo di frutta, verdura e cereali, olio d'oliva come principale fonte di grassi, basso consumo di carne e prodotti lattiero-caseari e il moderato consumo di vino. Negli ultimi anni, studi condotti sulla biodisponibilità dei composti fitochimici presenti in varie matrici alimentari, principalmente frutta e verdura, sia in modelli animali che nell uomo 5

23 hanno dimostrato come l apporto adeguato di molecole bioattive introdotte con la dieta, rappresenti una dose efficace, capace cioè di esplicare un effetto protettivo. È chiaro quindi come sia stretto il rapporto tra l effetto benefico delle molecole naturali, che coincide con il loro status di biologicamente attive, la loro biodisponibilità (Linos et al., 1999). Materiali e metodi Sono presentati in questo lavoro dati svolti nell ambito del progetto Biodiversità e agroalimentare: strumenti per descrivere la realtà italiana BIOVITA finanziato dal Mipaaf. Le proprietà antiossidanti sono state studiate tramite i saggi FRAP (Ferric Reducing Antioxidant Power) e TRAP (Total radical-trapping antioxidant potential). Il saggio FRAP è stato effettuato mediante tecnica spettrofotometrica secondo il metodo di Benzie e Strain (1996). Il saggio TRAP è stato effettuato secondo il metodo di Ghiselli et al. (2000). La valutazione dei carotenoidi è stata effettuata mediante tecnica di cromatografia liquida ad alta pressione (HPLC) applicando la metodologia descritta da Maiani et al. (1995). Il laboratorio è inserito a livello internazionale nel Quality Control del National Institute Tecnology USA ed è considerato laboratorio di riferimento. La vitamina C è stata valutata mediante tecniche di cromatografia liquida ad alta pressione (HPLC) secondo il metodo di Margolis (1997), con alcune modifiche (Serafini et al., 2002). Risultati Nell ultimo decennio c è stata un estensione ed un arricchimento del concetto di qualità alimentare. La qualità sta diventando un parametro soggettivo, che differisce da individuo ad individuo e dipende dai punti di vista del consumatore: la qualità dipende dalla persona, dal luogo e dal tempo (Kapsak et al., 2008); il Libro Verde la Commissione Europea indica la qualità alimentare come soddisfacimento delle aspettative dei consumatori (Germanò, 2008). Oggi per i consumatori e i produttori la tradizionalità rappresenta un prerequisito di qualità alimentare. Dati reali sulla composizione nutrizionale degli alimenti di nicchia e/o tipici stanno diventando essenziali nel contesto della globalizzazione di mercato e di produzione per la formulazione delle qualità nutrizionali e c è un numero sempre maggiore di alimenti resi interessanti dalle loro proprietà preventive e terapeutiche. Risultati di ricerche condotte sui prodotti tipici/tradizionali hanno evidenziato una stretta correlazione tra il potenziale salutistico, la possibile funzionalità di un alimento e il territorio. In Tab. 1 è mostrato il contenuto in molecole bioattive in prugne coltivate e selvatiche (Tab. 1): le prugne selvatiche presentano un profilo in antiossidanti migliore rispetto al prodotto coltivato. La cicoria selvatica calabrese rappresenta un importante fonte di antiossidanti (Tab. 2). Il contenuto dei singoli antiossidanti sembra indicare un miglior potenziale salutistico di questi alimenti rispetto ai corrispettivi commerciali. Uno studio condotto su campioni di cicoria coltivata e selvatica ha evidenziato come la bollitura incrementi la quantità dei carotenoidi (luteina e β-carotene) presenti e come aumenti la loro concentrazione ripassando l alimento in padella, probabilmente per una migliore e facilitata estrazione di tali composti dalla parete cellulare vegetale per l aggiunta di olio (Fig. 1). Per contro la cottura causava la totale scomparsa della vitamina C, che persisteva nel prodotto fresco. Vari studi epidemiologici ed evidenze sperimentali hanno mostrato il ruolo preventivo di una corretta alimentazione verso carenze alimentari, disordini comportamentali e malattie 6

24 degenerative; tale legame sembra essere connesso al contenuto di nutrienti e non, di composti bioattivi, e quindi alla qualità alimentare (Dragsted et al., 2004; Halliwell et al., 2005). In uno studio condotto nell ambito del progetto Biovita, è stato valutato l effetto della qualità della dieta, principalmente sullo stato nutrizionale antiossidante, sullo stato infiammatorio e lo stress ossidativo in un gruppo di popolazione sana. In Tab. 3 sono riportati i consumi medi dei gruppi di alimenti tipici e non della dieta mediterranea per classi di MDS. Il 26% dei soggetti ha una bassa qualità della dieta (MDS 3), nel 45% del campione la qualità della dieta è media (MDS=4-5), mentre il 29% presenta un elevata qualità della dieta (MDS 6). Come atteso è possibile osservare un aumento nei consumi degli alimenti tipici della dieta mediterranea, ritenuti protettivi, ed una diminuzione negli apporti di alimenti considerati non tipici, all aumentare delle classi di MDS. In particolare nel campione esaminato una maggior aderenza alla tradizionale dieta mediterranea (MDS 6) è significativamente associata ad un maggior consumo di verdura (P<0.0008),di frutta (P<0.0000) e pesce (P<0.005) e un minor consumo di carne (P<0.02), di latte e derivati (P<0.002), di alcool, sebbene non statisticamente significativo ed un miglior rapporto tra MUFA e PUFA (P< ) (Azzini et al., 2011). Da questo studio risulta che i soggetti con una maggior aderenza alla dieta mediterranea (MDS 6) sono significativamente associati a livelli plasmatici circolanti di luteina plus criptoxantina, α-carotene, β-carotene, vitamina E e lo stato degli antiossidanti endogeni risulta migliorato (Azzini et al., 2011). Conclusioni I risultati ottenuti evidenziano come il contenuto dei singoli antiossidanti è indice di un miglior potenziale salutistico degli alimenti, mostrando, in particolare, come i prodotti tipici presentino dei valori del potenziale antiossidante nettamente più alti rispetto ai prodotti commerciali. Gli effetti di abitudini alimentari salutari sono correlate alla qualità della dieta. Le abitudini alimentari e gli stili di vita sono determinate da fattori economici, sociali e personali e dall ambiente. La disponibilità e l accesso agli alimenti rappresenta un elemento chiave nella determinazione delle abitudini alimentari, così come la cultura, la tradizione, la modalità di consumo e la preparazione e cottura dei cibi. Bibliografia AZZINI E., POLITO A., FUMAGALLI A., INTORRE F., VENNERIA E., DURAZZO A., ZACCARIA M., CIARAPICA D., FODDAI M.S., MAURO B., RAGUZZINI A., PALOMBA L., MAIANI G., Mediterranean diet effect: an Italian picture. Nutrition Journal, 10: 125. BENZIE I.F.F, STRAIN J.J., The ferric reducing ability of plasma (FRAP) as a measure of antioxidant power : the assay. Analytical Biochemistry, 239: DRAGSTED L.O., PEDERSEN A., HERMETTER A., BASU S., HANSEN M., HAREN G.R., KALL M., BREINHOLT V., CASTENMILLER J.J.M., STAGSTED J., JAKOBSEN J., SKIBSTED L., RASMUSSEN S.E., LOFT S., SANDSTROM B., The 6-a-day study: effect of fruit and vegatbles on markers of oxidative stress and antioxidative defense in healthy non smokers. American Journal of Clinical Nutrition, 79: GERMANÒ A., Il Libro Verde della Commissione europea del 15 ottobre 2008: alla ricerca di una definizione di alimenti di qualità. Rivista di diritto agrario, 87(4):

25 GHISELLI A., SERAFINI M., MAIANI G., AZZINI E., FERRO-LUZZI A., A fluorescence-based method for measuring total plasma antioxidant capability. Free Radical Biology and Medicine, 18(1): HALLIWELL B., RAFFER J., JENNER A., Health promotion by flavonoid, tocopherols, tocotrienols and other phenols: direct or indirect effects? Antioxidant or not? American Journal of Clinical Nutrition, 81: 68S-76S. KAPSAK W.R., SCHMIDT D., CHILDS N.M., MEUNIER J., WHITE C., Consumer perceptions of graded, graphic and text label presentations for qualified health claims. Critical Revision Food Science and Nutrition, 48(3): LINOS A., KAKLAMANI V.G., KAKLAMANI E., KAKLAMANI Y., GIZIAKI E., PAPAZOGLOU S. and MANTZORO C.S., Dietary factors in relation to rheumatoid arthritis: a role for olive oil and cooked vegetables? American Journal Clinical Nutrition, 70: MAIANI, G., PAPPALARDO G., FERRO-LUZZI A., RAGUZZINI A., AZZINI A., GUADALAXARA A., TRIFERO M., FROMMEL T., and MOBARHAN S., Accumulation of beta-carotene in normal colorectal mucosa and colonic neoplastic lesions in humans. Nutrition and Cancer, 24: MARGOLIS S.A., SCHAPIRA R., Liquid chromatographic measurement of L-ascorbic acid e D-ascorbic acid in biological samples. Journal of Chromatography, 690: PÉREZ-LÓPEZ F.R., CHEDRAUI P., HAYA J., CUADROS J.L., Effects of the Mediterranean diet on longevity and age-related morbid conditions. Maturitas, 64: SHAHAR D.R., GROTTO I., Mediterranean diet and longevity. Current Nutrition Food Science, 2(4): SERAFINI, M., BUGIANESI, R., SALUCCI, M., AZZINI, E., RAGUZZINI, A., MAIANI, G., Effect of acute ingestion of fresh and stored lettuce (Lactuca sativa) on plasma total antioxidant capacity and antioxidant levels in human subjects. British Journal of Nutrition, 88: TRICHOPOULOU A., VASILOPOULOU E., Mediterranean diet and longevity. British Journal Nutrition, 84(2): S205-S209. VIOQUE J., WEINBRENNER T., CASTELLÓ A., ASENSIO L., GARCIA DE LA HERA M., Intake of fruits and vegetables in relation to 10-year weight gain among Spanish adults. Obesity, 16: WHO/FAO, Diet, nutrition and the prevention of chronic diseases. Technical Report, 916, Geneva, Switzerland. 8

26 Prugne ** P<0.01 Tab.1. Molecole bioattive in prugne coltivate e selvatiche Tab. 1. Bioactive compounds in cultivated and wild plums Luteina +Zeaxantina (mg/kg) β-carotene (mg/kg) Vitamina C (mg/100g) Coltivate 1.48± ± ±0.44 Selvatiche 1.38± ±1.11 ** 5.70±0.27 ** Tab. 2. Confronto tra le proprietà antiossidanti della cicoria selvatica e della cicoria commerciale (prodotto cotto). Tab. 2. Comparison of the antioxidant properties of wild and commercial chicory (cooked product). Provenienza del prodotto *** P<0.001 Cicoria di Pascolo Calabria Cicoria Commerciale FRAP (mmol/kg) TRAP(mmol/kg) 20.36±0.08 *** 26.71±1.04 *** 8.04± ±0.06 9

27 * nel prodotto bollito e cotto in padella la vitamina C non è rilevabile Fig. 1. Contenuto molecole bioattive di cicoria coltivata e selvatica cruda, bollita e ripassata in padella. Fig. 1. Content of bioactive molecules of cultivated and wild chicory raw and boiled. Tab. 3. Consumi medi delle classi alimentari* (g/die) in base alle classi MDS. Tab. 3. Average consumption of food classes * (g/die) based on MDS classes. Bassa (MDS 3) Qualità della dieta Media (MDS 4-5) Alta (MDS 6) Valori P % Cereali (g/die) 225 ± ± ± Verdura (g/die) 167 ± ± ± Legumi (g/die) 7 ± ± ± Frutta (g/die) 162 ± ± ± Pesce (g/die) 39 ± ± ± Carne (g/die) 161 ± ± ± Latte e derivati (g/die) 305 ± ± ± Alcool(g/die) 9 ± 11 8 ± 12 5 ± 10 n.s. Rapporto MUFA/SFA 1.8 ± ± ± *Food groups were adjusted to 2500 kcal for men and 2000 kcal for women Statistica: Anova. Fonte: Azzini et al.,

28 2.2. RACCOLTA DI SPECIE ORTICOLE NELLE AREE INTERNE DELLA BASILICATA COLLECTING VEGETABLE CROP GERMPLASM IN INLAND AREAS OF BASILICATA REGION Vincenzo MONTESANO 1, Giulio SARLI 1, D. NEGRO 1, G. LOGOZZO 2, P. SPAGNOLETTI ZEULI 2 1 Consiglio Nazionale delle Ricerche - Istituto di Genetica Vegetale - Centro Tematico per la Conservazione della Biodiversità Vegetale Mediterranea - Policoro (MT) 2 Università degli Studi della Basilicata - Dipartimento di Biologia, Difesa e Biotecnologie Agro-Forestali - Potenza Riassunto Al fine di salvaguardare la diversità biologica del germoplasma vegetale ortivo della Regione Basilicata, e per monitorare lo stato attuale dell erosione genetica, è stata condotta una missione di raccolta delle landraces e/o vecchie varietà conservate nelle aree interne. Per l identificazione dei siti da esplorare in ciascuno dei quattordici comuni individuati è stata adottata una strategia di campionamento basata sulla stratificazione del territorio sulla base della distribuzione della popolazione, tenuto conto anche della configurazione orografica; tramite software GIS, ogni territorio comunale è stato suddiviso in tre strata: 1. centri abitati, 2. gruppo di case, 3. casa isolata; per ognuna di queste tipologie sono stati individuati cinque siti da esplorare per un totale di 185. In 101 siti è stato possibile reperire germoplasma di specie orticole e gli agricoltori-custodi sono stati intervistati. In totale sono state raccolte 350 accessioni appartenenti prevalentemente ai generi Phaseolus, Capsicum e Lycopersicon. La ricerca ha evidenziato che le landraces sono conservate da agricoltori anziani (età media di 60 anni), che conducono aziende agricole isolate e che utilizzano sistemi produttivi tradizionali. Il 12% delle accessioni sono state raccolte nei centri abitati. Per salvaguardare questo ricco patrimonio genetico è ipotizzabile sviluppare una strategia di conservazione on farm. Parole chiave: raccolta di germoplasma, conservazione on farm, landraces di specie orticole Abstract To collect vegetable crop germplasm of Basilicata, South Italy, and to monitor the present risk of genetic erosion an expedition has been carried out in the inland areas. The whole territory of each selected town, by means of GIS software, was subdivided in three strata, based on the geographical distribution of population and on the orography and five sites were selected within: 1. city boundaries, 2. group of country houses, 3. isolated farm houses for a total of 185 sites. In 101 sites germplasm of vegetable crop species was gathered and the farmers-maintainers were interviewed. Altogether 348 vegetable crop accessions were collected, mainly of Phaseolus, Capsicum e Lycopersicon genus. Our research shows that landraces are mostly grown by elderly farmers (average age of 60 years), running isolated farms, using traditional farming systems; only 12% of the collected landraces was found in the groups of country houses. Keywords: germplasm collecting, on farm conservation, vegetable crop species landraces 11

29 Introduzione Le specie vegetali coltivate, nel corso dei millenni, si sono evolute in una grande molteplicità di forme che soddisfano le esigenze dell uomo-agricoltore. L adattamento ai molteplici ambienti di coltivazione ha determinato la costituzione di landraces spesso geneticamente eterogenee e differenziate, la cui distribuzione geografica è strettamente legata alle tradizioni culturali delle popolazioni che le coltivano (Frankel et al., 1995). In Basilicata i mutamenti sociali e tecnologici del secolo scorso hanno determinato una forte erosione di questo patrimonio genetico e landraces di molte specie sono sopravvissute prevalentemente in aree isolate geograficamente dove sono ancora praticate forme tradizionali di agricoltura. La Regione si caratterizza per un elevato livello di agro-biodiversità ancora presente sul suo territorio, specialmente nelle aree interne centro-occidentali (Piergiovanni e Laghetti, 1999). Per salvaguardare questo ricco patrimonio genetico è stato avviato un programma di ricerca e raccolta di germoplasma orticolo nelle aree interne regionali, con lo scopo di determinare la possibilità di conservazione on farm dell agrobiodiversità. Materiali e metodi Sulla base di precedenti missioni esplorative di raccolta nel Sud Italia, anche elencati in una checklist (Hammer et al., 1990), di ricerche bibliografiche (Laghetti et al., 1993, 1995, 2003; Masi et al., 1999; Figliuolo et al., 2001; Logozzo et al., 2001; Piergiovanni et al., 2000; Polignano et al., 2001a, 2001b) e di comunicazioni personali da ricercatori ed agricoltori esperti del posto sono stati individuati quattordici Comuni nelle province di Potenza e Matera dei quali nove della Basilicata Occidentale, mediamente ad altimetria più elevata e caratterizzati da una maggiore quantità di precipitazioni e con un agricoltura meno sviluppata, e cinque della Basilicata Centrale (Petrarca et al., 1999). Complessivamente i 14 Comuni individuati occupano una superficie di 1.268,75 km 2 e quasi tutti sono classificati nella zona altimetrica Montagna. La popolazione totale è abitanti, la densità media oscilla da 13,3 a 252,7 abitanti per km 2 e l indice di vecchiaia medio è di 150,9 % (Istat, 2001). Sono stati visitati i territori dei Comuni di: Atella, Baragiano, Cersosimo, Marsico Nuovo, Paterno, Rapone, Rionero in Vulture, Rotonda, Senise, Terranova del Pollino e Venosa per quanto riguarda la provincia di Potenza e Aliano, Stigliano e Tricarico per la provincia di Matera (Fig.1). Per l identificazione dei siti da esplorare in ciascun comune è stata adottata una strategia di campionamento basata sulla stratificazione del territorio comunale in base alla distribuzione della popolazione, tenuto conto anche della configurazione orografica. Il territorio di ciascun Comune è stato suddiviso, sulla base della concentrazione di abitanti, in tre strata: 1. centro abitato, 2. gruppo di case, 3. casa isolata. Per ogni tipologia, utilizzando il software GvSig 1.1, sono stati individuati cinque siti rappresentativi da esplorare. In ogni sito esplorato sono stati intervistati gli agricoltori e le informazioni raccolte sono state inserite in un database appositamente disegnato. Risultati e discussione Sul totale dei 210 siti previsti ne sono stati esplorati in totale 185 poiché in cinque Comuni non sono presenti siti del tipo "2. gruppo di case". In totale sono state raccolte 350 accessioni rappresentative di 10 famiglie botaniche (Cucurbitaceae, Leguminosae e Solanaceae in prevalenza, con valori del 20%, 15% e 10% rispettivamente), 28 generi (in prevalenza Phaseolus, Capsicum e Lycopersicon) e 38 specie (Tab. 1). 12

30 In media sono state reperite venticinque accessioni e nove specie per Comune (Tab. 2), in prevalenza conservate da agricoltori anziani (età media di 60 anni) che vivono nelle case isolate delle zone rurali. Pomodoro (Lycopersicon esculentum Mill.) e peperone (Capsicum annum L.) sono stati raccolti in quasi tutte le località tranne che nel territorio di Cersosimo. Altra specie molto diffusa è la zucca che non è stata trovata solamente a Paterno. Landraces di melanzana (Solanum melongena L.) sono state raccolte solo nei paesi situati nell area Sud-Ovest della Regione (Senise e Paterno). Il fagiolo (Phaseolus vulgaris L.) è risultato presente solo nella Basilicata occidentale ed in territori tra di loro vicini (Terranova del Pollino - Cersosimo - Rotonda, Marsico Nuovo - Paterno e Atella - Rionero in Vulture), facendo presupporre una diffusione della specie facilitata dalla contiguità territoriale e similarità degli ambienti di coltivazione. La maggior parte degli ecotipi sono stati reperiti in aziende agricole isolate (3. casa isolata) (47% delle accessioni raccolte e 45% delle specie) e che utilizzano sistemi produttivi tradizionali. Il 12% delle accessioni sono state raccolte nei centri abitati (Fig. 2). Dato che la persistenza nel tempo delle landraces è attribuibile al loro valore culturale, alle condizioni di isolamento geografico, alle preferenze estetiche ed organolettiche degli "agricoltori-custodi" (Brush e Meng, 1998), nonostante la loro più ridotta produttività rispetto alle varietà moderne, e dato che la conservazione on farm degli agricoltori non garantisce la loro stessa conservazione nel tempo, si potrebbe ipotizzare l'incentivazione economica degli agricoltori-custodi, al fine di sopperire la perdita economica che ne deriverebbe rispetto alla coltivazione delle più produttive varietà moderne. Bibliografia BRUSH S.B., MENG E., Farmers valuation and conservation of crop genetic resources. Genetic Resources and Crop Evolution, 45: FIGLIUOLO G., CANDIDO V., LOGOZZO G., MICCOLIS V., SPAGNOLETTI ZEULI, P.L., Genetic evaluation of cultivated garlic germplasm (Allium sativum L. and A. ampeloprasum L.). Euphytica, 121(3): FRANKEL O.H., BURDON J.J., PEACOCK W.J., Landraces in transit - the treat perceived. Diversity, 11: ISTAT, Censimento della popolazione e delle abitazioni. LAGHETTI, G., HAMMER, K., OLITA, G., P. PERRINO, Collecting vegetable crops in Basilicata, Italy. Plant Genetic Resources Newsletter, 96: LAGHETTI, G., HAMMER, K., BRANDI, M., CERBINO, D., OLITA, G., P. PERRINO, Ritrovamento di una coltivazione di melanzana africana. Informatore Agrario, 51: LAGHETTI, G., PERRINO, P., CIFARELLI, S., BULLITTA, S., HAMMER, K Collecting plant genetic resources in Italy, Plant Genetic Resources Newsletter, 136: LOGOZZO, G., MASI, P., DILUCA, M., VOLPE, N., PERRINO, P., SPAGNOLETTI ZEULI, P.L., Valutazione di germoplasma di cece coltivato (Cicer arietinum L.) di diversa origine geografica. In: Atti del VI Convegno Nazionale Biodiversità. Opportunità di Sviluppo Sostenibile. 6-7 Settembre, 2001, Bari, Italia (compendio: SE- PP-22). 13

31 MASI, P., FIGLIUOLO, G., SPAGNOLETTI ZEULI, P.L., Landraces of beans (Phaseolus vulgaris L.) collected in Basilicata, Italy. Plant Genetic Resources Newsletter, 119: PETRARCA, S., SPINELLI, F., COGLIANI, E., MANCINI, M., Profilo climatico dell Italia. In: Campania, Puglia, Basilicata. Vol 6. ENEA, Roma. PIERGIOVANNI A.R., GAETANO LAGHETTI, The common bean landraces from Basilicata (Southern Italy): an example of integrated approach applied to genetic resources management. Genetic Resources and Crop Evolution, 46: PIERGIOVANNI A.R., CERBINO D., BRANDI M., The common bean populations from Basilicata (Southern Italy). An evaluation of their variation. Genetic Resources and Crop Evolution, 47: POLIGNANO, G.B., DELLA GATTA, C., MARTIGNANO, F., ALBA, E., 2001a. Valutazione germoplasma autoctono di fava (Vicia faba L. tipo major). In: Atti del VI Convegno Nazionale Biodiversità. Opportunità di Sviluppo Sostenibile. 6-7 Settembre, 2001, Bari, Italia (compendio: SE-PP-17). POLIGNANO, G.B., UGGENTI, P., SCIPPA, G., ALBA, E., 2001b. Valutazione germoplasma autoctono di cicerchia (Lathyrus sativus L.). In: Atti del VI Convegno Nazionale Biodiversità. Opportunità di Sviluppo Sostenibile. 6-7 Settembre, 2001, Bari, Italia (compendio: SE-PP-20). Fig. 1. Comuni della Regione Basilicata esplorati per la raccolta di germoplasma di specie orticole. Fig.1. Explored towns Basilicata Region for collecting vegetable crop landraces. 14

32 Tab. 1. Germoplasma di specie orticole reperite nei 14 Comuni delle aree interne della Regione Basilicata Tab. 1. Vegetable crop germplasm collected in 14 Cities in internal areas of Basilicata Region Nome comune Specie Accessioni raccolte (n ) (%) Pomodoro Lycopersicon esculentum 69 19,71 Fagiolo Phaseolus vulgaris 66 18,86 Peperone Capsicum annum 58 16,57 /Peperoncino Zucca Cucurbita spp ,29 Mais Zea mays 15 4,29 Cima di rapa Brassica campestris 9 2,57 subsp.oleifera Zucchino Cucurbita pepo 9 2,57 Melone Cucumis melo 8 2,29 Prezzemolo Petroselinum sativum 7 2,00 Sedano Apium graveolens 6 1,71 Lattuga Lactuca sativa 5 1,43 Cipolla Allium cepa 4 1,14 Scarola Cichorium endivia 4 1,14 Rucola Eruca sativa 4 1,14 Senape Sinapis alba spp. alba 4 1,14 Cetriolo Cucumis sativus 4 1,14 Fava Vicia faba 4 1,14 Melanzana rossa Solanum aethiopicum 4 1,14 Finocchio Foeniculum vulgare 3 0,86 Girasole Helianthus annuus 3 0,86 Cavolo Brassica oleracea var. 3 0,86 capitata Lagenaria Lagenaria siceraria 3 0,86 Basilico Ocimum basilicum subsp. 3 0,86 minimum Bietola Beta vulgaris 2 0,57 Zucca Cucurbita pepo 2 0,57 Cece Cicer arietinum 2 0,57 Melanzana Solanum melongena 2 0,57 Porro Allium ascalonicum 1 0,29 Aglio Allium sativum 1 0,29 Cicoria catalogna Cichorium intybus 1 0,29 Cavolo broccolo Brassica oleracea var. 1 0,29 italica Cavolo verza Brassica oleracea var. 1 0,29 sabauda Anguria Citrullus lanatus 1 0,29 Frumento Triticum durum 1 0,29 Origano Origanum vulgare 1 0,29 Cicerchia Lathyrus sativus 1 0,29 Lenticchia Lens culinaris 1 0,29 Pisello Pisum sativum 1 0,29 Totale

33 Tab. 2. Numero di accessioni raccolte e specie rinvenute nei 14 Comuni esplorati della Regione Basilicata Tab. 2. Accession number and species collected in the 14 explored Cities of Basilicata Region Basilicata Occidentale Basilicata Centrale Comune Accessioni (n) Specie (n) Comune Accessioni (n) Specie (n) Rionero in vulture Venosa 11 5 Atella Tricarico 28 8 Rapone 12 3 Stigliano Baragiano Aliano 16 9 Marsico nuovo Senise Paterno 28 6 Rotonda 34 6 Terranova del pollino 41 9 Cersosimo 11 6 Totale Fig. 2. Frequenza delle accessioni raccolte (raggruppate per classi di specie) per tipo di insediamento. Fig. 2. Frequency of the collected accessions grouped for class of species. 16

34 2.3. CARATTERIZZAZIONE BIO-AGRONOMICA E MOLECOLARE DEL GERMOPLASMA FRUTTICOLO CAMPANO BIO-AGRONOMIC AND MOLECULAR CHARACTERIZATION OF FRUIT TREES GERMPLASM OF CAMPANIA REGION (ITALY) Milena PETRICCIONE, Teresa MIGLIOZZI, Maria Silvia PASQUARIELLO, Laura Rita CAPUANO, Ilaria DI CECCO, Donatella DI PATRE, Giovanni SCOGNAMIGLIO, Pietro REGA, Giuseppe CAPRIOLO, Marco SCORTICHINI C.R.A. - Unità di Ricerca per la Frutticoltura, Via Torrino, 3, Caserta, Riassunto Le particolari condizioni geo-pedologiche e climatiche della Campania hanno consentito lo sviluppo di una frutticoltura estremamente varia con la coltivazione di un ampia gamma di specie anche con esigenze termiche molto diverse tra loro. La riscoperta e lo studio di varietà frutticole locali, oltre a rappresentare un mezzo di salvaguardia di cultivar locali a rischio di erosione genetica, consente di arricchire l offerta del panorama varietale esistente, ampliando la gamma con varietà autoctone, potenzialmente caratterizzate da proprietà nutrizionali e salutistiche specifiche e non livellate su standard organolettici comuni. Nell ambito del progetto Network per la salvaguardia e la gestione delle risorse genetiche agro-alimentari (AGRIGENET), finanziato dalla Regione Campania nell ambito del PSR misura 214-azione f2, l Unità di Ricerca per la Frutticoltura si sta occupando del reperimento e della caratterizzazione bio-agronomica e molecolare di accessioni locali del germoplasma frutticolo di melo, ciliegio e pesco. In particolare, in questa prima fase del progetto, l attività di reperimento delle accessioni delle diverse specie frutticole, svolta nei diversi areali campani, ha consentito il recupero di buona parte del patrimonio varietale autoctono di melo e di ciliegio. Le metodiche di identificazione varietale comunemente utilizzate nelle specie frutticole, si basano sulle valutazioni delle caratteristiche fenologiche, agronomiche, biometriche e pomologiche che possono essere influenzate da condizioni ambientali e di coltivazione richiedendo, conseguentemente, numerosi anni di osservazioni e valutazioni per ottenere un giudizio definitivo. Il lavoro di reperimento e di caratterizzazione su base bio-agronomica appare pertanto importante e permette già di fornire alcune indicazioni utili sul comportamento di alcune delle accessioni portando all acquisizione di un considerevole numero di dati che si rivelano utili come descrittori del materiale in esame. A supporto di queste metodiche, le tecniche di marcatura del DNA rappresentato una valida alternativa per l identificazione varietale sia per il loro notevole potenziale discriminante fra genotipi, sia per la loro neutralità rispetto alle condizioni ambientali. L integrazione tra i dati bio-agronomici e molecolari consente di caratterizzare le diverse accessioni frutticole campane rispetto alle cultivar standard e mettere in evidenza, in maniera inequivocabile, casi di sinonimia ed omonimia tra le accessioni individuate. Parole chiave: melo, ciliegio, germoplasma, conservazione ex situ Abstract In Campania region (southern Italy), the particular soil and climatic conditions affect the cultivation of a wide range of fruit tree species with different requirements. The study and 17

35 possible valorization of local fruit crops, often including rare varieties/ecotypes, is an effective way for the preservation of germplasm under the risk of genetic erosion. At the same time, it allows to potentially increase the offer if particular traits such as organoleptic, nutritional an safe benefits are pointed out. Within the project "Network for the protection and management of genetic resources, agrofood (AGRIGENET)", financed by Campania Region (Italy) PSR 214-f2 action, the research unit for Fruit Trees (CRA) of Caserta, aims to carry out bio-agronomic and molecular characterization of the local germplasm of apple, sweet cherry and peach. In the first phase of the project, it was performed a survey of germplasm in different areas of Campania, mainly concerning apple and sweet cherry. The identification of cultivars/ecotypes is commonly based on the evaluations of phenological, agronomic, pomological and biometrics characters that, however, can be influenced by cultivation and environmental conditions and many years of observation and assessment are required to provide a definitive characterization. The bio-agronomic characterization appears important and can provide some useful information on the behavior of some of the varieties/ecotypes, and it also allows the acquisition of an relevant number of data that are useful in the cultivar descriptions. In support of these methods, the genetic characterization represents a valid alternative for the identification of varieties/ecotypes both for their great potential of discrimination between genotypes and for its neutrality with respect to environmental conditions. The integration of bio-agronomic and molecular data allows to characterize different cultivars/ecotypes and discover cases of synonymy and homonymy. Keywords: apple, sweet cherry, germplasm, ex situ conservation Introduzione In Campania la secolare forte vocazione frutticola è stata sempre basata su un vasto numero di varietà tradizionali adatte a precise condizioni pedoclimatiche e particolari tecniche colturali. Negli ultimi anni in risposta alle richieste di mercato, le vecchie cultivar sono state gradualmente sostituite da cultivar migliorate con una conseguente riduzione della variabilità genetica. Nonostante ciò alcuni studi dimostrano che molte cultivar tradizionali continuano a sopravvivere, spesso in aree marginali della nostra penisola (Moccia et al., 2004; Cavanna, 2008). La necessità di conservare l agrobiodiversità è ormai avvertita da tempo, e oggi ha assunto un significato più ampio che comprende la valorizzazione dei territori e lo sviluppo economico degli stessi. Conservare le risorse genetiche agrarie significa non solo salvaguardare alcune coltivazioni che caratterizzano un territorio ma anche il patrimonio culturale e l assetto paesaggistico e ecologico ad esse legate (FAO, 2001). L interesse per le antiche varietà frutticole è da metter in relazione alla necessità di conservare un patrimonio genetico unico, derivato dalla secolare saggezza dei coltivatori e selezionatori nazionali e locali. Le cultivar antiche a distribuzione locale costituiscono importanti risorse genetiche per incroci, in particolare al fine di conferire resistenza a parassiti e malattie, di migliorare l adattamento agli ambienti locali e di prevenire i rischi coinvolti nella monocultura di individui geneticamente identici (Harris et al., 2002). Esse possono infatti rappresentare una fonte di caratteri utili ai fini del miglioramento genetico; inoltre alcune sono incluse nei disciplinari per l ottenimento di produzioni tipiche protette dai marchi europei IGP e DOP. Una strategia di conservazione affidabile per il recupero delle vecchie cultivar è necessariamente conseguente ad un accurata individuazione delle stesse, che se affidata 18

36 esclusivamente alla morfologia, risente di svariati problemi. In primo luogo, vi è la difficoltà di distinguere cultivar pomologicamente molto simili; in secondo luogo, le antiche varietà possono avere elevata eterogeneità genetica, cui corrisponde elevata variabilità nelle caratteristiche agronomiche e pomologiche come forma, colore e tessitura dei frutti. Si rende pertanto indispensabile, affiancare alla caratterizzane bio-agronomica, una caratterizzazione mediante l uso di marcatori molecolari. Oltre a quanto appena sottolineato, i marcatori molecolari hanno, come vantaggi rispetto alle metodiche di altro tipo, elevata sensibilità, maggiore velocità e riproducibilità delle analisi (Guilford et al., 1997). Tra la grande quantità di marcatori molecolari disponibili, sono stati scelti i microsatelliti (Simple Sequence Repeat-SSR), che hanno già dimostrato la loro utilità nella discriminazione di cultivar commerciali di melo (Guilford et al., 1997; Liebhard et al., 2002). Materiali e metodi Analisi bio-agronomiche e pomologiche - Il reperimento delle accessioni è stato effettuato per le accessioni di ciliegio presso il campo di conservazione del germoplasma presso l Azienda Sperimentale Improsta di Eboli (SA) della Regione Campania, per le accessioni di melo presso il campo collezione del germoplasma della Regione Campania presso il vivaio forestale Fizzo di Airola-Bucciano (BN) oppure presso agricoltori custodi. Tutti i rilievi sono stati effettuati utilizzando descriptor list elaborati dai principali enti preposti alla caratterizzazione e conservazione del materiale vegetale (UPOV, IPGRI), adeguata alle principali caratteristiche pomologiche (forma e dimensione del frutto, peso unitario, colore della polpa e grado di succulenza, forma e dimensioni dei semi, lunghezza del peduncolo e facilità al distacco), dei caratteri della foglia e del fiore, delle caratteristiche dell habitus e di quelle fenologiche e di produttività delle piante. I frutti raccolti, di ogni varietà, sono stati trasferiti nel laboratorio di pomologia dell Unità di Ricerca per la Frutticoltura di Caserta e sottoposti ad analisi distruttive. Sono stati determinati i parametri fisico-chimici quali durezza, contenuto di solidi solubili espressi come Brix (mediante rifrattometro digitale Kruss), ph del succo e contenuto di acidi totali espressi come grammi/litro di acido malico, mediante titolazione con NaOH 0,1N. I dati rilevati sono stati sottoposti ad analisi statistica. Analisi molecolari - Il DNA è stato estratto da 0.2 g di giovani foglie di melo usando la procedura modificata descritta da Thomas e collaboratori (1993). Le analisi molecolari sono state condotte utilizzando cinque loci SSR riportati in Tab.1. La miscela di PCR, per l amplificazione è stata realizzata in un volume di 20 μl contenente 50 ng di DNA, 0.5 U di Taq-DNA polimerasi (AmpliTaq Gold, Applied Biosystems Inc., Foster City, Calif.), 2 μl di buffer PCR 10X (100 mm Tris-HCl, ph 8.3, 500 mm KCl), 2 mm MgCl2, 200 μm dntps e 0.5 μm di ogni primer. Le condizioni di PCR prevedevano: una fase iniziale di denaturazione a 95 C per 9 min seguita da 26 cicli ripetuti comprendenti: una fase di denaturazione (30 sec at 95 C), una fase di appaiamento dei primers ai due filamenti di DNA (annealing) (variabile a seconda del primer), e l ultima fase di estensione (90 sec at 72 C). Al termine dell ultimo ciclo è stata effettuata una fase finale di allungamento a 72 C per 30 min. I primers forward erano marcati con un fluorocromo (6- FAM o HEX), i prodotti di amplificazione sono stati analizzati usando un sequenziatore capillare ABI-PRISM 3130 (Applied Biosystems). I risultati della corsa sono stati processati con il software GeneMapper e la lunghezza degli alleli è stata stimata usando GeneScan-500 LIZ (Applied Biosystems). 19

37 Il dendrogramma, che rappresenta graficamente le similarità genetiche calcolate utilizzando l indice di Jaccard (Jaccard, 1908), è stato costruito mediante il metodo UPGMA (Unweighted Pair Group Method with Arithmetic average; Sneath e Sokal, 1973). Risultati e discussioni Melo - Complessivamente sono state individuate 39 vecchie cultivar di melo, 18 delle quali sono state caratterizzate dal punto di vista pomologico (Tab. 2) e su 7 sono state effettuate le prime analisi molecolari. I risultati ottenuti mettono in evidenza che in Campania si è differenziato un patrimonio genetico molto ricco e variegato. Le cultivar Austegna ed Agostinella Rossa sono le uniche due mele a maturazione estiva, mentre tutte le altre sono mele a maturazione autunnale ad eccezione di Bianca di Grottolella che risulta a maturazione invernale. Una notevole variabilità è stata analizzata tra le diverse cultivar in termini di dimensioni e forma del frutto. Molte delle accessioni hanno frutti piccoli con pesi medi inferiori ai 110 g, ad eccezione di Zampa di Cavallo e Trumuntana che presentano frutti molto grossi con pesi medi rispettivamente di 210±12 g e 260±15 g. La forma è appiattita nella cultivar Fierro mentre nelle altre è ellissoidale, sferoidale o tronco-conico breve. Molte delle accessioni presentano colore di fondo verde o giallo-verde e poche accessioni mostrano sovraccolore rosso. Zampa di Cavallo e Trumuntana, inoltre, presentano rugginosità diffusa e lenticelle grandi e rugginose sui frutti. La polpa è generalmente biancastra ad eccezione di Arito che presenta una colorazione verdognola. Nell ambito del progetto sono stati valutati anche su 4 ecotipi di Limoncella reperiti in diversi comuni della Campania. La Limoncella è una vecchia cultivar italiana che veniva coltivata diffusamente nell Italia centro Meridionale, i diversi ecotipi analizzati non mostrano differenze in termini di produttività, pezzatura e morfologia del frutto. Essi sono caratterizzati da un gusto acidulo infatti il contenuto di acidi titolabili risulta essere mediamente di 11,8±1,7 g/l acido malico. Le primi analisi molecolari sono state condotte su 7 delle cultivar identificate. Il dendrogramma (Fig. 1) ottenuto dalla cluster analisi mostra ampie differenze genetiche fra le accessioni di melo individuate, con due principali raggruppamenti A e B. Il cluster A è a sua volta articolato in 2 sub-cluster, il primo con molte delle cultivar analizzate e il secondo contenente la cultivar Sergente e alcune delle cultivar prese come riferimento (Renetta di Champagne, Red Chief). Il cluster B contenente le altre cultivar prese come riferimento (Renetta Grigia, Renetta del Canada e Golden B) e un caso di sinonimia. Dalle analisi molecolari, infatti, è emerso che la cultivar Zampa di Cavallo è triploide ed è un sinonimo della Renetta del Canada avvalorando quanto già emerso dalle osservazioni pomologiche. Ciliegio - Complessivamente sono state individuate 50 vecchie cultivar di melo, 27 delle quali sono state caratterizzate già dal punto di vista pomologico (Tab. 2). Il calendario di maturazione di queste accessioni ha un estensione non superiore alle cinque settimane. La dimensione dei frutti è variabile la maggior parte delle accessioni ha frutti medio-piccoli e medi. I valori medi oscillano da 3.73 ± 0.78 g per Corvina che è la cultivar con peso medio inferiore a Nera dura di Mugnano e Patanara con valori medi più elevati rispettivamente di 9.67 ± 0.95 g e 9.93 ± 0.81 g. La forma dei frutti più ricorrente è quella cordiforme seguita da quella reniforme. Nella maggior parte dei casi i frutti presentano una cicatrice stilare media o meio-piccola e peduncoli di lunghezza media o corta. Peduncoli lunghi sono stati riscontrati soltanto in 4 delle cultivar analizzate: Marfatana, Zuccarenella, Mulegnana Nera e Lauretana. Lo spessore del peduncolo è elevato in Bologna con valori di 2,7±0,8 m mentre nelle altre cultivar risulta di medio spessore con valori compresi tra 1,31±0,6 e 0,75±0,2 mm. Una notevole variabilità si riscontra nella colorazione della buccia con colorazioni che vanno dal 20

38 giallo-rosso al rosso scuro. Il colore della polpa varia dal giallo al rosso scuro. La consistenza della polpa è media o medio-elevata, ad eccezione delle cultivar Zuccarenella, Ciauzara e Lattacci dove la consistenza è scarsa. Conclusioni Nel complesso i primi risultati sulle caratteristiche bio-agronomiche e molecolari sono particolarmente interessanti in quanto hanno permesso di valutare la grande variabilità di caratteri esistenti tra le diverse cultivar analizzate sia di melo che di ciliegio. Dal punto di vista pomologico, dalle prime osservazioni sono apparse interessanti per il melo le cultivar Bianca di Grottolella (Fig. 2) e Zampa di Cavallo che potrebbero essere oggetto di riconsiderazione per incrementare la produzione da destinare al mercato locale che ancora apprezza notevolmente la tipicità dei prodotti dell agricoltura. Numerose le cultivar di ciliegio analizzate, alcune hanno buone caratteristiche organolettiche come Montenero, Nera di Mugnano (Fig. 3) e Bertiello. Nell ambito delle osservazioni effettuate alcuni caratteri, come la resistenza ai parassiti e alle manipolazioni, appaiono interessanti per poter utilizzare le accessioni in programmi di miglioramento genetico. Inoltre, per l importanza dei risultati ottenuti, sarebbe auspicabile estendere le osservazioni anche su altre caratteristiche della pianta come la produttività, la vigoria e l autocompatibilità. Le cultivar con particolari caratteri di pregio potranno essere valorizzate e reintrodotte in coltivazione, nell ambito di programmi di tutela dell agrobiodiversità e di valorizzazione del territorio. Bibliografia CAVANNA M., TORELLO MARINONI D., BOUNOUS G, BOTTA R Genetic diversity in ancient germplasm from northwest Italy. Journal of of Horticultural Science and Biotechnology, 83 (5): FOOD AND AGRICULTURE ORGANISATION International treaty on plant genetic resources for food and agriculture. Food and Agriculture Organisation of the United Nations, Rome, Italy. GIANFRANCESCHI L., SEGLIAS N., TARCHINI R., KOMJANC M., GESSLER C Simple sequence repeats for the genetic analysis of apple. Theoretical and Applied Genetics, 96: GUILFORD P., PRAKASH S., ZHU J.M., RIKKERINK E., GARDINER S., BASSET H., FORSTER R Microsatellites in Malus x domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics, 94: JACCARD P Nouvelles recherches sur la distribution florale. Bulletin de la Societé Vaudoise des Sciences Naturelles, 44: LIEBHARD R., GIANFRANCESCHI L., KOLLER B., RYDER C.D., TARCHINI R., VAN DE WEG E., GESSLER C Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.). Molecular Breeding, 10: SNEATH P. H. A., SOKAL, R. R Numerical Taxonomy. Freeman, San Francisco, CA. THOMAS M.R., MATSUMOTO S., CAIN P., SCOTT N.S Repetitive DNA of grapevine: classes present and sequences suitable for cultivar identification. Theoretical and Applied Genetics, 86:

39 Tab. 1. Caratteristiche dei microsatelliti utilizzati (Gianfranceshi et al., 1998; Liebard et al., 2002). Tab. 1. Microsatellite loci and primer information (Gianfranceshi et al., 1998; Liebard et al., 2002). Locus SSR CH01d08 CH01f02 CH01f07 CH02g09 CH03a04 Sequenze 5-3 F: TCCGCCGCTATAACACTTC R: ACTCTGGAGGGTATGTCAAAG F: ACCACATTAGAGCAGTTGAGG R: CTGGTTTGTTTTCCTCCAGC F:CCCTACACAGTTTCTCAACCC R: CGTTTTTGGAGCGTAGGAAC F:TCAGACAGAAGAGGAACTGTAT TTG R: CAAACAAACCAGTACCGCAA F: GACGCATAACTTCTCTTCCACC R: TCAAGGTGTGCTAGACAAGGAG Tipo di ripet. Perfetta Perfetta Perfetta Range (bp) N di alleli Eterozigosità (H) Gruppo di linkage 6 0, , ,75 14 Perfetta ,78 08 Perfetta ,89 05 Tab. 2. Elenco delle cultivar di melo e ciliegio dolce caratterizzate. Tab. 2. List of apple and sweet cherry cultivars characterized. Melo Apple 1) Agostinella Rossa 2) Arancio 3) Arito 4) Austegna 5) Bianca di Grottolella 6) Fierro 7) Latte 8) Limoncella 02 9) Limoncella 05 10) Limoncella 06 11) Limoncella 10 12) Martina 13) Monaca 14) S. Francesco 15) Sergente 04 16) Tenerella 17) Trumuntana 18) Zampa di Cavallo Ciliegio dolce Sweet cherry 1) Antuono 2) Bertiello 3) Bologna 4) Camponica 5) Cannamela 6) Cervone 7) Ciauzara 8) Cornaiola 9) Corvina 10) Della Calce 11) Don Vincenzo 12) Imperatore 13) Lattacci 14) Lauretana 15) Maiatica di Taurasi 16) Marfatana 17) Montenero 18) Mulegnana Nera 19) Mulegnana Riccia 20) Nera Dura di Mugnano 21) Paesanella 22) Pagliarella 23) Patanara 24) Pomella 25) S. Anna 26) Silvestre 27) Zuccarenella 22

40 Fig. 1. Dendrogramma, ottenuto mediante il metodo UPGMA usando il coefficiente di similarità di Jaccard, per le relazioni genetiche tra le cultivar e accessioni di melo analizzate. Fig. 1. Dendrogram showing genotypic similarities of local and commercial apple cultivar (UPGMA method and Jaccard coefficient). 23

41 Fig. 2. Bianca di Grottolella. Fig.2. Bianca di Grottolella (apple genotype). Fig. 3. Nera Dura di Mugnano. Fig.3. Nera Dura di Mugnano (sweet cherry genotype). 24

42 2.4. RECUPERO DI ECOTIPI LOCALI DI ALBICOCCO (PRUNUS ARMENIACA L.) IN PUGLIA GENETIC RESOURCES ECOTYPE OF PRUNUS ARMENIACA L. IN APULIA Girolamo RUSSO 1, Laura D ANDREA 1, Venturino BISIGNANO 2, Giambattista POLIGNANO 2 1 Dipartimento di Scienze Agro-Ambientali e Territoriali - Università degli Studi di Bari - Aldo Moro, via Amendola 165/A, Bari, Italia 2 Istituto di Genetica Vegetale, C. N. R., Via Amendola 165/A, 70126, Bari Riassunto L albicocco (Prunus armeniaca L.) è ampiamente coltivato nei paesi del Mediterraneo e in particolar modo in Italia rappresenta una delle colture frutticole più diffuse. Tra le regioni del Sud, particolarmente vocata alla coltivazione di tale specie è la Regione Puglia, in cui sono presenti molti ecotipi locali sia negli ambienti collinari che nelle zone costiere. Essi sono rappresentati il più delle volte da pochi individui che testimoniano un progressivo depauperamento del patrimonio genetico autoctono della specie, da ciò la necessità di salvaguardare il germoplasma attualmente presente in Puglia caratterizzato da una buona capacità di adattamento alle specifiche condizioni pedo-climatiche della regione. Tale specificità non è riscontrabile nelle cultivars oggi maggiormente utilizzate in Italia e provenienti da paesi esteri in cui sono state selezionate (USA, Francia, Nuova Zelanda, ecc.). Al fine di salvaguardare le risorse genetiche autoctone di questa specie, si è eseguita un accurata indagine regionale per individuare, reperire e.caratterizzare gli ecotipi raccolti. Successivamente è stata effettuata una selezione dei fenotipi più interessanti per descrittori agronomici e con frutti di potenziale interesse per caratteristiche organolettiche e commerciali di pregio. Nelle provincie di Bari, Brindisi e Taranto sono stati reperiti 25 ecotipi. Per ogni sito di campionamento i caratteri rilevati hanno riguardato una sola pianta al momento di piena maturazione con la raccolta di 20 frutti posizionati all altezza media della chioma ed orientati a Nord, Sud, Est ed Ovest. I caratteri rilevati sul frutto sono stati : forma, lunghezza, larghezza, spessore, colore della buccia, forma dell'apice ed aspetto della linea di sutura; in aggiunta sono stati misurati lo spessore della buccia, la resa e i solidi solubili totali della polpa e l aderenza della stessa al nocciolo. I dati sono stati sottoposti all'analisi univariata e multivariata: componenti principali e cluster analisi. Dall'analisi complessiva dei risultati è emersa una elevata variabilità per numerosi caratteri osservati. Le componenti principali hanno permesso un analisi della variazione totale concentrata per un valore superiore al 70% nelle prime tre componenti. Gruppi omogenei degli ecotipi ono stati identificati con l analisi a grappolo. Una rappresentazione sintetica della variazione complessiva stimata è stata ottenuta combinando l analisi delle componenti principali con la cluster analisi. In conclusione gli ecotipi studiati sparsi per il territorio pugliese, hanno evidenziato un elevato polimorfismo così come riportato per altre regioni italiane e che l'areale considerato costituisce una fonte ricca di germoplasma autoctono di albicocco con caratteristiche di pregio poco valorizzate e di potenziale interesse per i diversi utilizzatori. Parole chiave: albicocco, germoplasma, ecotipi, caratteri morfo-qualitativi Abstract In Apulia an immense one germplasm of apricot tree (Prunus armeniaca L.) is present often constituted from subjects selected and introduced in cultivation from the man in remote times, 25

43 than with passing of the time, but, it has been lost weight, as the traditional agricultural areas, have gone reshuffle. Pure of it is consolidated and unquestionable scientific relief, the germplasm of Apulia apricot tree is a patrimony however complex, of which it is known still little, in how much up to now it is proceeded to only estimate a part of it. Very many genotypes have gone lost, in how much hastily abandoned without to have been described do not give the prelocated scientific institutions; moreover, many areas of the area regional never have not been object of taken care of surveying. The conservation of the biodiversity has various objectives which: that one to avoid the loss, irreversible, of a genetic patrimony of assessed value, also scientific; to recover and to value ecotype that they could have commercial interest or to be in possession of interesting genetic characters (resistance to biotic and abiotic stresses). The scope of the search is that one to determine the bioagronomic value of the ecotype of apricot characterized, the quota existing variability for the observed parameters. Keywords: germplasm, ecotype, apricot, defence, morphological traits Introduzione L albicocco (Prunus armeniaca L.) è ampiamente coltivato nei paesi del Mediterraneo e in particolar modo in Italia rappresenta una delle colture frutticole più diffuse. Tra le regioni del Sud, particolarmente vocata alla coltivazione di tale specie è la Regione Puglia, in cui sono presenti molti ecotipi locali sia negli ambienti collinari che nelle zone costiere. Essi sono rappresentati il più delle volte da pochi individui che testimoniano un progressivo depauperamento del patrimonio genetico autoctono della specie, da ciò la necessità di salvaguardare il germoplasma attualmente presente in Puglia caratterizzato da una buona capacità di adattamento alle specifiche condizioni pedo-climatiche della regione. Tale specificità non è riscontrabile nelle cultivars oggi maggiormente utilizzate in Italia e provenienti da paesi esteri in cui sono state selezionate (USA, Francia, Nuova Zelanda, ecc.). Al fine di salvaguardare le risorse genetiche autoctone di questa specie, si è eseguita un accurata indagine regionale per individuare, reperire e caratterizzare gli ecotipi raccolti. Successivamente è stata effettuata una selezione dei fenotipi più interessanti per descrittori agronomici e con frutti di potenziale interesse per caratteristiche organolettiche e commerciali di pregio. Materiali e metodi Nelle provincie di Bari, Brindisi e Taranto sono stati reperiti 25 ecotipi. Per ogni sito di campionamento i caratteri rilevati hanno riguardato una sola pianta al momento di piena maturazione con la raccolta di 20 frutti posizionati all altezza media della chioma ed orientati a Nord, Sud, Est ed Ovest. I caratteri rilevati sul frutto sono stati : forma, lunghezza, larghezza, spessore, colore della buccia, forma dell'apice ed aspetto della linea di sutura; in aggiunta sono stati misurati lo spessore della buccia, la resa e i solidi solubili totali della polpa e l aderenza della stessa al nocciolo. Utilizzando le medie di 9 descrittori quantitativi del frutto è stata effettuata un analisi multivariata allo scopo di accertare e sintetizzare la diversità fenotipica totale presente negli ecotipi in collezione ed esaminare le relazioni tra le stesse. Le analisi sono state effettuate utilizzando le specifiche procedure (Principal components e cluster analysis) del programma SAS (1989). Per la cluster analysis è stato utuilizzato il metodo Ward s minimum variance ed il numero di gruppi più significativo è stato individuato attraverso un consenso mediato tra 26

44 i parametri statistici: R-squared (RSQ), pseudo-f (PSF) e pseudo-t 2 (PST 2 ). I risultati della cluster analysis sono stati combinati con l analisi delle componenti principali. Risultati e discussione La provenienza degli ecotipi e l epoca di maturazione, dalla 1 decade di giugno alla 3 decade di luglio, sono riportati nella Tab. 1. Le caratteristiche dei frutti, riportate in Tab. 2, evidenziano dimensioni differenti: piccoli (48%), medi (20%) e grandi (32%); la lunghezza varia da 49.5 mm nell ecotipo 3 a 23.6 mm nell ecotipo 12; la larghezza varia da 48.1 mm nell ecotipo 3 a 25.0 mm nell ecotipo 12; lo spessore varia da 45.0 mm nell ecotipo 2 a 21.7 mm nell ecotipo 7; il rapporto medio lunghezza/spessore è 1.1 e Il rapporto medio lunghezza/larghezza è 1.0; il colore della buccia è per lo più giallo o arancione; la forma del frutto in sezione frontale è per il 36% rotondo allungata e 32% oblunga. Le caratteristiche della polpa, riportate in Tab. 3, con lo spessore della polpa risulta in media 9.5 mm con oscillazioni da 13.7 mm nell ecotipo 3 a 4.1 mm nell ecotipo 18; i solidi solubili totali variano da 24.8 Brix nell ecotipo 15 a 11.2 Brix nell ecotopo 8; la resa in polpa espressa in percentuale è risultata massima con il 93.7 %. Le caratteristiche del nocciolo, riportate in Tab. 4, con le dimensioni: piccole (12%), medie (52%) e grandi (36%); la lunghezza varia da 30.4 mm nell ecotipo 24 a 17.0 mm nell ecotipo 12; la larghezza varia da 24.3 mm nell ecotipo 24 a 14.9 mm nell ecotipo 12; lo spessore varia da 15.3 mm nell ecotipo 24 a 10.0 mm nell ecotipo 12; il rapporto medio lunghezza/spessore è 2.0 e Il rapporto medio lunghezza/larghezza è 1.2; il gusto della mandorla e per il 32% dolce, 64% amaro e 4% neutro; la forma del nocciolo in sezione laterale è per il 40% ellittico-allargata. Per quanto riguarda l analisi delle componenti principali (Tab. 5) le prime tre componenti assommano una elevata quota di variazione (96%) con una netta prevalenza della prima (72%). In particolare, se consideriamo i coefficienti di associazione tra le variabili originali e quelle trasformate ( eigenvectors ) la prima componente indica differenze per lunghezza, larghezza e spessore del frutto, lunghezza del nocciuolo e spessore della polpa; la seconda componente evidenzia differenze per spessore e larghezza del nocciuolo e per la resa in polpa; Il contenuto in zuccheri è fortemente associato alla terza componente. In Tab. 6 sono stati riportati i parametri statistici ottenuti dalla cluster analysis. Il numero di gruppi più appropriato è stato individuato mediando tra i valori più alti ottenuti per l RSQ, il PSFR, e PST 2 e quello più basso del CCC. In corrispondenza di quattro gruppi la quota di varianza ad essi attribuibile è stata del 70% che rappresenta una quota sufficientemente alta. In Fig. 1 è riportato il pattern distributivo dei 25 ecotipi di albicocco rispetto alle prime tre componenti principali. Le distanze tra gli ecotipi riflettono la somma delle differenze basate sui nove descrittori utilizzati. Nella figura vengono indicati anche i cluster di appartenenza per meglio definire i singoli gruppi. I risultati dell analisi a grappolo effettuata sull intero set delle componenti principali ha determinato raggruppamenti la cui composizione e struttura viene riportata in Fig. 1 insieme ad una rappresentazione grafica delle distanze tra gli ecotipi studiati rispetto alle prime tre componenti principali (PRIN 1, PRIN 2 e PRIN 3). Sono stati identificati 4 gruppi significativi i quali da soli giustificano il 70% della variazione stimata tra i gruppi (R 2 ). La seconda componente evidenzia un pattern distributivo ridotto rispetto alle altre due. Il gruppo I include 6 ecotipi di cui 5 raccolti nella provincia di Bari e uno in quella di Taranto. Gli stessi sono risultati ben differenziati lungo le componenti principali 2 e 3 includendo due ecotipi (15 e 17) con elevato grado zuccherino. Il gruppo II è risultato costituito da 7 ecotipi provenienti dalla provincia di Taranto (n. 4) e di Bari (n. 3). Per questo gruppo le maggiori differenze sono associate alla terza componente principale. Nel III gruppo sono rappresentate le tre provincie Bari (13-14), Taranto (3-10) e Brindisi (2) con una distribuzione piuttosto 27

45 ravvicinata rispetto alle tre componenti principali. Similmente il IV gruppo è risultato costituito da 7 ecotipi di cui 5 provenienti dalla provincia di Taranto ed ha mostrato una differenziazione maggiore lungo la prima componente. Infine i descrittori qualitativi (dimensione, sapore ed epoca di maturazione) sono stati utilizzati come variabili di classificazione allo scopo di evidenziare le relazioni tra essi ed i descrittori quantitativi del frutto. L epoca di maturazione intermedia è prevalsa nel trend distributivo degli ecotipi. Al contrario la dimensione del frutto ha visto prevalere le classi piccolo e grande. Infine una più ampia e diversificata distribuzione è stata osservata per il sapore del frutto. Conclusioni Da un punto di vista pratico, e quale risultato atteso, la presente analisi ha dato ulteriore conferma dell ampia variazione presente nel germoplasma di albicocco in Puglia. Per tutti i caratteri stimati è stata osservata un ampia variazione, ma solo alcuni di essi hanno mostrato un significativo potere discriminante nel differenziare gli ecotipi. In particolare ricordiamo le dimensioni della drupa e il grado zuccherino. L analisi ha evidenziato la necessità di una più mirata valutazione con l inclusione di ulteriori descrittori ed una più ampia collezione onde poter tracciare un pattern distributivo sufficientemente attendibile della variazione disponibile. L analisi multivariata ha permesso con successo di quantificare e sintetizzare i livelli di similarità e dissimilarità tra gli ecotipi studiati. Tuttavia le informazioni ottenute, di certo non esaustive, risulteranno utili nel programmare le future indagini. Bibliografia BASSI D., PRONI L., MARTELLI S., PIRAZZINI P., Difesa e valorizzazione del germoplasma di albicocco in Emilia-Romagna. In: Congresso su "Germoplasma frutticolo. Salvagurdia e valorizzazione delle risorse genetiche", Alghero, settembre Carlo Delfino, Sassari : CHESSA I., NIEDDU G., MULAS M., Valutazione delle risorse genetiche in popolazioni locali di albicocco, ciliegio, mandorlo e susino. In: Congresso su "Germoplasma frutticolo. Salvagurdia e valorizzazione delle risorse genetiche", Alghero, settembre Carlo Delfino, Sassari: DELLA STRADA G., PENNONE F., FIDEGHELLI C., MONASTA F., COBIANCHI D., Monografia di cultivar di albicocco. Ministero dell Agricoltura e delle Foreste, Roma. FIDEGHELLI C., DELLA STRADA G., GRASSI F., SARTORI A., VITELLOZZI F., Il patrimonio genetico della specie Prunus armeniaca in Italia. Italus Hortus, 3: GODINI A., Le cultivar di albicocco della provincia di Bari. Annali della Facoltà di Agraria dell Università degli Studi di Bari, 24: 141: 163. GUERRIERO R., Il germoplasma italiano di albicocco: inventario, data bank e articolazioni regionali. In: Congresso su "Germoplasma frutticolo. Salvagurdia e valorizzazione delle risorse genetiche", Alghero, settembre Carlo Delfino, Sassari: GUERRIERO R. AND MONTELEONE P., Principali caratteristiche tassonomiche e agronomiche di 28 cultivar di albicocco italiane in pericolo di estinzione. In: Congresso su "Germoplasma frutticolo. Salvagurdia e valorizzazione delle risorse genetiche", Alghero, settembre Carlo Delfino, Sassari: PENNONE F., Il germoplasma dell'albicocco in Campania: individuazione e valutazione delle più interessanti varietà. In: Congresso su "Germoplasma frutticolo. Salvagurdia e valorizzazione delle risorse genetiche", Alghero, settembre Carlo Delfino, Sassari:

46 SANTANGELO I., CASATO G., FRANCO G., CARBONE M., Recupero, conservazione ed utilizzazione del germoplasma dell'albicocco in Campania. Italus Hortus, 3: RUSSO G., CORONA M.G., Crisommola : albicocco rupestre a rischio di estinzione. In: 5 Convegno Nazionale sulla Biodiversità. Belvedere di San Leucio, Caserta, 9-10 settembre 1999: RUSSO G., Albicocco: valorizzazione del germoplasma locale nella provincia di Bari. Presentato al Convegno: Biodiversità come risorsa. Udine, Dicembre [Libro dei riassunti: Poster, p. 88]. RUSSO G., RESTA P., Caratteristiche morfo-qualitative di ecotipi di albicocco individuati in Puglia. In: PORRETTA S. (a cura di). Ricerche e innovazioni nell industria alimentare. Atti del 5 Congresso Italiano di Scienza e Tecnologia degli Alimenti (5 C.I.S.E.T.A.). Villa Erba, Cernobbio (CO), Settembre Chirotti, Pinerolo. Vol. 5, pp RUSSO G., D'ANDREA L., Evaluation of Apricot Germplasm in Southern Italy. In: LAURENS F. E EVANS K. (a cura di). Proceedings of XI EUCARPIA Symposium on Fruit breeding and genetics. 1-5 September 2003, Angers (France). Acta Horticulturae, 663. Vol 2: RUSSO G., D'ANDREA L., Genetic resources of Prunus armeniaca L. in Apulia. In: Audergon J.M. (a cura di). Proceedings of XII th International Symposium on apricot culture and decline. Avignon (France), September 10-14, Acta Horticulturae, 701. Vol 1, pp RUSSO G., D'ANDREA L., Conservation and valorization of apricot local varieties. In: XILOYANNIS C. (a cura di). Proceedings of the XIV th International Symposium on Apricot Breeding and Culture. Matera, Italy, June Acta Horticulturae, 862: RUSSO G., D'ANDREA L., Pomological and qualitative characteristics of apricot fruits. In: XILOYANNIS C. (a cura di). Proceedings of the XIV th International Symposium on Apricot Breeding and Culture. Matera, Italy, June Acta Horticulturae, 862: RUSSO G., D'ANDREA L., Risorse genetiche dell albicocco in Puglia. Presentato al III Congresso Nazionale: Qualità del suolo, Alimenti e Salute, Napoli maggio [Libro dei riassunti, p. 31]. 29

47 Tab. 1. Provenienza ed epoca di maturazione. Tab. 1. Provenience and time of ripening. ecotipi provincia città epoca di anno maturazione 1 BR Oria 3 decade di giugno BR Oria 3 decade di giugno TA Palagiano 3 decade di giugno TA Martina Franca 3 decade di giugno TA Massafra 3 decade di giugno TA Gioia del Colle 3 decade di giugno TA Massafra 3 decade di giugno TA Massafra 3 decade di giugno TA Massafra 1 decade di luglio TA Massafra 1 decade di luglio TA Martina Franca 1 decade di luglio BA Altamura 1 decade di luglio BA Altamura 1 decade di luglio BA Altamura 1 decade di luglio BA Altamura 1 decade di luglio BA Sammichele 1 decade di luglio BA Sammichele 2 decade di luglio BA Altamura 1 decade di luglio BA Sammichele 3 decade di luglio TA Crispiano 3 decade di giugno BA Sammichele 1 decade di luglio TA Massafra 1 decade di giugno TA Massafra 1 decade di giugno BA Sammichele 2 decade di giugno TA Palagiano 3 decade di giugno 2001 Tab. 2. Caratteristiche morfologiche del frutto di 25 ecotipi. Tab. 2. Characteristcs morphologicals of fruit the 25 ecotypes. ecotipi dimensione (g) lunghezza larghezza spessore rapporto rapporto lunghezza/ lunghezza/ (mm) (mm) (mm) spessore larghezza colore buccia 1 piccolo 43.1 DE 40.0 E-G 36.4 F-H 1.19 A-F 1.08 A-C arancione 2 grosso 48.3 A 47.2 AB 45.0 A 1.08 E-I 1.03 B-G arancione 3 grosso 49.5 A 48.1 A 44.0 AB 1.13 C-G 1.03 B-F giallo-arancione 4 piccolo 33.9 HI 30.6 IJ 29.4 JK 1.15 B-G 1.11 AB arancione 5 piccolo 38.5 G 37.2 GH 34.1 G-I 1.13 C-G 1.04 B-F giallo-arancione 6 piccolo 42.2 D-F 37.0 GH 33.5 G-I 1.26 AB 1.14 A giallo-arancione 7 piccolo 26.9 J 27.3 JK 21.7 L 1.24 A-C 0.98 D-I giallo-arancione 8 medio 41.5 D-G 39.1 FG 32.5 H-J 1.28 A 1.06 A-E arancione intenso 9 piccolo 39.3 FG 40.6 D-G 36.7 E-G 1.07 E-J 0.97 F-I arancione chiaro 10 medio 49.2 A 46.6 AB 41.4 A-D 1.19 A-E 1.06 A-E arancione 11 medio 43.6 CD 44.2 A-D 38.6 C-F 1.14 C-G 0.99 D-I giallo-arancione 12 piccolo 23.6 J 25.0 K 22.5 L 1.05 G-J 0.94 G-I giallo 13 grosso 46.8 A-C 43.3 BE 39.5 C-F 1.19 A-F 1.08 A-C arancione intenso 14 grosso 47.9 A 45.1 A-C 40.6 B-E 1.18 A-F 1.06 A-E arancione 15 piccolo 26.4 J 27.3 JK 26.5 K 1.00 H-J 0.97 F-I giallo chiaro 16 medio 43.9 B-D 41.3 C-F 39.8 C-F 1.11 D-H 1.06 A-E giallo arancio 17 piccolo 35.1 H 34.7 H 31.5 IJ 1.12 D-H 1.01 C-H arancione giallo 18 piccolo 23.8 J 25.4 K 22.4 L 1.07 F-J 0.94 HI giallo arancio 19 piccolo 40.1 E-G 39.4 E-G 34.3 G-I 1.17 A-G 1.02 C-H giallo arancio 20 grosso 47.0 AB 44.0 A-D 41.8 A-D 1.12 C-G 1.07 A-D arancione intenso 21 piccolo 31.0 I 34.1 HI 32.6 H-J 0.95 J 0.91 I giallo 22 grosso 42.9 DE 46.4 AB 44.0 AB 0.98 IJ 0.93 I arancione chiaro 23 medio 38.7 G 39.6 E-G 39.3 C-F 0.99 IJ 0.98 E-I arancione 24 grosso 44.5 B-D 45.6 AB 42.5 A-C 1.05 G-J 0.98 E-I arancione intenso 25 grosso 47.1 AB 46.2 AB 38.4 D-F 1.23 A-D 1.02 C-H arancione -verde media

48 Tab. 3. Caratteristiche morfologiche della polpa del frutto. Tab. 3. Characteristcs morphologicals of pulp fruit. ecotipi spessore zuccheri resa in polpa (mm) ( Brix) (%) D-F 15.0 J 90.5 A-D A-C 14.0 L 91.1 A-D A 14.0 L 93.7 A H 17.1 H 83.2 F-H F 21.0 C 90.8 A-D FG 15.0 J 88.8 A-E I 14.9 JK 78.7 HI H 11.2 N 81.9 F-H EF 13.2 M 90.3 A-D AB 18.0 FG 93.0 AB B-E 14.0 L 92.2 AB I 18.1 F 81.0 GH D-F 13.0 M 88.1 B-E B-E 16.0 I 90.3 A-D I 24.8 A 74.5 IJ C-F 20.2 D 89.9 A-D GH 23.2 B 86.2 D-F I 17.3 GH 72.4 J F 19.4 E 89.4 A-D A-D 16.0 I 92.0 A-C H 16.9 H 84.3 E-G A-C 16.0 I 92.0 A-C EF 14.2 KL 89.3 A-E D-F 18.2 F 86.8 C-F B-E 19.3 E 90.4 A-D media Tab. 4. Caratteristiche morfologiche del nocciolo del frutto. Tab. 4. Characteristcs morphologicals of stone fruit. ecotipi dimensione (g) lunghezza larghezza spessore rapporto rapporto lunghezza/ lunghezza/ (mm) (mm) (mm) spessore larghezza sapore della mandorla 1 medio 26.0 C-E 18.4 H-J 12.4 B-F 2.11 B-D 1.42 A dolce 2 grosso 28.9 A 23.6 A-C 13.2 B-D 2.19 A-C 1.23 B-E amaro 3 grosso 26.4 BC 21.2 D-F 11.8 D-F 2.23 AB 1.24 B-E amaro 4 medio 24.7 C-G 17.3 JK 11.9 D-F 2.08 B-D 1.43 A amaro 5 medio 23.0 G-I 17.7 I-K 10.9 F-H 2.11 B-D 1.30 B amaro 6 medio 26.3 B-D 17.9 I-K 12.3 B-F 2.13 A-D 1.47 A amaro 7 piccolo 20.1 KL 16.2 KL 10.4 GH 1.94 C-E 1.24 B-E dolce 8 grosso 29.6 A 23.9 AB 13.5 BC 2.20 AB 1.24 B-E amaro 9 medio 23.8 E-H 20.4 D-H 11.6 E-G 2.05 B-D 1.16 D-H amaro 10 piccolo-medio 26.6 BC 20.8 D-G 12.0 C-F 2.21 AB 1.28 BC amaro 11 medio 24.0 D-H 20.4 D-H 11.6 E-G 2.07 B-D 1.18 C-G amaro 12 piccolo 17.0 M 14.9 L 10.0 H 1.71 EF 1.14 E-H dolce 13 grosso 30.0 A 23.7 A-C 12.9 B-E 2.37 A 1.26 B-D dolce 14 grosso 28.4 AB 22.0 B-E 13.1 B-D 2.18 A-C 1.29 B dolce 15 medio 20.3 J-L 19.1 G-J 12.3 B-F 1.66 F 1.06 H dolce 16 grosso 25.6 C-F 20.8 D-G 13.5 BC 1.89 D-F 1.23 B-E amaro 17 medio 22.3 H-J 20.1 E-H 11.7 D-G 1.90 D-F 1.11 F-H dolce 18 piccolo 18.9 LM 17.3 JK 11.0 F-H 1.73 EF 1.09 GH amaro 19 medio 24.4 C-H 19.4 F-I 12.1 C-F 2.02 B-D 1.26 B-D amaro 20 medio 25.9 C-E 21.4 D-F 12.6 B-E 2.08 B-D 1.22 B-E amaro 21 medio 21.4 I-K 20.1 E-H 12.4 B-F 1.73 EF 1.07 H dolce 22 grosso 23.6 F-H 21.8 C-E 13.6 B 1.75 EF 1.09 GH amaro 23 medio 24.7 C-G 21.1 D-G 12.2 B-F 2.03 B-D 1.17 C-G amaro 24 grosso 30.4 A 24.3 A 15.3 A 1.99 B-D 1.26 B-D neutro 25 grosso 26.5 BC 22.2 B-D 13.2 B-D 2.00 B-D 1.19 B-F amaro media

49 Tab. 5. Autovalori, autovettori e percento di variazione delle prime tre componenti principali stimati in 25 ecotipi di albicocco. Tab. 5. Eigenvalues, eigenvesctors and percent of variation accounted by the first three PCs. Descrittore PRIN 1 PRIN 2 PRIN 3 eigenvectors Lunghezza frutto Larghezza frutto Spessore frutto Lunghezza nocciuolo Larghezza nocciuolo Spessore nocciuolo Spessore della polpa Zuccheri Resa in polpa eigenvalues Variation (%) Variation cum. (%) Tab. 6. Parametri statistici della cluster analysis. Metodo della varianza minima di Ward. Tab. 6. Statistical parameters of Cluster analysis according Ward s minimum variance metod. CLUSTER RSQ CCC PSF PST

50 Cluster 1 Cluster 2 Cluster 3 Cluster 4 Fig. 1. Rappresentazione grafica dei 25 ecotipi di albicocco rispetto alle prime tre componenti principali e identificazione dei gruppi. Fig. 1. A graphic representation of the 25 ecotypes according the first three principal component (PCs) and identification of clusters. 33

51 2.5. MARCATORI DI QUALITÀ NUTRIZIONALE PER LA VALORIZZAZIONE DI LEGUMINOSE NAZIONALI TIPICHE MARKERS OF NUTRITIONAL QUALITY FOR THE VALORIZATION OF TYPICAL ITALIAN LEGUMES Marina CARBONARO 1, Mirella NARDINI 1, Paola MASELLI 2, Alessandro NUCARA 2 1 Istituto Nazionale di Ricerca per gli Alimenti e la Nutrizione (INRAN) - Via Ardeatina, Roma, 2 Dipartimento di Fisica, Università di Roma La Sapienza - P.le Aldo Moro Roma Riassunto La valenza nutrizionale delle leguminose è primariamente legata all elevato contenuto di proteine del seme (20-45% del peso secco), accumulate grazie alla capacità di batteri simbionti del genere Rhizobium, presenti nelle radici, di fissare l azoto atmosferico. A questa caratteristica si deve anche la capacità delle leguminose di potenziare la fertilità del suolo e la sostenibilità degli ecosistemi. Nonostante il riconosciuto ruolo nutrizionale e l importanza di queste colture nei sistemi di produzione ecocompatibile, in Italia le leguminose da granella hanno subito una costante riduzione delle superfici coltivate a vantaggio di colture più redditizie. È pertanto sempre più elevato il rischio di perdita di numerosi agroecotipi, con descritte caratteristiche di pregio, legati a forme tradizionali di agricoltura praticate essenzialmente in aree marginali. Numerosi progetti sono stati finanziati recentemente in ambito nazionale, finalizzati ad una migliore conoscenza delle proprietà distintive di alimenti tradizionali. La salvaguardia di ecotipi locali di leguminose a rischio di estinzione, fondamentale per la tutela della biodiversità, necessita di opportuni descrittori di qualità nutrizionale che possano differenziare questi prodotti da altri maggiormente consolidati sul mercato o di importazione. Si riportano, in particolare, alcuni risultati ottenuti dallo studio di ecotipi locali di lenticchie (Lens culinaris L.), coltivati in aree parco selezionate nell Italia centro-meridionale. La caratterizzazione chimico-nutrizionale ha preso in esame specifici marcatori di qualità, messi a punto nell ambito di ricerche svolte precedentemente su leguminose di diverse specie e volti a definirne non soltanto il profilo compositivo, ma anche la disponibilità all assorbimento di nutrienti e composti bioattivi - proteine, minerali, oligoelementi, composti fenolici - con potenziali effetti benefici sulla salute umana. I risultati ottenuti su lenticchie tradizionali provenienti dall area del Parco di Colfiorito (Perugia) e dal Parco Nazionale delle Alte Murge (Altamura, Bari), sono stati confrontati con quelli relativi alla lenticchia di Castelluccio di Norcia (Perugia) a marchio IGP (indicazione geografica protetta) e a varietà di lenticchie comuni reperite dal commercio. I risultati indicano che gli ecotipi locali possiedono caratteristiche nutrizionali distinte rispetto alla varietà commerciale della stessa specie. Tali proprietà sono evidenziabili mediante l analisi di specifici parametri chimico-fisici delle proteine del seme e dalla composizione in composti fenolici, correlati alle rispettive biodisponibilità. Parole chiave: legumi, prodotti tipici, qualità nutrizionale, proteine, composti fenolici Abstract Nutritional value of legumes is mainly related to their high seed protein content (20-45% on a dry weight basis), accumulated as a result of nitrogen fixation by Rhizobium symbiotic bacteria in the roots. This feature is also responsible for legume capacity to potentiate soil 34

52 fertility and sustainability of ecosystems. Despite nutritional role of legumes and their importance for eco-sustainable productions have been widely recognized, in Italy in the last decades cultivation areas have suffered a constant reduction because of switching towards more profitable crops. Therefore, the risk of loss of several local ecotypes with known valuable properties, that are essentially grown in marginal areas where traditional agricultural is practised, is increasing. Several national projects have recently been funded, aimed at increasing knowledge about peculiar properties of traditional foods. Safeguard of local legume ecotypes in danger of extinction, that are essential for biodiversity preservation, needs suitable markers of nutritional quality able to distinguish between these products and others that are more diffused on the market or imported. Results concerning local ecotypes of lentil (Lens culinaris L.), cultivated in Park areas in Central and Southern Italy are reported here. Chemical and nutritional characterization was carried out by using specific quality markers that have been set up during previous research on different legume species. These markers are aimed at evaluating not only compositional profile but also bioavailability of nutrient and bioactive compounds -proteins, minerals, trace elements, phenolics- with potential beneficial effect on human health. Nutritional properties of traditional lentils cultivated in Colfiorito Park (Perugia) and in National Park of Alte Murge (Altamura, Bari) were compared with those of both Castelluccio di Norcia (Perugia) lentil with PGI (Protected Geographical Indication) denomination and commercial common lentil varieties. Results indicated that traditional lentils show nutritional properties that are different from those of the commercial common lentil. These properties can be pointed out through analysis of specific chemico-physical parameters of seeed proteins and composition in phenolic compounds, related to their bioavailability. Keywords: legumes, typical products, nutritional quality, protein, phenolic compounds Introduzione Il consumo di alimenti vegetali ad alto contenuto proteico, tra cui numerose specie di leguminose da granella (fagiolo, pisello, cece, lenticchia), rappresenta una caratteristica distintiva di tutti i modelli alimentari dell area mediterranea. Numerosi effetti benefici sono stati recentemente associati a diverse frazioni proteiche contenute nel seme, nonché ai peptidi derivanti dalla digestione gastro-intestinale: prevenzione delle malattie dell apparato cardiocircolatorio e del diabete, ridotto rischio di contrarre neoplasie, generale aumento dello stato di benessere (Carbonaro, 2011; Rosa Lovati et al., 2012). A livello nazionale, negli ultimi decenni, si è assistito ad una drastica riduzione delle aree destinate alla coltivazione delle leguminose, soprattutto delle lenticchie (da a circa 2000 ettari), non compensato dall aumento delle rese, con conseguente incremento delle importazioni. È tuttavia aumentato, negli ultimi anni, l interesse verso le fonti vegetali proteiche in quanto essenziali nell agricoltura biologica e ben adattabili ad aree marginali dell Italia meridionale. È inoltre sempre crescente la domanda dei consumatori verso prodotti nazionali garantiti, soprattutto prodotti tipici, tradizionali e biologici. La salvaguardia dei numerosi ecotipi locali di leguminose ad elevato rischio di estinzione, essenziali per la conservazione della biodiversità, può avvalersi del riconoscimento della superiore qualità nutrizionale di tali prodotti rispetto ad altri coltivati su più ampia scala o di importazione. In questo contesto, lo sviluppo di strumenti volti alla certificazione congiunta di origine e di qualità di ecotipi di leguminose, nonché l applicazione di strategie di monitoraggio del mantenimento delle proprietà nutrizionali peculiari dei prodotti durante i 35

53 trattamenti precedenti il consumo, costituisce elemento essenziale per la promozione del patrimonio nazionale dei prodotti tradizionali. Vengono riportati alcuni risultati particolarmente significativi relativi alla caratterizzazione chimico-nutrizionale, realizzata mediante l utilizzo di marcatori specifici di qualità nutrizionale, di lenticchie (Lens culinaris L.) tradizionali provenienti dall area del Parco Regionale di Colfiorito (Perugia), dal Parco Nazionale delle Alte Murge (Altamura, Bari), a confronto con la lenticchia di Castelluccio di Norcia (Perugia) a marchio IGP (indicazione geografica protetta) e con varietà di lenticchie comuni reperite dal commercio. Materiali e metodi Lenticchie tradizionali provenienti dal Parco di Colfiorito (Perugia), dal Parco delle Alte Murge (Altamura, Bari) e lenticchie di Castelluccio di Norcia (Perugia) IGP sono state reperite presso aziende locali. La varietà di lenticchia comune commerciale è stata acquistata presso la grande distribuzione. Il contenuto in proteine totali (Nx6,25) è stato misurato con il metodo Kjeldahl (AOAC, 2005). La composizione in aminoacidi è stata ottenuta come descritto da Moore et al. (1958). Gli aminoacidi solforati e il triptofano sono stati quantificati seguendo le procedure di Schram et al. (1954) e Nielsen e Hurrell (1985), rispettivamente. Le determinazioni di struttura secondaria delle proteine sono state effettuate mediante spettroscopia a riflettanza diffusa nel medio infrarosso (DRIFT), tra 500 e 5000 cm -1. Dalla riflettanza diffusa sono stati ottenuti gli spettri di assorbimento, che sono stati poi analizzati mediante procedure di deconvoluzione e fitting (Fourier Self Deconvolution e multipeak fitting) (Kaupinnen et al., 1981). Il contenuto in polifenoli totali, disponibili e legati a proteine è stato misurato come descritto in Carbonaro et al. (2000) ed espresso in g equivalenti di acido tannico/100 g di peso secco. Il contenuto in acidi fenolici (vanillico, caffeico, p-cumarico e ferulico) è stato ottenuto come descritto in Nardini et al. (2002). Risultati e discussione Il contenuto in proteine totali delle varietà di lenticchie esaminate è risultato compreso tra 26,5 e 27,5% (p.s.). Non sono state riscontrate differenze significative tra gli ecotipi locali di lenticchie. Il valore più basso veniva osservato in corrispondenza della varietà di lenticchia comune commerciale. È stato quindi esaminato il contenuto in aminoacidi con differenti proprietà (basici, acidi, idrofobici e polari carichi), in quanto tale parametro, da studi eseguiti in precedenza, è risultato correlato alla funzionalità e alla biodisponibilità delle proteine di diverse specie di legumi, incluse le lenticchie (Carbonaro et al., 1997). Si può osservare un maggior contenuto in aminoacidi acidi e un minor contenuto in quelli idrofobici nel caso degli ecotipi Colfiorito e Castelluccio IGP rispetto alla lenticchia comune, con conseguente incremento della proporzione di residui carichi (CHGS) (Tab. 1). Gli ecotipi locali analizzati presentano quindi migliori proprietà funzionali e, di conseguenza, una maggiore biodisponibilità degli aminoacidi, rispetto alla varietà di lenticchia comune reperita dal commercio. In tutti gli ecotipi analizzati è stato possibile evidenziare un contenuto elevato di struttura a foglietto b ( cm -1 ) (30-34%), caratteristica distintiva delle proteine del seme dei vegetali (Carbonaro et al., 2008). Sono state inoltre misurate quantità variabili (10-15%) dei componenti a bassa frequenza ( cm -1 ) e di quelli ad alta frequenza ( cm -1 ), rappresentativi di complessi proteici a diverso grado di stabilità. La caratterizzazione di tali complessi sarà oggetto di ulteriori studi. 36

54 I risultati di studi recenti sulla biodisponiblità di composti fenolici hanno indicato che le interazioni tra le proteine di alimenti vegetali (legumi, cereali) e composti fenolici a diverso peso molecolare contenuti nel seme hanno profonde conseguenze sulla bioefficacia di questi ultimi (D Archivio et al., 2010). È stato pertanto quantificato il contenuto in polifenoli totali, disponibili e legati a proteine degli ecotipi di lenticchie e i risultati sono presentati nella fig. 1. Il contenuto in polifenoli totali è risultato maggiore negli ecotipi locali (Castelluccio IGP>Colfiorito/Altamura) rispetto alla varietà di lenticchia comune commerciale. Sono state inoltre evidenziate differenze significative nel contenuto in polifenoli disponibili e in quelli legati. In particolare, il contenuto in polifenoli legati è risultato inferiore nell ecotipo di Altamura rispetto agli altri ecotipi locali (Castelluccio IGP, Colfiorito). I risultati ottenuti dall analisi di specifici acidi fenolici - vanillico, caffeico, p-cumarico e ferulico - indicano marcate differenze tra gli ecotipi e, in particolare, una più alta concentrazione in acidi fenolici totali e disponibili nell ecotipo di Castelluccio IGP rispetto a quello di Colfiorito. Conclusioni Gli ecotipi locali di lenticchie analizzati (Colfiorito, Castelluccio IGP, Altamura) possiedono caratteristiche nutrizionali distinte rispetto alla varietà commerciale della stessa specie. Si riscontrano inoltre differenze tra le proprietà nutrizionali dei tre ecotipi esaminati. Tali proprietà sono evidenziabili mediante l analisi di specifici parametri chimico-fisici e strutturali delle proteine del seme, nonché dalla composizione in composti fenolici, correlati alle rispettive biodisponibilità. Ringraziamenti La ricerca è stata svolta in parte nell ambito del Progetto MiPAAF TERRAVITA- Biodiversità, Territorio e Nutrizione: la sostenibilità dell agroalimentare italiano. Bibliografia AOAC INTERNATIONAL, Official Methods of Analysis of AOAC International. 18 th ed., Gaithersburg, MD, USA. CARBONARO M., Role of pulses in nutraceuticals. In: Pulse Foods. Processing, quality and nutraceutical applications. Academic Press (Oxford): CARBONARO M., CAPPELLONI M., NICOLI S., LUCARINI M., CARNOVALE E., Solubility-digestibility relationship of legume proteins. Journal of Agricultural and Food Chemistry, 45: CARBONARO M., GRANT G., CAPPELLONI M., PUSZTAI A., Perspectives into factors limiting in vivo digestion of legume proteins: antinutritional compounds or storage proteins? Journal of Agricultural and Food Chemistry, 48: CARBONARO M., MASELLI P., DORE P., NUCARA A., Application of Fourier transform infrared spectroscopy to legume seed flour analysis. Food Chemistry, 108: D ARCHIVIO M., FILESI C., VARÌ R., SCAZZOCCHIO B., MASELLA R., Bioavailability of the polyphenols: status and controversies. International Journal of Molecular Sciences, 11: KAUPINNEN J.K., MOFFATT D.J., MANTSCH H.H., CAMERON D.G., Fourier self deconvolution: a method for resolving intrinsically overlapped bands. Applied Spectroscopy, 35:

55 MOORE S., SPACKMAN D.M., STEIN W.H., Chromatography of amino acids on sulphonated polystyrene resins. Analytical Chemistry, 30: NARDINI M., CIRILLO E., NATELLA F., SCACCINI C., Absorption of phenolic acids in humans after coffee consumption. Journal of Agricultural and Food Chemistry, 50: NIELSEN H.K., HURRELL R.F., Tryptophan determination of food proteins by HPLC after alkaline hydrolysis. Journal of the Science of Food and Agriculture, 36: ROSA LOVATI M., MANZONI C., CASTIGLIONI S., PAROLARI A., MAGNI C., DURANTI M., Lupin seed g-conglutin lowers blood glucose in hyperglycaemic rats and increases glucose consumption of HepG2 cells. British Journal of Nutrition, 107: SCHRAM E., MOORE S., BIGWOOD E.J., Chromatographic determination of cystine as cysteic acid. Biochemical Journal, 57: Tab. 1. Percentuale di aminoacidi con differente carattere e proporzione di residui carichi (CHGS) della lenticchia di Colfiorito, lenticchia di Castelluccio IGP e lenticchia comune commerciale (CV<7%). Aminoacidi basici: Lys, Arg, His. Acidi: Asp, Glu. Idrofobici: Ala, Leu, Ile, Met, Phe, Pro, Val, Trp. Polari non carichi: Gly, Ser, Thr, Tyr, Cys. Ecotipo Aminoacidi (%) Basici Acidi Idrofobici Polari CHGS Colfiorito 19,0 30,3 31,8 17,5 47,4 Castelluccio IGP 17,9 30,0 31,4 17,2 46,0 Lenticchia comune 17,3 28,0 32,8 17,0 43,4 38

56 g/100 g p.s. 1,2 1,0 0,8 0,6 0,4 Totali Disponibili Legati 0,2 0,0 Colfiorito Castelluccio Altamura Lenticchia comune Fig. 1. Contenuto in polifenoli totali, disponibili e legati a proteine della lenticchia di Colfiorito, lenticchia di Castelluccio IGP, lenticchia di Altamura e lenticchia comune commerciale (media di almeno tre determinazioni, CV<8%). 39

57 2.6. BIODIVERSITÀ TRA RAZZE OVINE PER LA PRODUZIONE DELL AGNELLO DA LATTE. 2. CARATTERISTICHE QUALITATIVE DELLE CARNI BIODIVERSITY AMONG SHEEP BREEDS TO PRODUCE SUCKLING LAMB. 2. MEAT QUALITY CHARACTERISTICS Francesco DIPALO 2, Marco RAGNI 1, Massimo LACITIGNOLA 1, Giuseppe MARSICO 1, Arcangelo VICENTI 1 1 Dipartimento di Scienze Agro-Ambientali e Territoriali - Università degli Studi di Bari, Via Amendola 165/A, Bari, 2 Dipartimento di Produzione Animale - Università degli Studi di Bari, Via Amendola 165/A, Bari Riassunto L obiettivo della ricerca è stato rivolto a valutare le caratteristiche fisiche e chimiche delle carni di 24 agnelli, 12 Leccesi (LEC) e 12 Comisani (COM) alimentati con latte materno (NAT) e latte artificiale (ART) sino all età di 35 giorni circa. Le carni degli agnelli Leccesi sono risultate essere più ricche in acqua (74,91% vs 73,76%) e meno in grasso (2,86% vs 3,75%). Relativamente alla tenerezza delle carni gli agnelli Leccesi hanno fornito carni più tenere quando provenivano dall allattamento artificiale (2,02 vs 2,60, kg/cm 2 ). Nei riguardi delle caratteristiche colorimetriche la luminosità, relativamente alla razza Leccese è risultata superiore alla Comisana (42,03 vs 41,29; P<0,05). Le carni provenienti della razza Leccese sono risultate meno rosse (a*) rispetto a quelle della Comisana (8,02 vs 8,53; P<0,05). Dal confronto tra le razze è emerso che gli agnelli Leccesi forniscono un Longissimus Lumborum con un indice del giallo (b*) superiore (P<0.05) a quello dei soggetti Comisani (8,83 vs 8,56). Gli agnelli alimentati con il latte artificiale hanno fornito carni con un valore di b* superiore (P<0,01) rispetto a quelli che poppavano latte materno (8,87 vs 8,51). Relativamente al profilo acidico rilevato nelle carni, la percentuale di acidi grassi saturi è risultata significativamente (P<0,01) più elevata nella dieta Naturale (43,72%) rispetto a quella Artificiale (35,83%). I valori dei monoinsaturi sono risultati più elevati nella dieta artificiale rispetto alla naturale (54,40% vs 46,79% ); quelli della Comisana (P>0,05) nei confronti della Leccese (51,45% vs 49,74%). I migliori gli indici salutistici di aterogenicità e trombogenicità sono stati forniti dai soggetti alimentati con allattamento artificiale (P<0,01). L allattamento naturale, rispetto all artificiale, determina nelle carni di agnelli Leccesi il miglior rapporto ω6/ω3 (4,01 vs 5,50; P<0,05). Il contenuto in colesterolo totale rilevato nel sangue e nel fegato degli agnelli alimentati con latte artificiale è risultato più contenuto (P<0,01) in entrambe le razze. Parole chiave: biodiversità, agnello leccese, allattamento, qualità della carne Abstract The aim of the present research was to evaluate the physical and chemical characteristics of meat of twenty-four suckling lambs, 12 Leccese lambs (LEC) and 12 Comisana lambs (COM) fed with ewe milk from mothers (NAT) or artificial milk (ART) and slaughtered at 35 days of age. Leccese meat from suckling lamb was significantly higher in water content (74.91% vs 73.76%) and lower in fat content (2.86% vs 3.75%). No significant differences were observed between the two breeds and feeding system on meat tenderness, but Leccese lambs, fed with 40

58 artificial milk, gave more tender meat (2.02 kg/cm 2 vs 2.60, kg/cm 2 ). Regarding the colour characteristics differences on Longissimus lumborum muscle were observed on lightness (L*) resulting significantly higher in suckling Leccese lambs compared to Comisana lambs (42.03 vs 41.29; P<0.05). A lower red index (a*) (8.02 vs 8.53; P<0.05) and a higher yellow index (b*) (8.83 vs 8.56; P<0.01) were found in Leccese breed lambs comparing to Comisana. Fatty acid profile of the meat showed a significant (P<0.05) higher incidence of saturated fatty acid in Naturale group (43.72%) comparing with Artificiale group (35.83%). Monounsaturated fatty acids in artificial diet compared to natural (54.40% vs 46.79%) and those of Comisana breed (P<0.05) comparing to Leccese (51.45% vs 49.74%) were higher. Atherogenicity and thrombogenicity indexes were better in suckling lamb fed with artificial milk (P<0.01). In Leccese lambs the better ratio ω6/ω3 was obtained when lambs were fed with ewe milk comparing to artificial (4.01 vs 5.50; P<0,05). Cholesterol content in the blood and liver was lower (P<0.01) in lambs fed with artificial milk in both breeds. Keywords: biodiversity, Leccese lamb, suckling, meat quality Introduzione L importanza della tutela della biodiversità animale è oggi ampiamente riconosciuta come dimostrano i programmi di conservazione messi in atto dai diversi Paesi, non ultimo la Misura Azione 7 per la "Tutela delle Biodiversità animale" pubblicata sul Bollettino Ufficiale della Regione Puglia n. 53 del 12/04/2012 con cui si prevede un premio per coloro che allevano razze autoctone e tra le quali è annoverata la pecora Moscia Leccese. Secondo il rapporto FAO The State of the World's Animal Genetic Resources 2007 circa il 20% delle razze bovine, ovine, suine, equine e avicole del pianeta sono attualmente a rischio d estinzione determinando una riduzione di variabilità genetica entro le popolazioni. I consumi domestici delle carni ovi-caprine fresche manifestano una considerevole propensione degli italiani all acquisto di carne di agnello (89%) rispetto a quella di capretto (11%) (ISMEA, 2011). Attualmente i consumi di carne rivenienti dalla specie suina, bovina ed avicola sono da considerare, in termini sia quantitativi che di valore economico, più rilevanti rispetto a quella ovi-caprina che si concentra principalmente in occasione delle festività natalizie e pasquali. Nel 2010, relativamente alla quantità di carni ovi-caprine fresche acquistate, il Meridione ha concentrato il 46% delle quantità acquistate, seguito dal Centro, inclusa la Sardegna (pari al 29% degli acquisti totali), dal Nord-Ovest (14%) e dall area del Nord-Est (11%) (ISMEA, 2011). In Italia e nell area mediterranea si è consolidata la produzione dell agnello da latte (Cianci et al., 1971), macellato con un peso vivo di circa di 8-12 kg, proveniente soprattutto da razze ovine a prevalente produzione di latte (Lanza e Biondi, 1990). Tale tendenza deriva da diversi fattori, tra cui principalmente il regime dei prezzi che privilegia nettamente la carne dell agnello da latte che viene precocemente macellato destinando il prezioso latte alla caseificazione. La moscia Leccese è una razza ovina autoctona pugliese originaria del Salento che fino ai primi anni 80 rappresentava una delle popolazioni di maggiore interesse nell Italia meridionale peninsulare; è da ritenersi a buona attitudine lattifera (Cianci et al., 1968), ma è stata anche migliorata incrociandola con razze autoctone ottenendo un tipo morfo-funzionale a taglia grande (detto Leccese del Capo o Capuana) che, se pur garantiva un agnello allo svezzamento di maggior peso e una maggior produzione di latte, mostrava una minore capacità di adattamento alle ridotte disponibilità delle essenze pabulari dei pascoli. Gli allevatori, spinti dall impulso della competizione commerciale, hanno cominciato ad introdurre progressivamente nei propri allevamenti 41

59 soggetti di altre razze di varia provenienza (Sarda e Comisana) a più spiccata vocazione lattifera, con buone doti di adattabilità ai diversi ambienti di allevamento e più remunerative dal punto di vista economico (Ambrosini et al., 2000; Cianci et al., 1971; Dario et al., 1991, Pinto et al., ; Gallo et al., ) fino quasi alla totale sostituzione della razza ovina Leccese. Secondo le classificazioni internazionali, la razza ovina Leccese rientrerebbe nella watchlist delle razze vulnerabili annoverando un numero di 653 capi di femmine adulte registrate al Libro Genialogico su tutto il territorio nazionale (ASSONAPA, 2011). La Comisana è una razza ovina la cui attitudine preminente è quella della produzione del latte e con buone rese in carne (Pino e Portolano, 1962). La scomparsa di una razza implica la perdita definitiva di quelle peculiarità tipiche dei prodotti ottenibili esclusivamente dalla razza stessa. Attualmente la sopravvivenza delle razze locali, dove ancora esistono, è legata a diverse motivazioni quali la loro rusticità cioè la migliore adattabilità a condizioni pedoambientali difficili ed a un più elevato valore di mercato delle loro produzioni tipiche (carne e prodotti caseari). Numerosi lavori scientifici mostrano come l effetto razza influisca sulle performance produttive e sulle caratteristiche qualitative delle carni degli animali da reddito (Marsico et al., 1995; Ragni et al., 1997; Vicenti et al., 1998; Ragni et al., 2001; Caputi Jambrenghi et al., 2001; Santos-Silva et al., 2002; Russo et al., 2003; Marino et al., 2008; Bulent et al., 2010;) e il tipo di allattamento (Rodriguez et al., 2008; Lanza et al., 2006; Napolitano et al., 2002). Inoltre gli agnelli da latte sono considerati alla stregua dei monogastrici, pertanto la composizione degli acidi grassi del grasso del latte materno assunto in fase di allattamento influenza fortemente la composizione acidica delle loro carni (Lane et al., 2000; Vicenti et al., 2001). I mercati alimentari sono diventati più globalizzati, con il risultato che i consumatori sono più attenti alla propria alimentazione ed apprezzano alimenti di più alta qualità e con una chiara identità regionale. La certificazione di provenienza della carne potrebbe consentire un maggiore aumento nel valore commerciale degli agnelli da latte prodotti in Italia, soprattutto quando provengono da razze autoctone, allevati al pascolo con sistemi tradizionali (Martini et al., 2009). Infatti gli agnelli da latte alimentati con latte materno di pecore allevate al pascolo (Scerra et al., 2006; Vicenti et al., 2004) hanno fornito carcasse meno grasse e di qualità migliore da un punto di vista nutrizionale. Le razze autoctone costituiscono un prezioso serbatoio genetico nelle singole aree geografiche in cui si sono selezionate garantendo la produzione di molti prodotti tipici sia sotto il profilo edonistico e della qualità delle produzioni e sia per lo sfruttamento di molte aree marginali. Lo scopo di tale lavoro è stato quello di mettere a confronto gli aspetti qualitativi delle carni ottenute da agnelli da latte di razza Leccese e Comisana alimentati con due sistemi di allattamento (naturale vs latte ricostituito) ed allevati nella zona murgiana del nord-ovest barese, zona tra le più vocate all allevamento ovino della Puglia. Materiali e metodi La prova è stata effettuata sulle carni prelevate da 12 agnelli Leccesi (6 allattati artificialmente e 6 allattati dalle madri) e da 12 Comisani (6 allattati artificialmente e 6 allattati dalle madri). Dalla lombata è stato prelevato il muscolo Longissimus lumborum (Ll) su cui sono stati determinati, in accordo con le indicazioni ASPA (1996), i parametri colorimetrici, mediante spettrofotometro HunterLab con illuminatore D65, e la resistenza al taglio, misurata con il test del Warner Bratzler Shear Force (WBS) mediante apparecchio Instron Dal muscolo, previa omogeneizzazione, sono stati prelevati campioni per la determinazione chimica centesimale (ASPA, 1996). Sul grasso estratto dai campioni di carne è stata eseguita l analisi degli acidi grassi. La frazione lipidica è stata estratta con cloroformio-metanolo 2:1 (Folch et al., 1957). Gli esteri metilici degli acidi grassi sono stati 42

60 preparati con BF3-metanolo al 12% ed analizzati con gascromatografia utilizzando una colonna capillare di vetro silicato (lunghezza 50 m, diametro interno 0,25 mm, spessore film 0,25 μm) operante a temperatura programmata da 140 C a 210 C con gascromatografo Chromopack, modello CP Sono stati inoltre calcolati gli indici di aterogenicità e di trombogenicità (Ulbricht e Southgate, 1991). Infine è stato determinato il colesterolo ematico e del tessuto epatico. I dati ottenuti sono stati elaborati con l analisi della varianza mediante procedura GLM (SAS, 1991) confrontando i valori medi stimati con il t di Student, valutando l effetto razza e dieta e la loro interazione. Risultati e discussione La composizione chimica del muscolo Longissimus lumborum (Tab. 1) ha fatto osservare nella Leccese una maggior umidità (P<0,05) rispetto alla Comisana (74,91% vs 73,76%). Il grasso intramuscolare nelle carni della Comisana è risultato significativamente più elevato rispetto a quello della Leccese (3,75% vs 2,86%; P<0,01) confermando quanto riscontrato nei rilievi alla macellazione (Ragni et al., 2012). Nessuna differenza è stata osservata relativamente ai due sistemi di alimentazione. Lo sforzo al taglio (Tab. 2), ha fatto registrare una maggiore e significativa (P<0,05) tenerezza delle carni di agnelli Leccesi alimentati con latte artificiale rispetto agli stessi alimentati con latte naturale (2,02 kg/cm 2 vs 2,60, kg/cm 2 ). Nei riguardi delle caratteristiche colorimetriche la luminosità delle carni della Leccese è risultata superiore alla Comisana (42,03 vs 41,29; P<0,05). I campioni della razza Leccese sono risultati meno rossi (a*) rispetto a quelli della Comisana (8,02 vs 8,53; P<0,05). Sono state evidenziate differenze significative nell indice b* nei riguardi degli effetti principali, razza e dieta, la Comisana rispetto alla Leccese ha presentato valori di 8,56 vs 8,83, mentre l allattamento artificiale ha determinato valori di 8,87 vs 8,51 del naturale. Il latte artificiale rispetto a quello prodotto dalla pecora Leccese e Comisana (Tab. 3), contiene una minore percentuale di acidi grassi saturi (56.27% vs 69.55% vs 73.05%) ed un più elevato contenuto in polinsaturi (7.39% vs 5.57% vs 4.33%). Questo risultato non è stato sorprendente, dal momento che i lipidi del latte artificiale provengono da grassi vegetali caratterizzati da una inferiore saturazione rispetto ai grassi animali (Napolitano et al., 2002). Relativamente al profilo acidico rilevato nelle carni (Tab. 4), la percentuale di acidi grassi saturi è risultata significativamente (P<0,01) più elevata nella dieta Naturale (43,72%) rispetto al quella Artificiale (35,83%). I valori dei monoinsaturi sono risultati più elevati nella dieta artificiale rispetto al naturale (54,40% vs 46,79%) quelli della Comisana (P>0,01) nei confronti della Leccese (51,45% vs 49,74%); In accordo con quanto rilevato da Lanza et al. (2006), Napolitano et al. (2002) la maggior presenza della componente satura nelle carni di agnelli da latte alimentati con latte materno potrebbe essere attribuita ad una maggiore presenza di acidi grassi saturi nel latte materno, rispetto al latte artificiale, probabilmente dovuto all attività di bio-idrogenazione ruminale da parte della pecora. Inoltre negli agnelli il rumine non è ancora funzionale e gli acidi grassi insaturi somministrati con la dieta non subiscono alcuna alterazione di bio-idrogenazione. In uno studio precedente (Cifuni et al., 2000) hanno riscontrato un crescente grado di saturazione delle carni in funzione della maggiore età di macellazione degli agnelli in conseguenza del progressivo sviluppo del rumine. Pertanto, il profilo acidico delle carni degli agnelli da latte può riflettere la composizione del latte ingerito (Kuhne, et al., 1986; Zygoyannis et al., 1992). Di conseguenza risultano migliori gli indici salutistici di aterogenicità e trombogenicità nei soggetti alimentati con allattamento artificiale (P<0,01). Per contro l allattamento naturale, rispetto all artificiale determina nelle carni di agnelli Leccesi il miglior rapporto ω6/ω3 (4,01 vs 5,50; P<0,05) i cui valori sono prossimi ai quelli 43

61 consigliati per la salute umana (Galli, 1999). Positivi infine i riscontri ottenuti sul colesterolo totale rilevato nel sangue e nel tessuto epatico (Tab. 5) degli agnelli alimentati con latte artificiale, risultato significativamente più contenuto (P<0,01) in entrambe le razze. Conclusioni I risultati ottenuti dalla presente prova permettono di aumentare le conoscenze sulla qualità delle carni ottenute da agnelli di razza Leccese. Le carni di agnelli Leccesi sono risultate più luminose, meno rosse e con un indice del giallo superiore ai soggetti Comisani. L allattamento artificiale determina nella razza Leccese una maggiore tenerezza delle carni ed un minore contenuto in grasso. La composizione acidica delle carni riflette quella del latte ingerito, infatti le carni degli agnelli alimentati con latte artificiale, rispetto al naturale, in ambedue i genotipi manifestano un maggior contenuto di acidi grassi insaturi. In entrambe le razze, l allattamento con latte ricostituito consente di ottenere carni di agnello dieteticamente più salutari per il consumatore potendo destinare maggiori quantità del prezioso latte ovino alla produzione di prodotti tipici locali. Bibliografia AMBROSINI F., CIANCI D., La resistenza genetica alle parassitosi gastro-intestinali nell allevamento ovino con particolare riferimento alla situazione in Italia. Obiettivi e Documenti Veterinari, 21 (2): 7-9. ASPA, Commissione di studio valutazione quanti-qualitativa della carne. Metodiche per la valutazione delle caratteristiche qualitative della carne. Università degli Studi, Perugia. BULENT E., MUSTAFA O., ALPER Y., CEMIL T., TÜRKER S., Carcass measurements and meat quality characteristics of dairy suckling kids compared to an indigenous genotype. Meat Science, (85): CAPUTI JAMBRENGHI A., RAGNI M., BOZZO F., VICENTI A., VONGHIA G., Razze autoctone pugliesi allevate sull alta Murgia: prestazioni produttive dell agnello da latte. In: Atti del VI Convegno Nazionale Biodiveristà, Bari: CIANCI D., BUFANO G., ZEZZA L., Studio biometrico della popolazione Moscia Leccese. Annali della facoltà di Agraria dell Università di Bari, 22(3): CIFUNI G.F., NAPOLITANO F., PACELLI C., RIVIEZZI A.M., GIROLAMI A., Effect of age at slaughter on carcass traits, fatty acid composition and lipid oxidation of Apulian lambs. Small Ruminant Research, (35): DARIO C., PIERAGOSTINI E., BUFANO G., PETAZZI F., La piroplasmosi negli ovini pugliesi: una malattia da scarso reddito. II. Morbilità e mortalità. Atti Fe Me SPRUM (1): GALLI C., Recenti acquisizioni sugli effetti favorevoli degli acidi grassi polinsaturi ω-3 sulla salute umana. Progress in Nutrition, (1): GALLO R., BUFANO G, VICENTI A., PINTO F., L adattabilità di popolazioni ovine alloctone sulla murgia barese. II La produzione di latte della pecora Leccese in purezza. Annali della facoltà di Agraria dell Università di Bari, 31: KUHNE D., FREUDENREICH P., RISTIC P., The fatty acid patterns of various animal species. 2. Fats of ruminants, rabbits and chicken. Fleischwirtschaft, 66: ISMEA, Report Economico Finanziario.Vol. III LANE M. A., BALDWIN R. L., JESSE B. W., Sheep rumen metabolic development in response to age and dietary treatments. Journal of Animal Science, 78:

62 LANZA A., BIONDI L., II Simposio Internazionale Nuove prospettive della Ricerca sugli Ovi-Caprini, Varese: LANZA M., BELLA M., PRIOLO A., BARBAGALLO D., GALOFARO V., LANDI C., PENNISI P., Lamb meat quality as affected by a natural or artificial milk feeding regime. Meat Science, 73: MARINO R., ALBENZIO M., ANNICCHIARICO G., CAROPRESE M., MUSCIO A., SANTILLO A., SEVI A., Influence of genotype and slaughtering age on meat from Altamurana and Trimeticcio lambs. Small Ruminant Research, 78: MARSICO G., CIRUZZI B., VONGHIA G., PINTO F., VICENTI A., LAUDADIO V., RAGNI M., PAPALEO C., Effetto dell'olio di cartamo sulle performance, sulla composizione chimica della carne e su quella acidica del grasso di agnelli di genotipo diverso. Zootecnia e Nutrizione Animale, 6: MARTINI A., FERRANTE V., LORENZINI G., ASCARI S., RICCIO F., SARGENTINI C., LOLLI S., BONELLI A., BRAGHIERI A., BARBIERI S., TOCCI R., GIORGETTI A., NAPOLITANO F., Welfare and meat quality of Limousine organic calves. In: Proceedings of de Conference: Knowing animals, Florence 5-6 March: 54. NAPOLITANO F., CIFUNI G. F., PACELLI C., RIVIEZZI A. M., GIROLAMI A., Effect of artificial rearing on lamb welfare and meat quality. Meat Science, 60: RAGNI M., VICENTI A., LESTINGI A., CAPUTI JAMBRENGHI A., VONGHIA G., Impiego delle buccette d uva per l alimentazione dell agnello da carne. Influenza sulle caratteristiche produttive e quanti-qualitative delle carni. Atti XII Convegno Nazionale A.S.P.A., Pisa, giugno 1997: RAGNI M., VICENTI A., MELODIA L., VONGHIA G., L impiego del lupino dolce nell alimentazione degli agnelli di razze autoctone pugliesi in alternativa alla soia. 1. Prestazioni produttive. Atti della Società Italiana delle Scienze Veterinarie, 55: RAGNI M., SCARPA G., MELODIA L., DIPALO F., VICENTI A., Biodiversità tra razze ovine per la produzione dell agnello da latte. 1. Rilievi in vita e post macellazione. In: IX Convegno Nazionale Biodiversità (in corso di stampa). RODRIGUEZ A.B., LANDA R., BODAS R., PRIETO N., MANTECON A.R., GIRALDEZ F.J., Carcass and meat quality of Assaf milk fed lambs: Effect of rearing system and sex. Meat Science, 80: RUSSO C., PREZIUSO G., TARANTOLA M., D AGATA M., SHIAVONE A., Qualitative characteristics of meat derived from Blonde d Aquitaine, Charolais and Piemontese veals. Annali della facoltà di medicina veterinaria di Pisa: SANTOS-SILVA, J., BESSA, R.J.B., SANTOS-SILVA, F., Effect of genotype, feeding system and slaughter weight on the quality of light lambs. II. Fatty acid composition of meat. Livestock Production Science, 77: SAS., SAS/STAT User s Guide. Version 6. 4 th ed. Vol 1. SAS Istitute, Cary, NC, USA. SCERRA M., CAPARRA P., FOTI F., GALOFARO V., SINATRA M.C., SCERRA V., Influence of ewe feeding systems on fatty acid composition of suckling lambs. Meat Science, 76: ULBRICHT, T.L.V., SOUTHGATE, D.A.T., Coronary heart disease: Seven dietary factors. The Lancet, 338: VICENTI A. RAGNI M., VONGHIA G., Atti del 4 Convegno Nazionale sulla Biodiversità. Valorizzazione della biodiversità ovina: performance produttive e caratteristiche quanti-qualitative delle carcasse e delle carni in agnelli Gentile di Puglia:

63 VICENTI A., RAGNI M., MELODIA L., CAPUTI JAMBRENGHI A., FACCIOLONGO A.M., VONGHIA G., Impiego di acidi grassi ω3 nell allattamento artificiale per la produzione del capretto. Zootecnia e Nutrizione Animale, 27: VICENTI A., COLONNA M.A., RAGNI M., TOTEDA F., Effect of type of suckling and polinsatured fatty acid use on lamb production. 2 Chemical and fatty acid composition of raw and cooked meat. Italian Journal of Animal Science, 3: ZYGOYANNIS D., KUIDIS D., KATSAOUNIS N., PHILLLIPS P., Fatty acid composition of carcass fat of indigenous (Capra Prisca) suckled Greek kids and milk of their does. Small Ruminant Research, 8: Tab. 1. Composizione chimica del Longissimus Lumborum (%). Tab. 1. Chemical characteristics of Longissimus Lumborum (%). DIETA RAZZA RAZZA X DIETA D.S.E. ART NAT G.L. ART NAT COM LEC COM LEC COM LEC = 20 Campioni n Umidità 74,69 73,97 73,76 b 74,91 a 73,94 75,44 a 73,58 b 74,37 1,343 Proteine 20,13 20,30 20,04 20,38 20,06 20,20 20,03 20,57 1,008 Grassi 3,10 3,51 3,75 A 2,86 B 3,66 A 2,53 B 3,84 A 3,18 0,646 Ceneri 1,22 1,18 1,27 a 1,14 b 1,30 A 1,13 B 1,22 1,14 B 0,087 A, B: P<0,01; a, b: P<0,05 Tab. 2. Caratteristiche fisiche del Longissimus Lumborum. Tab. 2. Physical characteristics s of Longissimus Lumborum. DIETA RAZZA RAZZA X DIETA ART NAT ART NAT COM LEC COM LEC COM LEC WBS Kg/cm 2 2,13 2,33 2,15 2,30 2,25 2,02 b 2,07 2,60 a L* 41,81 41,50 41,29 b 42,03 a 42,97 A 40,65 B 39,60 B a* 8,27 8,28 8,53 a 8,02 b 8,07 BC D.S.E. G.L. = 20 0,458 43,40 A 0,901 8,47 AB 8,99 A 7,56 C 0,505 b* 8,87 A 8,51 B 8,56 b 8,83 a 9,24 A 8,51 B 7,89 C 9,14 A 0,244 A, B, C: P<0,01; a, b: P<0,05 46

64 Tab. 3. Composizione acidica (%) del latte naturale ed artificiale. Tab. 3. Fatty acid composition (%) of natural and artificial milk. COM LEC ART SATURI 73,05 69,55 56,27 INSATURI 26,95 30,45 43,73 MUFA 22,62 24,88 36,34 PUFA 4,33 5,57 7,39 ω3 0,90 1,30 1,23 ω6 3,10 3,98 5,46 Tab. 4. Composizione acidica (%) del Longissismus Lumborum. Tab. 4. Fatty acid composition (%) of Longissimus Lumborum. DIETA RAZZA RAZZA X DIETA D.S.E. ART NAT G.L. ART NAT COM LEC COM LEC COM LEC = 20 35,67 35,99 42,34 45,11 SATURI 35,83 B 43,72 A 39,01 40,55 B B Ab Aa 2,126 54,78 54,02 45,46 MUFA 54,40 A 46,79 B 51,45 a 49,74 b A A 48,12 Ba Bb 1,821 PUFA 10,38 9,54 9,58 10,35 9,62 11,14 9,53 9,55 1,913 64,40 65,16 INSATURI 64,78 A 56,33 B 61,03 60,09 A A 57,66 B 55,00 B 2,342 ω3 1,72 1,79 1,74 1,77 1,85 1,59 1,63 1,95 0,579 ω6 7,71 7,14 7,16 7,70 7,37 8,05 6,95 7,34 1,255 ω6/ω3 4,77 4,38 4,40 4,76 4,05 5,50 a 4,75 4,01 b 1,281 I.A. 0,58 B 1,11 A 0,72 B 0,98 A 0,56 C 0,61 C 0,88 B 1,35 A 0,120 I.T. 0,92 B 1,27 A 1,05 1,13 0,91 B 0,93 B 1,20 A 1,33 A 0,154 A, B, C: P<0,01; a, b: P<0,05 Colest. Tot. mg/dl Colest. Fegato mg/100gr A, B: P<0,01; a, b: P<0,05. Tab. 5. Contenuto di colesterolo. Tab. 5. Cholesterol content. DIETA RAZZA RAZZA X DIETA D.S.E. ART NAT G.L. ART NAT COM LEC COM LEC COM LEC = 20 58,72 82,66 58,78 82,72 B A 70,73 70,65 58,75 B B A 82,61 A 12,31 300,25 353,08 309,33 291,16 357,50 348,66 B A 333,41 319,91 Bb B A Aa 26,91 47

65 2.7. LA BIODIVERSITÀ AGRARIA NELLE MARCHE: VALORIZZAZIONE NUTRIZIONALE DI LEGUMINOSE E CEREALI TIPICI BIODIVERSITY IN MARCHE: NUTRITIONAL QUALITY OF TYPICAL LEGUMES AND CEREALS Gianna FERRETTI 1, Tiziana BACCHETTI 1, Simona MASCIANGELO², Ambra MICHELETTI 2 1 Dipartimento di Scienze Specialisteche ed Odontostomatologiche, Università Politecnica delle Marche, Ancona, Italia, 2 Dipartimento di Scienze della Vita e dell Ambiente, Università Politecnica delle Marche, Ancona, Italia, 3 A.S.S.A.M. - Agenzia Servizi Settore Agroalimentare delle Marche, Osimo (AN), Italia, Riassunto La Regione Marche, nell ambito delle politiche di sviluppo, promozione e protezione degli agro-ecosistemi e delle produzioni di qualità, ha approvato la Legge Regionale 3 giugno 2003 n.12 Tutela delle risorse genetiche animali e vegetali del territorio marchigiano. La legge difende le risorse genetiche non più coltivate o allevate sul territorio regionale ma attualmente conservate presso Istituti sperimentali, Orti botanici, Banche del Germoplasma, Università e Centri di ricerca anche di altre Regioni o Paesi, per le quali esista un interesse economico, scientifico, ambientale, paesaggistico o culturale. L ASSAM (Agenzia per i Servizi nel Settore Agroalimentare delle Marche) cura l attuazione dei programmi pluriennali e annui in materia di tutela della biodiversità per il settore agricolo e gestisce i due strumenti operativi della Legge cioè il Repertorio Regionale e la Rete di Conservazione e Sicurezza. Nel Repertorio Regionale vengono iscritte le risorse genetiche autoctone a rischio di erosione. Lo studio si è prefisso di valorizzare da un punto di vista nutrizionale di legumi e cereali inseriti nel Repertorio Regionale. La ricerca è stata condotta sui seguenti prodotti : Cicerchia (Serra de Conti); Fagioli (Monachello, Solfino, Occhio di capra, Americano); Roveja (Appignano), Cece "Quercia" (Appignano); Fava (Fratte Rosa); Mais ottofile (Treia, Pollenza, Roccacontrada tipologia rosso e giallo). L analisi dei principali nutrienti ha confermato che i legumi e i cereali inclusi nello studio rappresentano una buona fonte di proteine e di carboidrati soprattutto complessi e di fibra alimentare. La valorizzazione nutrizionale dei legumi e cerali ha incluso anche la valutazione dei livelli di alcuni fitonutrienti come polifenoli e carotenoidi e delle loro proprietà antiossidanti. Infatti questi fitonutrienti oltre a conferire colore e proprietà organolettiche ai vegetali, hanno anche un interesse nutrizionale. I risultati hanno evidenziato una variabilità nei livelli di fitonutrienti nelle diverse varietà di legumi e cereali inclusi nello studio e hanno dimostrato che la maggior parte di essi rappresentano una buona fonte di fitonutrienti. In conclusione i risultati ottenuti dimostrano che gli alimenti tipici della nostra regione, oltre a costituire un patrimonio culturale di notevole importanza, hanno una elevata qualità nutrizionale e pertanto il loro consumo potrebbe avere ricadute positive per l ambiente, per il mantenimento della biodiversità e per la salute. Parole chiave : biodiversità, proprietà nutrizionali, antiossidanti, cereali, legumi 48

66 Abstract Marche Region, as part of development policies, promotion and protection of agroecosystems and production of quality, approved June 3, 2003 the Regional Law No. 12 "Protection of animal and plant genetic resources of the Marche". The law protects the genetic resources that are no longer grown or reared within the region and that now are preserved by experimental institutes, botanical gardens, gene banks, universities and research centers also of other regions or countries, for which there is an economic, scientific, environmental, landscaping or cultural interest. A.S.S.A.M. (Agency for Food Service Industry in the Marche) is involved in the implementation of programs for the protection of biodiversity for agriculture and manages two instruments: the Regional Repertory and the Network of Regional Conservation and Safety. Aim of the study was to investigate the nutritional qualities of legumes and cereals included in the Regional Repertory. The research was conducted on the following products: Cicerchia (Serra de Conti), Beans (Monachello, Solfino, Occhio di capra, Americano); Roveja (Appignano), Cece " Querchia" (Appignano), Fava (Fratte Rosa) and Corn (Treia, Pollenza, Roccacontrada type red and yellow). The analysis of macronutrients confirmes that legumes and cereals included in the study represent a good source of protein and complex carbohydrates and dietary fiber. The study has also included the evaluation of the levels of phytonutrients such as polyphenols and carotenoids and their antioxidant properties. The results show a variability in the levels of phytonutrients in the different varieties of legumes and cereals included in the study and have shown that most of them represent a good source of phytonutrients. In conclusion, the results demonstrate that the typical food of Marche, besides being a very important cultural heritage, have a high nutritional quality, and therefore their consumption may have positive consequences for the environment, for the maintenance of biodiversity and health. Keywords: biodiversity, nutritional properties, antioxidants, cereals, legumes Introduzione La Regione Marche, nell ambito delle politiche di sviluppo, promozione e protezione degli agro-ecosistemi e delle produzioni di qualità, ha approvato la Legge Regionale 3 giugno 2003 n.12 Tutela delle risorse genetiche animali e vegetali del territorio marchigiano. La legge difende le risorse genetiche non più coltivate o allevate sul territorio regionale ma attualmente conservate presso Istituti sperimentali, Orti botanici, Banche del Germoplasma, Università e Centri di ricerca anche di altre Regioni o Paesi, per le quali esista un interesse economico, scientifico, ambientale, paesaggistico o culturale. L ASSAM (Agenzia per i Servizi nel Settore Agroalimentare delle Marche) cura l attuazione dei programmi pluriennali e annui in materia di tutela della biodiversità per il settore agricolo e gestisce i due strumenti operativi della Legge cioè il Repertorio Regionale e la Rete di Conservazione e Sicurezza. Nel Repertorio Regionale vengono iscritte le risorse genetiche autoctone a rischio di erosione. In tale ambito lo studio si è prefisso di valorizzare da un punto di vista nutrizionale una serie di legumi e cereali inseriti nel Repertorio Regionale. La ricerca è stata condotta sui seguenti prodotti : Cicerchia (accessione di Serra de Conti); Fagioli (Monachello, Solfino, Occhio di capra, Americano); Roveja (accessione di Appignano), Cece "Quercia" (accessione di Appignano); Fava (accessione di Fratte Rosa); 4 tipologie di Mais ottofile (accessioni di Treia, Pollenza, Roccacontrada tipologia rosso, arancio e giallo). 49

67 La valorizzazione nutrizionale di questi prodotti tipici ha incluso la valutazione dei livelli dei principali nutrienti (carboidrati, lipidi, proteine) e dei livelli di alcuni fitonutrienti. Con questo termine ci riferiamo a sostanze sintetizzate nelle piante e presenti in quantità e qualità diverse nei vari alimenti. Alcuni di questi fitonutrienti tra cui i polifenoli e carotenoidi, infatti, oltre a conferire colore e proprietà organolettiche ai vegetali, hanno anche un interesse nutrizionale poiché sono sostanze biologicamente attive e svolgono ruoli regolatori del metabolismo e di funzioni cellulari (Kriushnapriya et al., 2012; Vasanthi et al., 2012). Numerosi studi hanno investigato i meccanismi molecolari con cui i fitonutrienti esercitano il loro effetto protettivo ed antiossidante ed è stato dimostrato che la maggior parte di essi è biodisponibile cioè viene assorbito dopo l assunzione con i pasti. Infatti studi condotti in vivo hanno dimostrato un aumento dei livelli di antiossidanti dopo un pasto contenente frutta o verdura (Polidori et al., 2009) ed è emersa una relazione inversa tra consumo di fitonutrienti (polifenoli e carotenoidi) e markers di danno ossidativo e di infiammazione (Holt et al., 2009; Martínez-Tomas et al., 2012). Pertanto lo studio delle proprietà nutrizionali e del contenuto in antiossidanti permette quindi di caratterizzare in modo completo le proprietà nutrizionali di un alimento. Materiali e metodi Descrizione dei campioni inclusi nello studio - La ricerca è stata condotta sui seguenti legumi inseriti nel Repertorio Regionale: Cicerchia (accessione di Serra de Conti); Fagioli (Monachello, Solfino, Occhio di capra, Americano); Roveja (accessione di Appignano), Cece "Quercia" (accessione di Appignano); Fava (accessione di Fratte Rosa). Inoltre sono state considerate alcune varietà di mais iscritte nel Repertorio Regionale: il mais ottofile di Treia, il mais ottofile Pollenza, il mais ottofile di Roccacontrada tipologia rosso e giallo. Ciascun prodotto è stato caratterizzato dal punto di vista della composizione in carboidrati, proteine, lipidi e fibra. Per quanto riguarda i lipidi, lo studio ha previsto anche una dettagliata analisi della composizione in acidi grassi. Preparazione del campione - I campioni (circa 0.5g) sono stati ridotti a farina e incubati in presenza di acetone 50% per 20 ore e successivamente centrifugati a 3000 rpm a 4C per 20 minuti. Gli estratti sono stati diluiti in modo da ottenere le condizioni ottimali per il dosaggio dei fenoli totali e delle proprietà antiossidanti. Determinazione del contenuto totale dei fenoli - Il contenuto dei fenoli nei diversi campioni di mais e legumi è stato determinato mediante Folin-Ciocalteu assay. In particolare 25µl di estratto vengono aggiunti a 1,5 ml di acqua distillata, 0,125ml di reagente Folin-Ciocalteu e 0,350ml di NaCO 3 20%. L assorbanza è stata valutata a 765 nm dopo 2 ore di incubazione. Il contenuto totale di fenoli è espresso come equivalenti di acido gallico su 100 grammi di campione (Xu et al., 2007). Valutazione potenziale antiossidante totale - La valutazione del potenziale antiossidante totale degli estratti di legumi e di mais è stata effettuata mediante Orac (Oxygen radical absorbance capacity) assay come riportato da Gillespie et al. I risultati sono espressi in µmoli di equivalenti Trolox (Gillespie et al., 2007). Determinazione della capacità antiossidante nei confronti delle LDL - La valutazione della capacità antiossidante degli estratti di mais e dei legumi è stata condotta utilizzando la cinetica di perossidazione delle lipoproteine a bassa densità (LDL) isolate da plasma umano (Ferretti et al., 2010). Le incubazioni sono state condotte a 37 C in presenza di ioni rame (5 M). Nelle LDL ossidate in assenza (controllo) o in presenza di estratti, la cinetica è stata eseguita mediante le valutazione della formazione dei dieni coniugati e calcolo della lag-time (Esterbauer et al., 1989). 50

68 Carotenoidi - La caratterizzazione e la quantificazione dei carotenoidi presenti nei diversi campioni mais sono stati identificati quantificati mediante il metodo HPLC-UV detection come riportato da Scott et al. (2005). Risultati Caratteristiche composizionali e nutrizionali - Come riassunto nella Tab. 1 nei legumi inclusi nello studio (Fagioli, Roveja, Cicerchia, Fava e Cece), i carboidrati costituiscono circa il 60% del loro peso secco, mentre nel mais essi rappresentano circa 75% del loro peso secco. Le proteine sono presenti con una percentuale, rispettivamente, di circa 25% e 8 % nei legumi e nel mais. Nel mais i lipidi costituiscono circa il 3-5% del peso secco. Il contenuto di fibra nei legumi inclusi nello studio è circa il 25%, mentre nei campioni di mais il contenuto è compreso tra 7-8%. Livelli di polifenoli e carotenoidi - I livelli di composti fenolici totali nelle diverse varietà di fagioli inclusi nello studio mostrano una elevata variabilità con valori compresi tra mg/100gr. Nella Cicerchia e nel Cece Quercia i livelli di fenoli sono 121±21 mg GAE/ 100g e mg GAE/100g, rispettivamente. Elevati livelli di fenoli si sono osservati nella Roveja. (Tab. 2) I livelli di composti fenolici totali nei campioni di mais inclusi nello studio sono compresi tra mg GAE/100g del Mais Pollenza e mg GAE/100g del Mais Roccacontrada varietà rossa. Nella Tab. 2 sono indicati i livelli di carotenoidi valutati in diverse varietà di mais. Il contenuto di carotenoidi totali nelle varietà di mais incluse è circa 3mg/Kg (Tab. 3). La caratterizzazione più dettagliata della composizione dei carotenoidi nelle diverse varietà di mais emerge che la zeaxantina, l alfa criptoxantina, la luteina e il beta carotene sono i principali rappresentanti (Tab. 3). Potere antiossidante - Come mostrato nella Fig. 2, le diverse varietà di fagioli inclusi nello studio mostrano valori di potenziale antiossidante totale (PAT) compresi tra i 77571±256 mol TE/100g del fagiolo Americano e i 3761±321 del fagiolo Solfino (Tab. 2). La Roveja presenta un potere antiossidante simile a quelli dei fagioli (Tab. 2). Valori inferiori si sono osservati nella Cicerchia e nel Cece Quercia. (Tab. 2). Allo scopo di indagare il ruolo protettivo degli estratti ottenuti dalle diverse varietà di legumi e di mais, è stata studiata la cinetica di formazione dei dieni coniugati nelle LDL ossidate in presenza o in assenza degli estratti. Il valore della lag-time nelle LDL ossidate (ox-ldl) in assenza degli estratti era di 69±12minuti. Valori della lag-time significativamente più elevati sono stati ottenuti nelle LDL ossidate in presenza degli estratti (Fig. 1). La significativa correlazione positiva stabilita tra i livelli di composti fenolici e i valori di PAT (r=0.93, n=12, p<0,001) e la durata della lag-time delle LDL ossidate in presenza degli estratti (r=0.88, n=12, p<0,001) dimostra che i composti fenolici svolgono un ruolo importante nelle capacità antiossidanti dei campioni analizzati ed esercitano un ruolo protettivo contro la perossidazione lipidica delle lipoproteine. Conclusioni Fino ad oggi non è stata effettuata un analisi dettagliata della loro composizione nutrizionale di leguminose e cereali tipici della Regione Marche. Dallo studio condotto emerge che i prodotti Marchigiani si contraddistinguono per le caratteristiche nutrizionali sia per il contenuto in macro e in micronutrienti. In particolare, essi risultano essere particolarmente ricchi di composti antiossidanti quali polifenoli e carotenoidi che conferiscono ai prodotti un elevato potere antiossidante totale. L analisi del potere antiossidante ha evidenziato la maggior parte dei prodotti inclusi nello studio si colloca tra gli alimenti vegetali con un 51

69 elevato potere antiossidante. In particolare i dati dimostrano che in tutti gli estratti sono presenti molecole che rallentano la perossidazione lipidica delle LDL. Studi precedenti hanno dimostrato che la perossidazione delle LDL avviene in vivo. Le LDL-ox esercitano un ruolo citotossico, pro-infiammatorio e sono coinvolte nei meccanismi molecolari alla base della formazione della placca aterosclerotica (Grundy, 1995). Pertanto i dati ottenuti potrebbero avere una rilevanza fisiologica poiché è noto che parte dei fitonutrienti sono biodisponibili (Polidori et al., 2009). I dati ottenuti dallo studio riguardanti la caratterizzazione delle proprietà nutrizionali e del potere antiossidante dei prodotti può rappresentare un elemento importante nella valorizzazione di questi prodotti tipici delle Marche. Tali informazioni sulla qualità nutrizionale possono essere utilizzate in campagne di valorizzazione nutrizionale di prodotti tipici con l obiettivo di incentivarne la conoscenza e il consumo soprattutto tra i più giovani oltre al loro possibile utilizzo come ingrediente funzionale in alimenti salutistici. In conclusione, gli alimenti tipici della nostra regione, come quelli inclusi nello studio, oltre a costituire un patrimonio culturale di notevole importanza, hanno evidenziato una elevata qualità nutrizionale, pertanto il loro consumo potrebbe avere ricadute positive per la salute, per l ambiente e per il mantenimento della biodiversità. Bibliografia ESTERBAUER H., STRIEGL G., PUHL H., ROTHENEDER M Continuous monitoring of in vitro oxidation of human low density lipoprotein. Free Radical Research, 6: FERRETTI G., BACCHETTI T., MASCIANGELO S., BICCHIEGA V Effect of phytosterols on copper lipid peroxidation of human low-density lipoproteins. Nutrition, 26(3): GILLESPIE K.M., CHAE J.M., AINSWORTH E.A Rapid measurement of total antioxidant capacity in plants. Nature Protocols, 2: GRUNDY S.M., Role of low-density lipoproteins in atherogenesis and development of coronary heart disease. Clinical Chemistry, 41: HOLT E.M., STEFFEN L.M., MORAN A., BASU S., STEINBERGER J., ROSS J.A., HONG C.P., SINAIKO A.R Fruit and vegetable consumption and its relation to markers of inflammation and oxidative stress in adolescents. Journal of the American Dietetic Association, 109(3): KRIUSHNAPRIYA S., DHINAGAR K., MALATHY S., MANI K., Database for vegetable phytochemicals and their mechanism of action. Bioinformation, 8(10): MARTÍNEZ-TOMÁS R., LARQUÉ E., GONZÁLEZ-SILVERA D., SÁNCHEZ- CAMPILLO M., BURGOS M.I., WELLNER A., PARRA S., BIALEK L., ALMINGER M., PÉREZ-LLAMAS F., 2012 Effect of the consumption of a fruit and vegetable soup with high in vitro carotenoid bioaccessibility on serum carotenoid concentrations and markers of oxidative stress in young men. European Journal of Nutrition, 51(2): POLIDORI M.C, CARRILLO J.C., VERDE P.E., SIES H., SIEGRIST J., STAHL W., 2009 Plasma micronutrient status is improved after a 3-month dietary intervention with 5 daily portions of fruits and vegetables: implications for optimal antioxidant levels. Nutrition Journal, 8: 10. SCOTT C.E., ELDRIDGE A.L., Comparison of carotenoid content in fresh, frozen and canned corn. Journal of Food Composition and Analysis, 18: VASANTHI H.R., SHRISHRIMAL N., DAS D.K., Phytochemicals from plants to combat cardiovascular disease. Current Medicinal Chemistry, 19 (14):

70 XU B.J., YUAN S.H., CHANG S.K.C., Comparative analyses of phenolic composition, antioxidant capacity and color of cool season legumes and other selectes food legumes. Journal of Food Science, 72: S Tab. 1. Caratteristiche composizionali dei legumi e cereali inclusi nello studio Tab. 1. Chemical composition of legumes and cereals included in the study Fagiolo Monachello Fagiolo Solfino Fagiolo Americano Fagiolo Occhio di capra Cicerchia Serra de Conti Roveja Appignano Cece Quercia Fava di Fratte Rosa Mais ottofile Treia Mais ottofile Pollenza Mais ottofile Roccacontrada giallo Mais ottofile Roccacontrada rosso Fenoli (mg/100g) PAT ( molte/100g) Tab. 2. Livelli di polifenoli totali e potere antiossidante totale (PAT) nelle diverse varietà di legumi e mais inclusi nello studio. Tab. 2. Levels of total polyphenols and total antioxidant potential (PAT) in the different varieties of legumes and maize included in the study. Fagiolo Monachello Fagiolo Solfino Fagiolo Americano Fagiolo Occhio di capra Cicerchia Serra de Conti Roveja Appignano Cece Quercia Fava di Fratte Rosa Mais ottofile Treia Mais ottofile Pollenza Mais ottofile Roccacontrada giallo Mais ottofile Roccacontrada rosso Proteine g/100g ,1 7,8 9,1 8,8 Lipidi g/100g 1,9 1,4 1,4 1,4 1,3 2,1 2,1 2,3 3,77 4,89 5,46 4,25 Carboidrati g/100g Fibra g/100g ,1 7,2 8,3 7,5 53

71 ox-ldl Fagiolo Americano Fagiolo Monachello Fagiolo occhio di capra Fagiolo Solfino Cece Quercia Roveja Cicerchia Fava di Fratte Rosa Mais Treia Mais Pollenza Mais Roccacontrada rosso Mais Roccacontrada giallo Lag-time (minuti) Tab. 3. Livelli di carotenoidi nelle diverse varietà di mais incluse nello studio Tab. 3. Levels of carotenoids in the different varieties of maize included in the study Carotenoids ( g/kg) Mais Mais Mais Mais Treia Pollenza Roccacontrada giallo Roccacontrada rosso Carotenoidi totali Luteina Zeaxantina Alfa-Criptoxantina Beta-Criptoxantina Alfa-Carotene Beta-Carotene Violaxantina <20 <20 <20 <20 Licopene <20 <20 <20 < * * * * * * * * * * * * Ox-LDL+ estratto Fig. 1. Durata della lag-time nelle LDL ossidante in assenza (ox-ldl) o in presenza di estratti ottenuti dalle diverse varietà di legumi e mais inclusi nello studio Fig. 1. Duration of the lag-time in LDL oxidized in the absence (ox-ldl) or in the presence of extracts obtained from different varieties of legumes and maize included in the study. 54

72 2.8. LA VITAMINA C NEI FRUTTI DI AGRUMI COME VALORE NUTRACEUTICO VITAMIN C IN CITRUS FRUITS AS A NUTRACEUTICAL VALUE Girolamo RUSSO 1, Laura D ANDREA 2, Teodora BASILE 1 1 Dipartimento di Scienze delle Produzioni Agrarie, Università degli Studi di Bari, via Amendola 165/A, Bari, Italy, 2 CRA - Unità di Ricerca per i Sistemi Colturali degli Ambienti caldo-aridi (SCA), via Celso Ulpiani 5, Bari, Riassunto In questo lavoro è stato determinato il contenuto di acido ascorbico o vitamina C nei frutti di una collezione di agrumi coltivati nell arco Ionico Pugliese. Sono stati messi a confronto 10 cv di arancio dolce, 10 cv di mandarino e mandarino-simili e 2 cv di pompelmo, piante ubicate tutte nello stesso campo di orientamento varietale, realizzato in provincia di Taranto. I risultati ottenuti hanno mostrato valori equilibrati di vitamina C nell ambito delle cultivar dello stesso agrume, arancio, pompelmo, clementina, mandarino e mandarino-simile. I risultati ottenuti hanno messo in evidenza l elevato contenuto in vitamina C di alcune delle cultivar esaminate. I valori della vitamina C (mg/l) sono risultati però diversi: nelle arance variavano da 67,6 a 101,1 nei mandarini e mandarino simili da 45,5 a 75,5 e nei pompelmi da 74,1 a 76,5. Parole chiave: vitamina C, arancio, mandarino, clementina, pompelmo Summary In this work the ascorbic acid, i.e. vitamin C, content in a collection of citrus fruits grown in Ionic area of Apulia region has been determined. Ten cv of sweet orange, ten cv of mandarin and mandarin-like fruits and two cv of grapefruit, from plants all located in the same field in the province of Taranto were compared. The results obtained showed balanced values of vitamin C in cultivars of the same citrus: orange, grapefruit, mandarin, mandarin-like, and clementine. The results obtained highlighted the high content of vitamin C in some of the examined cultivars. Anyway, the vitamin C values (mg/l) were different in different citrus fruits: in oranges ranged from 67.6 to in mandarin and mandarin-like ranged from 45.5 to 75.5, and in grapefruits from 74.1 to Keywords: vitamin C, orange, mandarin, clementine, grapefruit Introduzione Le vitamine sono sostanze necessarie all organismo umano in piccolissime quantità ma esso non è in grado di sintetizzare, da cui il bisogno di assumerle con l alimentazione. La vitamina C, il cui nome scientifico è acido L-ascorbico, è il lattone dell acido esuronico. L uomo, contrariamente alle altre specie animali e vegetali, non è in grado di sintetizzare l acido, ascorbico dal D-glucosio e quindi è indispensabile che lo ricavi dall alimentazione: frutta (ad esempio, fragole, arance, mele) e verdure (come cavoli, piselli, spinaci). Le vitamine fanno parte delle sostanze nutraceutiche, termine coniato nel 1989 da S.L. DeFelice, per quelle sostanze note per la loro comprovata azione benefica e protettiva nei confronti della salute 55

73 umana. È noto che il contenuto di vitamina C, la più notevole fra le vitamine contenute negli agrumi, è molto variabile da specie a specie e nell ambito delle specie fra le cultivar. Le differenze di quantità della vitamina C sono determinate anche dallo stadio di maturazione dei frutti, dall andamento climatico stagionale, dalle diverse condizioni pedo-climatiche, dai fattori agronomici e dalle modalità e tempi di conservazione del frutto (Gioffrè e Continella, 1973; Russo, 1984; Testoni et al., 1986). Tenuto presente questa variabilità e la sua importanza in quanto sostanza nutraceutica è stato ritenuto utile impostare la presente ricerca allo scopo di determinare il contenuto di vitamina C nei frutti di diversi agrumi coltivati su uno stesso terreno nell areale dell arco Ionico dove di recente è stato ottenuto anche il riconoscimento dell IGP Clementine del Golfo di Taranto. Materiali e metodi I campioni di frutti, dieci da ciascuna pianta, sono stati raccolti ad altezza d uomo, tenendo conto sia dell uniformità di pezzatura che del grado di maturazione. I campioni sono stati prelevati da ciascuna tesi di 10 cv di arancio dolce, 10 cv di mandarino e mandarino-simili e 2 cv di pompelmo, piante tutte ubicate nello stesso campo di orientamento varietale realizzato in provincia di Taranto. Ciascuna tesi, ripetuta tre volte, era costituita da quattro piante distribuite a caso e scelte considerando piante di sviluppo vegetativo simile. Le analisi per la determinazione chimica su campioni, raccolti direttamente in campo quando commercialmente pronti, sono state effettuate in laboratorio immediatamente dopo la raccolta per titolazione colorimetrica con il 2,6-diclorofenoloindofenolo. I dati sperimentali sono stati analizzati statisticamente. Risultati e discussione I risultati della presente ricerca, riportati nelle Tab. 1 e 2, fanno presumere che il biochimismo della formazione della Vitamina C sia alquanto più complesso di quanto si possa pensare e che, in qualche modo, dipenda anche dalla evoluzione dei contenuti di acidi, seppure con modalità variabile fra specie e cultivar e in probabile connessione con gli andamenti climatici stagionali. I valori di vitamina C determinati per arance e pompelmo, riportati in Tab 1, mostrano che è rilevante il contributo degli agrumi al fabbisogno giornaliero di vitamina C: 40 mg (bambino), 45 mg (adulto), 60 mg (donna in gravidanza), 80 mg (donna allattante). Inoltre, il loro consumo come frutta fresca, insieme agli ortaggi verdi, diminuisce il rischio di cancro dello stomaco (Haenszel et al., 1972, 1976; Kolonel et al., 1980). La vitamina C insieme alla vitamina E, delle quali i vegetali sono ricchi, inibiscono infatti la formazione di derivati nitrosanti, composti che possiedono azione cancerogena, associati a cancro dello stomaco (Schmahl, 1980). I valori di vitamina C anche per mandarino e mandarino-simili analizzati e riportati nella Tab. 2, riconfermano l importanza del consumo di agrumi per il notevole apporto di tale vitamina, specialmente da quando è stato sottolineato il suo ruolo chiave nell inibizione e nella prevenzione del cancro. La vitamina C in laboratorio, infatti, inibisce in vivo ed in vitro la formazione dei composti N-nitrosati (Mirvish, 1972). L aggiunta di acido ascorbico a colture di cellule umane (Park, 1980) previene la formazione chemio-indotta di queste cellule e in alcuni casi provoca la reversione delle cellule trasformate. Conclusioni Oltre a partecipare a numerose reazioni metaboliche e alla biosintesi di collagene, di alcuni aminoacidi ed ormoni, la vitamina C svolge numerosi effetti benefici: è un antiossidante, 56

74 interviene nelle reazioni allergiche potenziando la risposta immunitaria, neutralizza i radicali liberi e svolge una funzione protettiva a livello dello stomaco, inibendo la sintesi di sostanze cancerogene. La sua carenza provoca una malattia chiamata scorbuto, molto diffusa in passato tra i marinai che assumevano poca frutta e verdura fresca, i cui primi sintomi sono apatia, anemia e inappetenza e poi, proprio per la mancata sintesi di collagene, sanguinamento delle gengive, caduta dei denti, dolori muscolari, fragilità dei capillari e emorragie sottocutanee. La vitamina C è contenuta soprattutto negli alimenti freschi, come frutta e verdura, in particolare negli agrumi, fragole, cavolo (Tab. 3). La vitamina C viene però facilmente deteriorata durante i trattamenti di conservazione e cottura, si perde facilmente durante i lavaggi e la cottura in acqua viene danneggiata anche dall ossigeno e dal calore. Per assicurare un buon apporto di vitamina C, è quindi necessario consumare frutta e verdura freschissime, crude o poco cotte. I dati sperimentali ottenuti dimostrano il notevole contenuto di vitamina C nei frutti di diversi agrumi nell areale dell arco Jonico e costituiscono un tassello in più per la valutazione degli indici analitici caratterizzanti la tipicità per tracciabilità e rintracciabilità del prodotto agrume tipico delle Puglie - IGP Clementine del Golfo di Taranto. Bibliografia CARRERA G., I fabbisogni nutrizionali. Tossicologia e sicurezza degli alimenti: Ed. Tecniche nuove-milano. DEFELICE S. L., The nutricentral devolution: fueling a powerful. New International Market. GIOFFRÈ D., CONTINELLA G., Contenuti di vitamina C nei frutti delle cultivar di agrumi più diffuse in Calabria e Basilicata. In: Atti Convegno: Recente contributo della ricerca allo sviluppo dell agrumicoltura italiana. Cagliari 29 Aprile - 3 Maggio. HAENZEL W., KURIHARA M., SEGI M., LEE RKC.,1972. J. Natl. Cancer Inst., 49: 969. Alimentazione e cancro, Ed. Tecniche nuove Milano. HAENZEL W., KURIHARA M., LOCKE F. B., SMIMUZU X., SEGI M., J. Natl. Cancer Inst., 52,265. Alimentazione e cancro, Ed. Tecniche nuove Milano. KOLONEL L., N., J. Nath. Cancer Inst., 65: Alimentazione e cancro, Ed. Tecniche nuove Milano. MIRVISH S.S., WALLCAVE L., EAGEN M., SHUBIK P., Science, 177,65. Alimentazione e cancro, Ed. Tecniche nuove Milano. PARK C. H., AMARE M., SAVIN M. A., HOOGSTRATEN B., Cancer Res., 40, Alimentazione e cancro, Ed. Tecniche nuove Milano. RUSSO G., Ripening process of two orange cultivars: Washinton Navel and Navelina. In: International Citrus Congress, July 15 to 20, Sao Paulo, Brasil. SCHMAHL D., Arch. Toxic. Suppl., 4,29. Alimentazione e cancro, Ed. Tecniche nuove Milano. TESTORI A., ECCHER ZERBINI P., INTRIGLIOLO F., LANZA G., Influenza della concimazione azotata sulla qualità dell arancio Tarocco vecchia linea e Tarocco nucellare durante la conservazione frigorifera. In: Atti Convegno: Recente contributo della ricerca allo sviluppo dell agrumicoltura italiana. Cagliari 29 Aprile - 3 Maggio. 57

75 Tab. 1. Contenuto di vitamina C in 11 cultivar di arancio e in 2 di cultivar di pompelmo (media biennio 2004/05 e 2005/06). Tab. 1. Vitamin C content in 11 orange cultivar and 2 grapefruit cultivar (mean value for two year period 2004/05 and 2005/06). Cultivar Valore medio di vitamina C (mg/l) E.S. Belladonna 67,6 14,35 Biondo 75,4 1 3,89 Moro 60, 5 1 2,59 Navelina 82,8 14,12 Navelate 67,6 15,23 Ovale 77,4 1 3,76 Salustiana 77,1 15,12 Staccia 77,9 14,78 Tarocco 101,1 1 6,54 Valencia Late 81,1 14,76 Washinton N. 75,0 13,89 Marsh Seedless 76,5 1 6,76 Red Blush 74,1 1 5,54 Tab. 2. Contenuto di vitamina C in 10 cultivar di mandarino e mandarino-simili (media biennio 2004/05 e 2005/06). Tab. 2. Vitamin C content in 10 mandarin and mandarin-like cultivar (mean value for two year period 2004/05 and 2005/06). Cultivar Valore medio di vitamina C (mg/l) E.S. Clementine Comune 75,8 12,4 Clementine Nules 74,5 15,3 Clementine Monreal 70,4 13,7 Clementine Oroval 72,6 14, 7 Mandarino Avana 45,5 12,9 Mandarino Avana Apirno Nuc. 45,9 11,8 Mandarino ibrido Palazzelli 66,1 15,7 Mandarino tardivo di Ciaculli 59,3 13,9 Satsuma Owari 48,3 12,1 Tangelo Mapo 49,3 12,7 Tab. 3. Contenuto di vitamina C in alcuni frutti e verdura (mg/100g). Tab. 3. Vitamin C content in some fruits and vegetables (mg/100g). Frutta mg/100g Verdura mg/100g Fragola 60 Cavolo 50 Agrumi 50 Pisello 20 Mele 20 Porro 20 Pesche 5 Spinaci 25 (Dati ricavati da Carrera,1988). 58

76 2.9. CARATTERIZZAZIONE CHIMICA E MORFOPOMOLOGICA DI GENOTIPI DI MELOGRANO (PUNICA GRANATUM L.) IN PUGLIA CHEMICAL AND MORPHO-POMOLOGICAL CHARACTERIZATION OF POMEGRANATE GENOTYPES (PUNICA GRANATUM L.) IN APULIA Giuseppe FERRARA 1, Angela Maria Stella MATARRESE 1, Andrea MAZZEO 1, Andrea PACIFICO 1, Carmela PACUCCI 1, Vito GALLO 2,3, Isabella CAFAGNA 2, Piero MASTRORILLI 2,3 1 Dipartimento di Scienze Agro-ambientali e Territoriali - University of Bari Aldo Moro, via Amendola 165/A Bari (Italy) 2 DICATECh - Politecnico di Bari, via Orabona Bari (Italy) 3 Innovative Solutions S.r.l. - Spin off del Politecnico di Bari, zona H Noci (Bari, Italy) Riassunto In Puglia il melograno viene generalmente coltivato in piccoli frutteti familiari e le produzioni sono destinate ai mercati locali. L informazione sui genotipi locali è praticamente assente ed è per questo che da qualche anno sono in corso indagini per valutare le caratteristiche morfopomologiche e chimiche di diversi genotipi di melograno presenti nell areale regionale. Nel 2011 una indagine in diverse zone della Puglia ha portato alla individuazione e alla raccolta dei campioni di frutti da diversi genotipi. Sui frutti, raccolti alla maturazione commerciale, tra fine settembre e metà ottobre, sono state determinate le caratteristiche morfologiche e chimiche. Differenze significative sono emerse tra i genotipi e, in particolare, una grossa variazione si è osservata per alcuni parametri morfologici tra cui il peso, il diametro, la lunghezza del frutto e lo spessore della buccia. I Brix sono variati da 14,6 a 18,3, mentre l acidità titolabile (espressa in acido citrico) da 5.2 a 29.6 g/l per la presenza di genotipi dolci ed acidi. La resa in succo (cm 3 /100 arilli) non ha mostrato differenze significative ad eccezione di un genotipo acido che ha presentato una resa nettamente più bassa. Le caratteristiche chimiche dei campioni sono state studiate anche con un approccio metabolomico mediante l impiego della spettroscopia 1 H NMR. I risultati hanno indicato in glucosio, fruttosio e acido citrico i metaboliti maggiormente presenti nel succo. Il contenuto di glutammina e treonina è alla base della differenziazione di alcuni genotipi, mentre la componente fenolica del succo è risultata molto variabile dal punto di vista qualitativo. Parole chiave: Punica granatum L., caratteri organolettici, composti fenolici, metabolomica, spettroscopia 1 H NMR Abstract Pomegranate in Apulia region is generally cultivated in small home orchards and the limited production is generally consumed by the families or in local fruit markets. No information is available about the local pomegranate genotypes and few years ago we started morphopomological and chemical analyses of some pomegranate genotypes localized in the region. In 2011, a survey in several areas of the region allowed the localization of various genotypes and the collection of fruit samples. These fruits were harvested at commercial ripening, from the end of September to mid October, for the subsequent morphological and chemical analyses. 59

77 The genotypes showed significant differences, in particular for some morphological parameters such as fruit weight, diameter and length, and skin thickness. Total soluble solids ranged from 14.6 to 18.3 Brix and titratable acidity (as citric acid) ranged from 5.2 to 29.6 g/l because of the presence of both sweet and sour genotypes. The juice yield (cm 3 /100 arils) did not show significant differences, with the exception of an acid genotype with a significantly lower juice yield. Chemical characteristics of the samples have been studied with a metabolomic approach, through the use of 1 H NMR spectroscopy. Results showed that glucose, fructose and citric acid were the most abundant metabolites in the juice. The content of glutamine and threonine and the phenolic components were variable among the genotypes. Keywords: Punica granatum L., organolectic characteristics, fenolic compounds, metabolomic analysis, spectroscopy 1 H NMR Introduzione Il melograno è generalmente coltivato nel bacino del Mediterraneo, nelle regioni dell Asia meridionale, India, Nord e Sud America, in ambienti dove le alte temperature permettono una buona maturazione del frutto. In particolare, il suo adattamento al clima Mediterraneo ha favorito una larga diffusione in diversi Paesi dando origine, nell arco di secoli, a una variegata produzione di genotipi locali. Le parti commestibili del frutto sono gli arilli, che costituiscono dal 45 al 60% del peso totale del frutto (Kulkarni e Aradhya, 2005; Sarkosh et al., 2009;. Tehranifar et al., 2010). Gli arilli comprendono due parti: la testa e il seme al cui interno vi è l embrione. La testa, che è polposa e ricca di succo, può essere dolce, agrodolce o acida, di colore bianco, rosa o rosso ed è ricca di acidi organici e composti fenolici. L embrione contenuto nel seme, invece, contiene sostanze nutritive come gli acidi grassi presenti in gran quantità nell olio di semi di melograno (Sarkosh et al., 2009). Il melograno è stato sempre prioritariamente utilizzato per il consumo fresco, ma è anche impiegato, in seguito a separazione dei semi, per la preparazione di succhi di frutta, marmellate, sciroppi, bevande, coloranti e altri prodotti (Stover e Mercure, 2007; Magerramov et al., 2008). Come per molte specie da frutto, le varietà di melograno si differenziano per il loro gusto, variando dal dolce all acido (Holland et al., 2008) e ciò è legato direttamente alla qualità e quantità degli acidi organici e zuccheri presenti nel frutto. Un recente aumento nella domanda di prodotti a base di melograno da parte dei consumatori nei Paesi occidentali è imputabile alle sue caratteristiche nutrizionali e medicinali (Lansky e Newman, 2007). Queste attività sono principalmente attribuite ai livelli elevati di attività antiossidante ed all alto contenuto in polifenoli totali (Gil et al., 2000;. Tzulker et al., 2007). Il succo di melograno ha dimostrato di possedere un attività antiossidante 3 volte maggiore di quella del vino rosso o del tè verde (Gil et al., 2000), e rispettivamente due, sei e otto volte più alta delle attività rilevate in uva/mirtillo, pompelmo e succo d'arancia (Rosenblat e Aviram, 2006). Alcuni studi sulle caratteristiche morfologiche e chimiche del melograno si basano su analisi di genotipi presenti in alcuni Paesi del Mediterraneo (Baroni et al., 2001; Drogoudi et al., 2005; Tzulker et al., 2007; Martínez et al., 2006), ma non ci sono informazioni disponibili circa i genotipi presenti in Puglia. In particolare, in Italia i dati del 2011 indicano 60 ettari coltivati a melograno e 24 ettari risultano ufficialmente coltivati in Puglia (ISTAT, 2011). In questa regione le principali colture sono vite, olivo e ciliegio ma, considerando le condizioni pedoclimatiche, anche il melograno potrebbe essere una interessante e promettente coltura. 60

78 L'obiettivo del presente lavoro è quello di studiare e confrontare le caratteristiche morfopomologiche e chimiche di alcuni genotipi di melograno localizzati in Puglia. In particolare, le caratteristiche chimiche sono valutate mediante l impiego della spettroscopia di Risonanza Magnetica Nucleare (NMR) al fine di apprezzare il profilo metabolico del succo nella sua interezza. In tal modo, è possibile caratterizzare genotipi che potranno essere utilizzati in futuro per la coltivazione o per programmi di miglioramento genetico. Materiali e metodi Raccolta dei frutti - Nel 2011 una indagine in diverse zone della Puglia ha portato alla raccolta di frutti di 17 genotipi (Tab. 1). I frutti sono stati raccolti da alberi adulti siti in piccoli frutteti privati. Tutti i genotipi selezionati hanno una data di maturazione simile in base al loro colore interno ed esterno. Sui frutti, raccolti alla maturazione commerciale, tra fine settembre e metà ottobre, sono state determinate le caratteristiche morfologiche e chimiche. Caratteristiche morfo-pomologiche e organolettiche dei frutti - Su 15 campioni di frutti maturi raccolti per ciascun genotipo sono state effettuate misurazioni morfo-pomologiche (Mars e Marrakchi, 1999), misure delle caratteristiche di arilli e semi (Martínez et al., 2006) e analisi chimiche (Sarkhosh et al., 2009). Sui frutti sono stati misurati i seguenti tratti morfo-pomologici: peso del frutto (g), lunghezza (mm) e diametro (mm), numero di sepali (n.), lunghezza del calice (mm) e diametro (mm), spessore della buccia (mm). Sono state analizzate le seguenti caratteristiche degli arilli: larghezza massima (mm) e lunghezza (mm), peso dell arillo (mg), volume di succo (cm 3 /100 g di arilli). Il succo è stato preparato schiacciando gli arilli attraverso un setaccio di metallo, quindi è stato filtrato e separato in due aliquote, una delle quali è stata immediatamente congelata a -20 C per l analisi 1 H NMR mentre l altra è stata utilizzata per la determinazione dei solidi solubili ( Brix), ph ed acidità titolabile. L acidità titolabile è stata calcolata come g di acido citrico /1000 ml di succo. Analisi 1 H NMR - La registrazione degli spettri NMR è stata effettuata con uno spettrometro Bruker Avance 400 seguendo una procedura automatizzata. Il succo di melograno sottoposto all analisi 1 H NMR è stato conservato a 20 C fino al momento della preparazione del campione che consiste nell aggiunta di 200 μl di soluzione tampone ([C 2 O 4 2 ] + [HC 2 O 4 ] = 0.28 M, ph = 4.2) contenente NaN 3 ( M) e 300 μl di (trimetilsilil)tetradeuteropropionato sodico (TSP) in acqua deuterata ([TSP] = M) a 500 μl di succo di melograno. L esperimento NMR impiegato è un esperimento NOESY monodimensionale con presaturazione del segnale dell acqua. Analisi statistica - I dati sono stati analizzati utilizzando il software XLSTAT-Pro (Addinsoft, Francia). Prima dell'analisi, i dati sono stati sottoposti al test di Levene (omogeneità della varianza) che a quello di Lilliefors (distribuzione normale). Successivamente, l analisi della varianza (ANOVA) è stata eseguita a livello 0.01 P e i valori medi ottenuti per i diversi trattamenti sono stati separati utilizzando il test di Tukey. Gli spettri 1 H NMR sono stati sottoposti ad analisi statistica multivariata utilizzando il software AMIX (Bruker BioSpin GmbH, Rheinstetten, Germany). Gli spettri sono stati suddivisi in piccole regioni (bucket) dall ampiezza di 0.04 ppm. Al fine di apprezzare il naturale raggruppamento dei campioni, le bucket sono state elaborate mediante Analisi delle Componenti Principali (PCA), un metodo statistico multivariato non supervisionato che consente di ridurre la dimensionalità dei dati ad un sottospazio costituito da un numero limitato di componenti principali. Tali componenti principali rappresentano le direzioni lungo le quali è possibile apprezzare in ordine decrescente i maggiori gradi di varianza. 61

79 Risultati e discussione Caratteristiche morfo-pomologiche e organolettiche - Il peso ed il volume medio del frutto sono risultati, rispettivamente, di 344,8 g e 349,5 cm 3. Il peso dei frutti è variato notevolmente tra i genotipi, da un minimo di 127,8 g (Acido Molfetta) ad un massimo di 665,1 g (Tardivo acido), come mostrato nella tab. 2. Risultati simili al peso si sono avuti anche per il volume (da 127,8 a 665,1 cm 3 ), diametro dei frutti (valore medio 89,6 mm) variato da un minimo di 66,3 mm (Acido Molfetta) ad un massimo di 109,2 mm (Tardivo acido) e per la lunghezza (valore medio 74,1 mm) con un minimo di 52,7 mm (Acido Molfetta) ed un massimo di 95,8 mm (Tardivo acido). Le dimensioni minime e massime sono state riscontrate in 2 genotipi con arilli dal sapore acido anche se di località diverse (Tab. 2). Il peso medio dei frutti è risultato simile a quello misurato per alcune cultivar spagnole (Martínez et al., 2006) e più alto del valore misurato in cultivar iraniane (Sarkhosh et al., 2009) e comunque simile a valori riportati in una precedente ricerca in Puglia (Ferrara et al., 2011). La dimensione del frutto è un importante caratteristica che attrae i consumatori per il mercato fresco ed è quindi un parametro da tenere in debita considerazione per la scelta del genotipo per un impianto commerciale. Per quanto riguarda le altre caratteristiche morfologiche del frutto, i valori del diametro del frutto e del calice sono stati superiori ai valori iraniani, mentre le lunghezze di frutto e calice sono risultate minori (Sarkhosh et al., 2009). Il numero medio di sepali è risultato pari a 6,4 e non significativamente differente tra i vari genotipi. Le dimensioni del calice sono invece risultate diverse tra i genotipi solo per il diametro, con il valore più alto (21,3 mm) per l Acido Torrelonga ed il valore più basso (13,8 mm) per i genotipi Comune e Giardino; la lunghezza del calice ha presentato un valore medio di 12,2 mm senza differenze tra i genotipi. Una notevole variabilità si è invece osservata per lo spessore della buccia (Tab. 2) con valori oscillanti da 1,3 mm (Giardino) a 3,5 mm (Ninetta). Anche il peso totale degli arilli ha mostrato significative differenze tra i genotipi esaminati, con il valore più elevato (358,3 g) per il Tardivo acido ed il più basso (78,4 g) per l Acido Molfetta. La resa in succo (cm 3 /100 arilli) non ha mostrato differenze significative (75-65 cm 3 /100), ad eccezione dell Acido Molfetta che ha presentato una resa nettamente più bassa (53 cm 3 /100). Passando alle analisi chimiche, i Brix sono variati da 14,6 a 18,3 mentre l acidità titolabile da 5.2 a 29.6 g/l. Il valore medio dei Brix dei genotipi è stato 16.4, molto simile a quello riportato per alcune varietà spagnole (Martinez et al., 2006) ed a dati ottenuti in Grecia, ,0 Brix (Drogoudi et al., 2005), in Cile ,8 Brix (Sepúlveda et al., 2010), in Turchia 14,7-19,0 Brix (Ozgen et al., 2008;. Poyrazoğlu et al., 2002) ed in Puglia (Ferrara et al., 2011). Per quanto riguarda invece l acidità, i valori sono risultati simili a quelli ottenuti in Spagna, da 2,2 a 29,2 g/l (Melgarejo et al., 2000) e in Cile, da 4,2 a 29,0 g/l (Sepúlveda et al., 2010). Risulta evidente come i genotipi con arilli dal sapore acido si distinguano nettamente dai genotipi dolci, mentre due genotipi acidi (Acido Molfetta e Acido Torrelonga) presentano i valori più elevati di solidi solubili (Tab. 2). Analisi metabolomica mediante spettroscopia 1 H NMR - La spettroscopia NMR è una tecnica analitica che fornisce informazioni sull identità e la quantità dei metaboliti presenti in un alimento ed è ormai tra le tecniche di elezione per determinare il contenuto di metaboliti primari e secondari presenti in un prodotto agroalimentare (Kim et al., 2010; Colquhoun, 2007; Wishart, 2008; Pereira et al., 2006). Dall analisi dello spettro è possibile identificare i metaboliti (in base alla posizione e alla molteplicità dei segnali) e determinare la loro quantità (mediante opportune tecniche di quantificazione). Nella fig. 1 è riportato un tipico spettro 1 H 62

80 NMR di succo di melograno dal quale si può notare che i segnali più intensi sono quelli generati da glucosio e fruttosio (regione compresa tra 6.0 e 3.0 ppm) e dall acido citrico (sistema di spin AB a 2.82 e 2.72 ppm). Nella regione compresa tra 3.0 e 0.5 ppm sono presenti in maniera distinta anche i segnali dell acido malico (doppietti di doppietti centrati a 2.85 e 2.75 ppm) e di un limitato numero di amminoacidi quali la glutammina (multipletti centrati a 2.45 e 2.13 ppm), l alanina (doppietto a 1.47 ppm), la treonina (doppietto a 1.32 ppm) e la valina (doppietto di doppietti a 1.00 ppm). Nella regione compresa tra 10 e 6 ppm sono presenti segnali di scarsa intensità attribuibili a varie tipologie di composti fenolici. È importante precisare che le caratteristiche dei segnali NMR di tali composti, e di conseguenza la loro struttura chimica, differiscono al variare del campione. I metaboliti primari maggiormente presenti, cioè il glucosio, il fruttosio e l acido citrico, sono stati quantificati e le loro concentrazioni sono riportate nella tab. 3. Il contenuto di glucosio varia tra 4.92 g/100 ml per il Maddaloni dolce e 7.45 g/100ml per l acido di Molfetta e quello di fruttosio varia tra 6.41 e 9.97 g/100 ml nuovamente per il Maddaloni dolce e l acido di Molfetta. La concentrazione di acido citrico è compresa tra 0.39 g/100ml per il Maddaloni dolce e 2.56 g/100ml per il Maddaloni acido. Dalla valutazione dei dati riportati in Tab. è possibile affermare che il carattere dolce o acido del melograno non è legato alla quantità assoluta di zuccheri, perché tra i genotipi acidi vi sono alcuni (acido di Torrelonga, tardivo acido, acido di Molfetta) che presentano un contenuto di zuccheri superiore alla media (15.10 g/100ml). Poiché il rapporto glucosio/fruttosio risulta piuttosto costante con variazioni comprese tra 0.74 e 0.81, le differenze in termini di carattere dolce o acido non possono essere attribuite ad una netta prevalenza del fruttosio ma al rapporto tra zuccheri e acido citrico. Infatti, tale rapporto è sempre inferiore alla media (22.24 g/100ml) per i genotipi acidi ed è sempre superiore alla media per i genotipi dolci. Gli spettri NMR sono stati sottoposti, a seguito di bucketing, ad analisi delle componenti principali. La PCA è stata eseguita sulla regione spettrale dei composti fenolici ( ppm) e su quella degli amminoacidi ( ppm). Nel primo caso non sono stati apprezzati raggruppamenti spontanei tra i campioni, molto probabilmente a causa della grande variabilità di composti fenolici in termini di identità chimica. Per quanto riguarda, invece, il secondo caso, è stata apprezzata la separazione dei campioni in due gruppi nello scores plot PC1/PC3 (Fig. 2). Dall analisi dei loadings è emerso che i genotipi Dente di cavallo, Acido Molfetta, Comune e Pianta C (ovale blu) si differenziano dagli altri per un maggiore contenuto di treonina. I genotipi raggruppati nell ovale rosso, invece, presentano un contenuto maggiore di glutammina. Conclusioni Lo studio ha evidenziato una notevole variabilità esistente per molti dei parametri indagati nel pool genetico di melograni della regione Puglia. Considerando tutti i parametri valutati, e in particolare quelli riferiti alle caratteristiche organolettiche ed al contenuto di antiossidanti, è stato constatato che i genotipi più promettenti da un punto di vista agronomico ed industriale sono stati il Dolce, il Dente di cavallo e A dente per il mercato fresco e il Tardivo acido per l'industria del succo. Tuttavia, ci sono molti altri genotipi in Puglia che meritano di essere indagati sia per gli aspetti morfo-pomologici che per quelli chimici. Bibliografia COLQUHOUN, I. J., Use of NMR for metabolic profiling in plant systems. Journal of Pesticide Science, 32,

81 DROGOUDI P.D., TSIPOURIDIS C., MICHAILIDIS Z., Physical and chemical characteristics of pomegranates. Horticulture Science, 40: FERRARA G., CAVOSKI I., PACIFICO A., TEDONE L., MONDELLI D., Morphopomological and chemical characterization of pomegranate (Punica granatum L.) genotypes in Apulia region, Southeastern Italy. Scientia Horticulturae, 130: GIL M.I., TOMAS-BARBERAN F.A., HESS-PIERCE B., HOLCROFT D.M., KADER A.A., Antioxidant activity of pomegranate juice and its relationship with phenolic composition and processing. Journal of Agricultural Food Chemistry, 48: HOLLAND D., HATIB K., BAR-YA AKOV I., Pomegranate: Botany, Horticulture, Breeding. Horticultural Reviews, 35: ISTAT, KIM, K. H., CHOI, Y. H., VERPOORTE, R NMR-based metabolomic analysis of plants. Nature Protocols, 5: KULKARNI A.P., ARADHYA S.M., Chemical changes and antioxidant activity in pomegranate arils during fruit development. Food Chemistry, 93: LANSKY P.E., NEWMAN R.A., Punica granatum (pomegranate) and its potential for prevention and treatment of inflammation and cancer. Journal of Ethnopharmacology, 109: MAGERRAMOV M.A., ABDULAGATOV A.I., AZIZOV N.D., ABDULAGATOV I.M., Effect of temperature, concentration, and pressure on the viscosity of pomegranate and pear concentrates. Journal of Food Engineering, 80: MARS M., MARRAKCHI M., Diversity of pomegranate (Punica granatum L.) germplasm in Tunisia. Genetic Resources and Crop Evolution, 46: MARTÍNEZ J.J., MELGAREJO P., HERNÁNDEZ F., SALAZAR D.M., MARTÍNEZ R., Seed characterisation of five new pomegranate (Punica granatum L.) varieties. Scientia Horticulturae, 110: MELGAREJO P., SALAZAR D.M., ARTÉS F., Organic acids and sugars composition of harvested pomegranate fruits. European Food Research and Technology, 211: OZGEN M., DURGAÇ C., SERÇE S., KAYA C., Changes and antioxidant properties of pomegranate cultivars grown in the Mediterranean region of Turkey. Food Chemistry, 111: PEREIRA, G. E., GAUDILLERE, J. P., VAN LEEUWEN C., HILBERT, G., MAUCOURT, M., DEBORDE, C., MOING, A., ROLIN, D., H NMR metabolite fingerprints of grape berry: comparison of vintage and soil effects in Bordeaux grapevine growing areas. Analytica Chimica Acta, 563: POYRAZOĞLU E., GÖKMEN V., ARTIK N., Organic acids and phenolic compounds in pomegranates ( Punica granatum L.) grown in Turkey. Journal of Food Composition And Analysis, 15, ROSENBLAT M., AVIRAM M., In Vitro Studies. In: SEERAM N. P. E H. D. TAYLOR (a cura di). Pomegranates: Ancient Roots to Modern Medicine. Francis Group, New York: SARKHOSH A., ZAMANI Z., FATAHI R., RANJBAR H., Evaluation of genetic diversity among Iranian soft-seed pomegranate accessions by fruit characteristics and RAPD markers. Scientia Horticulturae, 121: SEPÚLVEDA E., SÁENZ E., PENA Á., ROBERT P., BARTOLOMÉ B., GÓMEZ- CORDOVÉS C., Influence of the genotype on the anthocyanin composition, antioxidant capacity and color of chilean pomegrante (Punica granatum L.) juices. Chilean Journal of Agricultural Research, 70:

82 STOVER E., MERCURE E.W., The pomegranate: a new look at the fruit of paradise. Horticultural Science, 42: TEHRANIFAR A., ZAREI M., NEMATI Z., ESFANDIYARI B., VAZIFESHENAS M.R., Investigation of physic-chemical properties and antioxidant activity of twenty Iranian pomegranate (Punica granatum L.) cultivars. Scientia Horticulturae, 126: TZULKER R., GLAZER I., BAR-ILAN I., HOLLAND D., AVIRAM M., AMIR R., Antioxidant activity, polyphenol content and related compounds in different fruit juices and homogenates prepared from 29 different pomegranate accessions. Journal of Agricultural and Food Chemistry, 55: WISHART D. S., Quantitative metabolomics using NMR. Trends in Analytical Chemistry, 27: Tab. 1. Genotipi analizzati nella prova. Tab. 1. Genotypes analyzed in the trial. Località Bari S. Giorgio Ostuni Identificativo del genotipo Tardivo acido Ninetta S. Pietro in Lama Maddaloni dolce Bari S. Giorgio Palo del Colle 1D Triggiano Bari S. Giorgio Palo del Colle 2 Molfetta Bitonto Dolce Pianta A Acido Torrelonga Dente di cavallo Pianta D A dente Giardino S. Pietro in Lama Giardino chiuso dolce Molfetta Bari S Giorgio Locale Comune S. Pietro in Lama Maddaloni acido Palo del Colle 2D Palo del Colle 1 Molfetta Pianta B Pianta C Acido Molfetta 65

83 Tab. 2. Valori medi delle caratteristiche pomologiche dei frutti e chimiche del succo. Tab. 2. mean values of fruit pomological characteristics and juice chemical characteristics. Genotipo Peso frutto (g) Volume (cm 3 ) Diametro (mm) Lunghezza (mm) Spessore buccia (mm) Peso arilli (g) Brix Acidità (g/l) Tardivo acido 665,1 A 665,1 A 109,2 A 95,8 A 2,5 AB 358,3 A 16,1 BE 24,8 A Ninetta 513,7 AB 513,7 AB 104,8 AB 89,3 AB 3,5 A 200,0 BC 16,5 AE 24,8 A Maddaloni dolce 457,8 BC 457,8 BC 99,9 AC 83,6 AC 2,8 AB 247,7 AC 14,6 E 5,8 B Dolce 456,9 BC 456,9 BC 97,9 AC 84,1 AB 2,1 AB 298,3 AB n.d. n.d. Pianta A 404,2 BD 404,2 BD 98,0 AC 74,1 BE 2,0 AB 264,1 AC 16,6 AE 5,5 B Acido Torrelonga 361,0 BE 361,0 BE 93,3 BC 71,5 CE 3,2 A 160,5 CD 17,5 AB 25,6 A Dente di cavallo 331,7 CE 331,7 CE 88,5 BD 76,6 BD 2,0 AB 220,8 BC 16,7 AD 7,2 B Pianta D 328,6 CE 328,6 CE 89,8 BD 75,2 BE 2,1 AB 187,4 BC 17,0 AD 5,9 B A dente 328,3 CE 328,3 CE 89,8 BD 72,2 CE 1,9 B 210,2 BC 14,8 E 5,2 B Giardino 312,0 CE 312,0 CE 88,0 BD 75,2 BE 1,3 B 229,4 AC 14,9 DE 6,1 B Giardino chiuso dolce 307,0 CE 307,0 CE 85,4 CD 75,6 BD 3,2 A 183,1 C n.d. n.d. Locale 277,7 DE 277,7 DE 84,1 CD 68,3 DE 2,8 AB 163,7 CD 16,3 BE 6,0 B Comune 273,8 DE 273,8 DE 84,9 CD 71,9 CE 2,5 AB 172,0 CD 16,8 AD 6,6 B Maddaloni acido 269,6 DE 269,6 DE 84,4 CD 69,8 CE 1,9 B 168,6 CD 15,6 CE 29,6 A Pianta B 253,2 DF 253,2 DF 82,9 CD 65,1 DF 1,5 B 168,6 CD 17,4 AC 8,5 B Pianta C 193,0 EF 193,0 EF 75,7 DE 59,6 EF 1,7 B 126,3 CD 17,1 AD 6,8 B Acido Molfetta 127,8 F 127,8 F 66,3 E 52,7 F 1,9 B 78,4 D 18,3 A 27,8 A 66

84 Tab. 3. Quantificazione mediante spettroscopia 1 H NMR di glucosio, fruttosio e acido citrico presenti nei succhi di melograno (concentrazione deviazione standard [g/100 ml]; 3 repliche). Tab. 3. Glucose, fructose and citric acid quantification through spectroscopy 1 H NMR in pomegranate juice (concentration standard deviation [g/100 ml]; 3 replications). Identificativo Genotipo Glucosio Fruttosio Acido Citrico Glucosio + Fruttosio Glucosio/ Fruttosio (Glucosio+ Fruttosio)/ (Ac. Citrico) Maddaloni dolce 4,92 ± 0,25 6,41 ± 0,36 0,39 ± 0,05 11,33 0,77 28,96 Acido Torrelonga 6,85 ± 0,23 9,29 ± 0,31 2,14 ± 0,15 16,14 0,74 7,53 Pianta A 6,31 ± 0,57 8,43 ± 0,77 0,42 ± 0,02 14,73 0,75 35,05 Tardivo acido 6,54 ± 0,03 8,62 ± 0,09 1,19 ± 0,04 15,16 0,76 12,74 Giardino 6,23 ± 0,13 7,74 ± 0,24 0,49 ± 0,02 13,97 0,80 28,36 Dente di Cavallo 6,83 ± 0,20 8,67 ± 0,19 0,58 ± 0,03 15,50 0,79 26,49 Locale 6,63 ± 0,47 8,45 ± 0,80 0,53 ± 0,02 15,07 0,78 28,63 Pianta C 6,82 ± 0,41 8,73 ± 0,74 0,52 ± 0,02 15,54 0,78 29,64 Maddaloni acido 5,99 ± 0,46 8,09 ± 0,58 2,56 ± 0,55 14,08 0,74 5,50 Comune 6,80 ± 0,25 8,74 ± 0,32 0,57 ± 0,04 15,54 0,78 27,47 Ninetta 5,91 ± 0,46 8,00 ± 0,71 1,91 ± 0,66 13,92 0,74 7,29 Acido Molfetta 7,45 ± 0,41 9,97 ± 0,46 2,33 ± 0,52 17,42 0,75 7,47 Pianta B 7,32 ± 0,84 9,43 ± 1,33 0,70 ± 0,02 16,75 0,78 24,00 Pianta D 7,18 ± 0,81 9,48 ± 1,26 0,51 ± 0,05 16,66 0,76 32,80 A Dente 6,54 ± 0,55 8,08 ± 0,74 0,46 ± 0,04 14,63 0,81 31,70 67

85 Fig. 1. Tipico spettro 1 H NMR di succo di melograno. Fig. 1. Typical spectrum 1 H NMR of pomegranate juice. 0,25 PC3 0,2 0,15 0,1 0,05 PC1 0-0,4-0,2-0,05 0 0,2 0,4 0,6-0,1-0,15-0,2-0,25 A B C D E F G H I L M N O P Fig. 2. PC1/PC3 scores plot ottenuto dalla regione spettrale compresa tra 2.5 e 0.5 ppm. Fig. 2. PC1/PC3 scores plot obtained from the spectral region included between 2.5 and 0.5 ppm. 68

86 2.10. VARIAZIONE DEI LIVELLI DI ALCUNI COMPOSTI A VALENZA NUTRACEUTICA E SALUTISTICA DURANTE LA MATURAZIONE IN BIOTIPI DI CIPOLLA BIANCA DI POMPEI (ALLIUM CEPA L.) EVOLUTION OF THE CONTENT OF SOME NUTRACEUTICAL AND HEALTH-PROMOTING COMPOUNDS DURING THE RIPENING IN CIPOLLA BIANCA DI POMPEI (ALLIUM CEPA L.) ACCESSIONS Giuseppe MENNELLA 1, Gianluca FRANCESE 1, Antonietta D ALESSANDRO 1, Francesco RAIMO 2 1 CRA-Centro di Ricerca per l Orticoltura (CRA-ORT), via Cavalleggeri, 25 Pontecagnano- Faiano (SA), 2 CRA-Unità di Ricerca per le Colture Alternative al Tabacco (CRA-CAT), via P. Vitiello, 108 Scafati (SA), Riassunto Al fine di valutare le influenze dello stadio di maturazione del bulbo sui livelli di alcune sostanze che esibiscono proprietà nutrizionali ed antiossidanti, sono state analizzate undici accessioni di cipolla bianca di Pompei. I biotipi sono stati allevati in campo secondo uno schema sperimentale a blocchi randomizzati con tre repliche. La raccolta dei bulbi è avvenuta tra la terza decade di dicembre 2011 e la prima decade di aprile 2012; i bulbi di ciascun biotipo sono stati raccolti tre volte in corrispondenza di tre diversi stadi di maturazione commerciale: A) diametro ~ 2 cm; B) diametro 2,5-4 cm; C) a completa maturazione (diametro 6-8 cm). Sono state effettuate determinazioni spettrofotometriche della pungenza e dei flavonoidi totali rispettivamente su estratti acquosi e alcoolici dei bulbi; inoltre, sugli estratti alcoolici è stata effettuata analisi dei flavonoidi differenziali mediante cromatografia liquida ad alta risoluzione (HPLC). Per quanto riguarda la pungenza, i biotipi febbrarese (C13), marzatica precoce (C4), marzatica tardiva (C5) e maggiaiola (C10) hanno mostrato differenze statisticamente significative (p 0,05) al test di Tukey tra i tre stadi di maturazione; gli altri sette biotipi o non hanno mostrato differenze o queste non erano significative. Differenze significative sono state anche rilevate tra gli undici biotipi, nei differenti stadi di maturazione del bulbo: nello stadio A, il valore max è risultato 16,36 µmoli di piruvato/g di peso fresco per il biotipo C10, il valore min è stato 8,08 µmoli di piruvato/g di peso fresco per il biotipo C13; nello stadio B, valore max 14,21 per C10, valore min 8,60 per C12, nello stadio C, 13,55 per C5 e 8,07 per C9. Per quanto riguarda i flavonoidi totali, i valori più elevati sono stati riscontrati nello stadio A con una generale tendenza a ridursi con l aumentare del diametro del bulbo. Differenze statisticamente significative (p 0,05) al test di Tukey sono state riscontrate per diversi biotipi nei tre stadi di maturazione commerciale del bulbo (A, B, C). In accordo con i dati presenti in letteratura anche le cipolle bianche da noi analizzate hanno mostrato valori dei flavonoidi totali e differenziali sensibilmente più bassi rispetto a quelli rilevati in cipolle dorate o rosse. I flavonoidi principali, identificati negli estratti alcoolici dei biotipi di cipolla bianca di Pompei analizzati, sono stati: quercetina 3,4ʹdiglucoside (tempo di ritenzione 6,8 minuti) e quercetina 4ʹ-glucoside (tempo di ritenzione 16,4 minuti); flavonoidi minori, non facilmente identificabili, sono stati anche evidenziati nei cromatogrammi a 362 nm. I bulbi di questa orticola, prodotti nell agro Pompeiano-Stabiese e Nocerino-Sarnese con ciclo vernino-primaverile, rappresentano una fonte di flavonoidi antiossidanti che tanti benefici sembrano apportare nella prevenzione di importanti malattie croniche nell uomo. 69

87 Parole chiave: pungenza, flavonoidi, bulbi, ecotipo, accessioni Abstract The influence of the ripening stage on the content of nutraceutical and health-promoting compounds was evaluated in 11 cipolla Bianca di Pompei biotypes. The bulbs, grown in an experimental field located in Scafati (Salerno, Italy) at the research unit for Tobacco alternative crops of Agricultural Research Council (CRA), were collected three times in correspondence to three commercial ripening stages (named A, B and C, characterized by increasing diameter), from December 2011 to April Spectrophotometric analyses of water and alcohol extracts were carried out in order to evaluate the pungency and the content of total flavonoids of the eleven white onion accessions; moreover, a differential analysis of the flavonoids was also performed in alcohol extracts through Reversed Phase-High Performance Liquid Chromatography (RP-HPLC) at 362 nm. The pungency of the biotypes febbrarese (C13) marzatica precoce (C4), marzatica tardiva (C5) and maggiaiola (C10) resulted significantly different (Tukey test, p 0.05) among the three ripening stages. Significant differences were also detected among the eleven accessions in each ripening stage: in the A stage, the higher value was achieved by C10 biotype (16.37 µmoles pyruvate /g fw), the minimum value by C13 (8,08 µmoles pyruvate /g fw); in the B stage, the higher value was achieved by C10 (12.88 µmoles pyruvate /g fw), the minimum value by C12 (8.60 µmoles pyruvate /g fw); in the C stage, the values being 13,5 µmoles pyruvate /g fw for C5 and 8,07 µmoles pyruvate /g fw for C9. The higher values of total flavonoids were observed in the A stage for all the biotypes analyzed, on the contrary during the ripening these values decreased. According to several authors, our white onion accessions showed a lower content of differential and total flavonoids than red and golden ones. Flavonoid differential analysis, performed by RP-HPLC at 362 nm, of alcohol extracts from cipolla Bianca di Pompei showed two main flavonoids: Quercetin 3-4 di-o-glucoside (retention time 6.8 min) and Quercetin 4-O-glucoside (retention time 16.4 min). Other minor flavonoids were also detected but not identified. The bulbs of cipolla Bianca di Pompei, cultivated during the winter-spring season, represent, in the cultivation area, an important source of antioxidant flavonoids which play an essential role in the prevention of human chronic diseases. Keywords: pungency, flavonoids, bulbs, biotypes Introduzione La cipolla bianca (Allium cepa L.) è uno degli ortaggi più conosciuti e diffusi non solo in Italia e nel resto del bacino del Mediterraneo, ma un po in tutti i continenti. In particolare, la cipolla bianca di Pompei, con un ciclo vernino-primaverile, rappresenta un orticola tipica del sud Italia e soprattutto della Campania, sia nell agro Pompeiano-Stabiese che in quello Nocerino-Sarnese. Questa liliacea presenta una spiccata precocità: seminata in agostosettembre produce un bulbo globoso-appiattito nella primavera successiva; tuttavia, il suo consumo parte già dal periodo invernale (dicembre-gennaio) quando viene raccolto in uno stadio di precoce maturazione (noto come cipollotto) e quindi ricopre un importante ruolo nell economia agricola anche durante i mesi invernali. La cipolla bianca di Pompei, per l importanza economica che riveste, è stata oggetto di numerosi lavori di caratterizzazione agronomica volti all ottenimento del riconoscimento da parte della Comunità Europea della Denominazione di Origine Protetta (DOP) e/o 70

88 dell Indicazione Geografica Protetta (IGP). Infatti, la DOP è stata riconosciuta al Cipollotto Nocerino con regolamento C.E. n 656 del 10 Luglio Alcuni precedenti studi biochimici si sono focalizzati sulla possibilità di caratterizzare alcune accessioni di cipolla bianca di Pompei mediante metodiche cromatografiche in HPLC. Così, lo studio differenziale delle proteine estratte dall endosperma del seme di cipolla bianca di Pompei ha evidenziato diversità nel pattern della frazione globulinica utile per la caratterizzazione ed il recupero dei biotipi presenti nell areale di coltivazione campano (Mennella et al., 2005). Dal punto di vista nutrizionale, la cipolla contribuisce all intake di carboidrati, vitamine, minerali ma anche di composti fenolici importanti, quali i flavonoidi. Studi epidemiologici hanno evidenziato il possibile ruolo che questi composti hanno nella prevenzione delle malattie cardiovascolari e del cancro (Chu et al., 2000; Hertog et al., 1992, 1993). La Quercetina è il maggior flavonoide presente in cipolla, di cui sono state riscontrate tre forme predominanti: quercetina aglicone, quercetina 3,4 -O-diglucoside e la quercetina 4 -Oglucoside (Leighton et al., 1992; Price e Rhodes, 1997). La quantificazione di questi flavonoidi è stata condotta sia su varietà di cipolla rossa che di cipolla bianca o dorata e diverse evidenze confermano il maggior contenuto di tali composti nelle cipolle a bulbo colorato (Lombard et al., 2002; Mariotti e Piccaglia, 2002; Lee et al., 2008; Rodriguez et al., 2008). Lo scopo del presente studio è stato l identificazione e la determinazione di composti ad elevato valore nutraceutico e salutistico, quali i flavonoidi, presenti in 11 biotipi di cipolla bianca di Pompei. In particolare, sono state valutate sia le differenze quali-quantitative nei diversi biotipi studiati che le variazioni dei loro livelli durante la fase di maturazione dei bulbi. Inoltre, sugli stessi campioni è stata valutata anche la variazione temporale della pungenza, un carattere organolettico molto apprezzato dai consumatori. Materiali e metodi Materiale vegetale - Undici biotipi appartenenti all ecotipo cipolla bianca di Pompei (Allium cepa L.) sono stati allevati presso l azienda sperimentale dell Unità di Ricerca per le Colture Alternative al Tabacco del Consiglio per la Ricerca e la Sperimentazione in Agricoltura (CRA-CAT) di Scafati (SA). Il germoplasma, raccolto presso diverse aziende agricole dell areale di produzione e già sottoposto a precedente caratterizzazione morfo-fisiologica ed agronomica, era costituito da 4 biotipi febbraresi (denominati C1, C3, C7 e C13), 3 biotipi marzatici precoci (C4, C6 e C8), 2 biotipi marzatici (C9 e C12), un biotipo marzatico tardivo (C5) e un biotipo maggiaiolo (C10). I biotipi sono stati allevati in campo secondo uno schema sperimentale a blocchi randomizzati con tre repliche. La semina dei biotipi, avvenuta ad agosto 2011, è stata seguita da un trapianto in pieno campo nel mese di settembre. La raccolta dei bulbi è avvenuta tra la terza decade di dicembre 2011 e la prima decade di aprile I bulbi di ciascun biotipo sono stati raccolti tre volte in corrispondenza di tre diversi stadi di maturazione commerciale: stadio A, diametro ~ 2 cm; stadio B, diametro 2,5-4 cm; stadio C, a completa maturazione (diametro 6-8 cm). 100 g di prodotto fresco, prelevato da 4 differenti bulbi appartenenti alla stessa replica di ciascuna accessione, sono stati congelati in azoto liquido, conservati a -80 C e in seguito liofilizzati per le successive determinazioni dei flavonoidi totali e differenziali. Analisi spettrofotometrica - Pungenza. Per ciascuna replica di ogni accessione, sono stati prelevati, da 4 bulbi, circa 3 g di prodotto fresco per la determinazione spettrofotometrica della pungenza, ad una lunghezza d onda di 420 nm, secondo la metodica di Schwimmer e Wenston (1961). Ogni estratto è stato sottoposto a lettura spettrofotometrica e i risultati sono 71

89 stati espressi come µmoli di piruvato/g di peso fresco. Flavonoidi totali. Per ciascuna replica di ogni accessione, 1 grammo di liofilo è stato omogenato in un becker con 10 ml di una soluzione di etanolo all 80%, successivamente sonicato per 60 minuti in un bagno ad ultrasuoni e poi ulteriormente omogeneizzato. L omogenato è stato centrifugato a 15000g per 10 minuti a 10 C, il surnatante è stato centrifugato a 3000g per 5 minuti. L estratto ottenuto è stato sottoposto a lettura allo spettrofotometro ad un lunghezza d onda di 362 nm secondo la metodica di Lombard et al. (2002). È stata utilizzata una curva di calibrazione ottenuta diluendo una soluzione standard di isoquercetina (quercetina 3-O-β-glucopiranoside, Extrasynthese Genay France) in etanolo all 80%. I risultati sono stati espressi come mg/kg di peso fresco. Analisi cromatografica - L estrazione dei flavonoidi per l analisi differenziale è stata effettuata secondo la stessa metodica utilizzata per l analisi dei flavonoidi totali. Essendo nota in letteratura la bassa concentrazione di questi composti in cipolla bianca, l estratto ottenuto dopo centrifugazione è stato concentrato circa 10 volte mediante rotavaporazione. L estratto concentrato è stato filtrato mediante filtri Millex-FG (Merck Millipore, Billerica MA, USA) da 0.2 µm prima dell analisi in HPLC. Per l analisi cromatografica è stata utilizzata la metodologia riportata in Lee et al. (2008). L analisi RP-HPLC è stata effettuata mediante un sistema E-Alliance (Waters, Milford MA, USA) costituito da un unità di separazione con una pompa quaternaria mod. 2695, un autocampionatore e un rivelatore a fotodiodi mod. 2996; i dati sono stati acquisiti utilizzando il software Empower. Per la separazione dei flavonoidi è stata utilizzata una colonna Luna C18(2) 5µ, 100 Å, (250 x 4,6 mm, Phenomenex Inc., USA) a 30 C. L analisi è stata condotta secondo il seguente gradiente lineare di Acetonitrile (A) e 0.5% di Acido Formico (B): 18% (A) e 82% (B) 40% (A) e 60% (B) in 40 minuti 90% (A) e 10% (B) in 10 minuti, 5 minuti in 90% (A) e 10% (B) 18% (A) e 82% (B) in 10 minuti e riequilibrazione della colonna per altri 5 minuti, prima della successiva iniezione. Il flusso è stato di 0.8 ml/min e il volume di iniezione di 20 µl. I profili di eluizione dei cromatogrammi sono stati risolti alla lunghezza d onda (λ) di 362 nm; i tempi di ritenzione dei due principali flavonoidi analizzati sono stati: quercetina 3,4ʹdiglucoside, 6,8 minuti e quercetina 4ʹ-glucoside, 16,4 minuti. Sono stati utilizzati standard esterni, a concentrazione nota, dei due flavonoidi (Extrasynthese Genay France). Tutte le determinazioni sono state effettuate in triplo. Sui dati ottenuti è stata effettuata l analisi della varianza utilizzando il software JMP (SAS Institute, Cary, NC, USA); le medie sono state comparate mediante il test di Tukey HSD (p 0.05). Risultati e discussione Per quanto riguarda la pungenza, solo i biotipi febbrarese (C13), marzatica precoce (C4), marzatica tardiva (C5) e maggiaiola (C10) hanno mostrato differenze statisticamente significative al test di Tukey HSD (p 0,05) tra i tre stadi di maturazione (Tab. 1). Differenze significative sono state anche rilevate tra gli undici biotipi, in ciascuno stadio di maturazione del bulbo. Nello stadio A, il valore massimo (significativamente più elevato rispetto a tutti gli altri) è risultato di 16,36 µmoli di piruvato/g di peso fresco per il biotipo C10; differenze significative sono state rilevate anche tra il biotipo C6 e i biotipi C10 e C13, quest ultimo ha evidenziato il valore minimo di 8,08 µmoli di piruvato/g di peso fresco. Nello stadio B, il valore max di 14,21 riscontrato nel biotipo C10 è risultato non significativamente differente rispetto a C1, C4, C8 e C13; il valore min per questo stadio di maturazione è stato 8,60 nel biotipo C12 (Tab. 1). Nello stadio C, il valore max di 13,55 per C5 è risultato 72

90 significativamente più elevato rispetto a quello degli altri biotipi, eccetto C1, laddove quest ultimo è risultato significativamente più elevato rispetto a C9 che ha mostrato il valore minimo (8,07 µmoli di piruvato/g di peso fresco). I valori dei flavonoidi totali degli 11 biotipi di cipolla bianca di Pompei, misurati in tre successivi stadi di maturazione, sono riportati in Fig. 1. I risultati ottenuti indicano una marcata riduzione dei livelli di flavonoidi totali con la maturazione. Lo stadio A ha evidenziato i valori più elevati per tutti i biotipi e in particolare il C7 ha raggiunto il valore massimo con 51,21 mg/kg di peso fresco, mentre il valore minimo è stato del C8 con 34,94 mg/kg di peso fresco. In questo stadio è risultato evidente un notevole polimorfismo tra i biotipi, sottolineato da un range di valori abbastanza ampio (34,94-51,21) oltre che da differenze significative tra molti di essi (Fig. 1). Lo stadio B ha evidenziato un range di valori più ristretto (22,86-31,93), un minore polimorfismo con il valore più elevato e quello più basso esibiti rispettivamente dai biotipi C10 e C13. Lo stadio C (range 11,99-21,27) ha fatto registrare il valore più elevato nel biotipo C7 e quello più basso nel biotipo C4; rispetto ai due stadi di maturazione precedenti, lo stadio C è caratterizzato da una maggiore uniformità dei biotipi per quanto riguarda i contenuti di flavonoidi totali. Tutti i biotipi, eccetto C13 (stadio B e C), hanno mostrato differenze significative (p 0,05) nei livelli di flavonoidi totali tra i tre stadi di maturazione (dati non riportati). In Fig. 2 sono riportati i valori della quercetina 3,4 -diglucoside, il principale flavonoide della cipolla, ottenuti dall analisi dei profili cromatografici RP-HPLC degli undici biotipi, valutati nei tre stadi di maturazione. Come per i flavonoidi totali, è stata evidenziata una netta riduzione dei livelli del flavonoide diglucoside durante la maturazione, per tutti i biotipi analizzati. In tutti e tre gli stadi di maturazione è stato riscontrato un buon grado di polimorfismo oltre che differenze significative (p 0,05) tra i biotipi (Fig. 2); inoltre, lo stadio A ha mostrato un range di valori più ampio (1,04-6,39 mg/kg di peso fresco) rispetto agli stadi B (0,27-2,72) e C (0,22-1,45). Lo stadio A ha evidenziato i livelli più elevati del flavonoide ed in particolare il C7 è risultato il biotipo con valore massimo mentre il C9 quello con valore più basso. Per lo stadio B il valore più alto è stato raggiunto dal C3, mentre il livello più basso è stato misurato nel biotipo C13. Nello stadio C, invece, il C4 ed il C13 hanno mostrato rispettivamente il livello più alto e più basso del flavonoide (Fig. 2). Per i livelli di quercetina 3,4 -diglucoside tutti i biotipi, eccetto il C13 (stadio B e C), hanno mostrato differenze significative (p 0,05) tra i tre stadi di maturazione (dati non riportati). I livelli di quercetina 4 -glucoside, un altro dei più rappresentativi glucosidi della quercetina presenti in cipolla, hanno mostrato lo stesso andamento dei flavonoidi totali e della quercetina 3,4 -diglucoside, con una netta riduzione dallo stadio A allo stadio C (dati non riportati). Il valore massimo per questo flavonoide è stato rilevato nello stadio A del biotipo C7 (1,19 mg/kg di peso fresco), mentre nello stadio C i livelli del flavonoide, troppo bassi, sono risultati non misurabili per i biotipi C1, C9, C10, C12 e C13 (dati non mostrati). Altri flavonoidi minori, non facilmente identificabili, sono stati evidenziati nei cromatogrammi a 362 nm. Il biotipo C7 (febbrarese) ha evidenziato, allo stadio di cipollotto (stadio A), i livelli più elevati di flavonoidi totali e differenziali e un valore di pungenza tra i più bassi per questo stadio, risultando perciò tra i biotipi più interessanti nel presente studio, per quanto riguarda le proprietà nutraceutiche e salutistiche. 73

91 Conclusioni I biotipi di cipolla analizzati hanno evidenziato una riduzione graduale e significativa dei livelli di flavonoidi con la maturazione. La quercetina 3,4 -diglucoside è risultata il flavonoide più rappresentativo tra quelli presenti nel bulbo di cipolla bianca di Pompei. Un andamento biotipo-dipendente è stato rilevato, invece, per la pungenza nei diversi stadi di maturazione del bulbo. Alcuni dei biotipi studiati hanno mostrato livelli interessanti di flavonoidi totali e differenziali insieme a buoni valori di pungenza. La cipolla bianca di Pompei, per le sue peculiari caratteristiche, è una delle ortive più coltivate nell Agro Pompeiano-Stabiese e Nocerino-Sarnese; non di minore importanza, a differenza delle altre varietà di cipolla, è la sua presenza per molti mesi sulle tavole italiane, da fine dicembre a giugno. Inoltre, la sua elevata duttilità culinaria fa si che i bulbi possano essere consumati sia crudi freschi che in seguito a diverse preparazioni, rappresentando, in tal modo, un importante e alternativa fonte di composti ad elevata attività antiossidante. Bibliografia CHU Y.H., CHANG C.L., HSU H.F., Flavonoids content of several vegetables and their antioxidant activity. Journal of the Science of Food and Agriculture, 80: HERTOG M.G.L., HOLLMAN P.C.H., KATAN M.B., Content of potentially anticarcinogenic flavonoids of 28 vegetables and 9 fruit commonly consumed in the Netherlands. Journal of Agricultural and Food Chemistry, 40: HERTOG M.G.L., FESKENS E.J.M., HOLLMAN P.C.H., KATAN M.B., KROMOUNT D., Dietary antioxidant flavonoids and risk of coronary heart disease: the Zutphen elderly study. Lancet, 342: LEE S.U., LEE J.H., CHOI S.H., LEE J.S., OHNISI-KAMEYAMA M., KOZUKUE N., LEVIN C.E., FRIEDMAN M., Flavonoid content in fresh, home-processed, and light-exposed onions and in dehydrated commercial onion products. Journal of Agricultural and Food Chemistry, 56: LEIGHTON t., GINTHER C., FLUSS L., HARTER W.K., CANSADO J., NOTARIO V., Molecular characterization of quercetin and quercetin glycosides in Allium vegetables phenolic compounds in food and their effects on health II. ACS Symposium Series, 507: LOMBARD K.A., GEOFFRIAN E., PEFFLEY E., Flavonoid quantification in onion by spectrophotometric and high performance liquid chromatography analysis. Hortscience, 37(4): MARIOTTI M., PICCAGLIA R., Characterization of flavonoids in different cultivars of onion (Allium cepa L.). Journal of Food Science, 67(3): MENNELLA G., ONOFARO SANAJÀ V., D ALESSANDRO A., DESIDERIO A., Biochemical characterization of white onion landraces (Allium cepa L.) through HPLC analysis of endosperm seed proteins. Euphytica, 141: PRICE K.R., RHODES M.J.C., Analysis of the major flavonol glycoside present in four varieties of onion (Allium cepa L.) and changes in composition resulting from autolysis. Journal of the Science of Food and Agriculture, 74: RODRÍGUEZ GALDÓN B., RODRÍGUEZ RODRÍGUEZ E.M., ROMERO D., Flavonoids in onion cultivars (Allium cepa L.). Journal of Food Science, 73(8): SCHWIMMER S., WENSTON W., Enzymatic development of pyruvic acid in onion as a measure of pungency. Journal of Agricultural and Food Chemistry, 9:

92 Tab. 1 Valori di pungenza (µmoli di piruvato/g di peso fresco) in 11 biotipi di cipolla bianca di Pompei. Tab. 1. Pungency values (µmoles of pyruvate/g of fresh weight) in eleven cipolla bianca di Pompei biotypes. Le medie seguite da lettere minuscole differenti indicano valori significativamente differenti in ciascuno stadio di maturazione; a lettere maiuscole differenti corrispondono valori significativamente differenti tra i tre stadi di maturazione di ciascun biotipo (p 0,05, test di Tukey HSD). Means followed by different lowercase letters indicate significantly different pungency values for each ripening stage; different capital letters correspond to significantly different pungency values among the three ripening stages of each biotype (p 0.05, Tukey HSD test). Accessione Stadio A Stadio B Stadio C C 1 10,66 bc 10,33 a-c 11,13 ab C 3 9,57 bc 8,72 c 9,56 bc C 4 8,49 bc B 11,46 a-c A 10,02 bc AB C 5 11,05 bc AB 8,69 c B 13,55 a A C 6 11,73 b 9,44 bc 9,27 bc C 7 8,96 bc 9,08 bc 9,99 bc C 8 9,45 bc 10,53 a-c 10,14 bc C 9 10,52 bc 8,69 c 8,07 c C 10 16,36 a A 14,21 a A 8,42 bc B C 12 10,57 bc 8,60 c 10,28 bc C 13 8,08 c B 12,78 ab A 10,11 bc AB 75

93 mg/kg di peso fresco 60 Flavonoidi totali Stadio A Stadio B a b c d e g ef fg fg h i a b d de c c e de fg f g a ab a a a cd d bc e e f Stadio C 0 C1 C3 C4 C5 C6 C7 C8 C9 C10 C12 C13 Accessione Fig. 1. Livelli di flavonoidi totali in 11 biotipi di cipolla Bianca di Pompei misurati in tre diversi stadi di maturazione. Fig. 1. Total flavonoids content measured in three different ripening stages of 11 cipolla bianca di Pompei biotypes. Per ciascuno stadio di maturazione, biotipi contrassegnati da lettere differenti esibiscono valori di flavonoidi totali significativamente differenti (p 0,05) al test di Tukey HSD. For each ripening stage, biotypes with different letters are significantly different (p 0.05, Tukey HSD test). 76

94 mg/kg di peso fresco 7 6 Quercetina 3,4'- diglucoside b a Stadio A Stadio B Stadio C c d e d f g g a b h a c d e e i f b c e e d d f g gh g g h h h C1 C3 C4 C5 C6 C7 C8 C9 C10 C12 C13 Accessione Fig. 2. Livelli di quercetina 3,4 -diglucoside in 11 biotipi di cipolla Bianca di Pompei misurati in tre diversi stadi di maturazione. Fig. 2. Quercetin 3,4 -diglucoside amount measured in three different ripening stages of 11 cipolla bianca di Pompei biotypes. Per ciascuno stadio di maturazione, biotipi contrassegnati da lettere differenti esibiscono valori di quercetina 3,4 -diglucoside significativamente differenti (p 0,05) al test di Tukey HSD. For each ripening stage, biotypes with different letters are significantly different (p 0.05, Tukey HSD test). 77

95 2.11. PSR PUGLIA E RECUPERO DI ORTAGGI A RISCHIO DI EROSIONE GENETICA THE RURAL DEVELOPMENT PROGRAMME OF APULIA REGION AND THE RECOVERY OF VEGETABLES AT RISK OF GENETIC EROSION Angelo SIGNORE*, Rocco MARIANI, Pietro SANTAMARIA Dipartimento di Scienze Agro-Ambientali e Territoriali, via Amendola 165/A, 70126, Bari - Università degli Studi di Bari Aldo Moro * Autore corrispondente: Riassunto La Regione Puglia, all interno del Programma di Sviluppo Rurale (PSR) , ha emanato una serie di misure per la tutela della biodiversità. In particolare la misura 214, attraverso l azione 3, prevede la conservazione della diversità genetica mediante la promozione della coltivazione delle varietà/accessioni riportate nell elenco delle risorse genetiche autoctone regionali a rischio di erosione genetica (allegato 8) del PSR. Tale documento comprende quattordici varietà/accessioni appartenenti a nove specie orticole. Lo scopo di questo studio è stato duplice: 1) individuare sul territorio pugliese le varietà/accessioni orticole dell allegato 8 del PSR Puglia e 2) compilare una scheda descrittiva per ciascuna delle varietà coltivate. Dopo la coltivazione, le varietà/accessioni reperite sono state caratterizzate con alcuni descrittori, essenzialmente morfologici, che ne consentiranno l individuazione in maniera univoca. Le schede così ottenute sono state successivamente inserite nel Bollettino Ufficiale della Regione Puglia n. 47 del 31/03/2011, con lo scopo di illustrare, anche con l ausilio di foto, le principali caratteristiche morfologiche delle varietà coltivate al fine di riconoscere un premio agli agricoltori custodi. Parole chiave: Programma Sviluppo Rurale, ortaggi, varietà orticole coltivate, erosione genetica, schede descrittive Abstract Italy is the European country with the greatest biodiversity, hosting about half of the plant species and almost one third of all animal species. The Apulia Region, through the Rural Development Programme (RDP) , has issued a series of measures for the protection of biodiversity. In particular the action 3 of the measure 214 contemplate the conservation of genetic diversity by promoting the recovery and the cultivation of some species/landraces at risk of genetic erosion which are reported in a list (named annex 8) contained in the RDP. This document contains, among others, fourteen species/landraces belonging to nine vegetable crops, which are: cabbage, cauliflower, broccoli, artichoke, carrot, tomato, sweet potato, chicory, melon. The purpose of this research was twofold: 1) identify the germplasm of these species/landraces; 2) compile a sheet for each of these species/landraces. The species/landraces were first located within the territory of Apulia region, and cultivated with the intent to define some morphological descriptors and the aim to allow the identification of such landrace in a univocal way. The definition of morphological descriptors was made possible with the help of the material freely available inside the site Biodiversity International. 78

96 For all species/landraces considered, were prepared fact sheets that were later incorporated in the Official Bulletin of the Apulia Region in order to illustrate, with the aid of photos, the main morphological characteristics of the landraces included in Annex 8 of the PSR. Keywords: Rural Development Programme, vegetables, horticultural varieties cultivated, genetic erosion, fact sheets Introduzione L Italia è il Paese europeo con il maggiore grado di biodiversità vegetale. Blasi et al. (2005), riprendendo dati del World Conservation Monitoring Centre (1992), riportano che la flora italiana consta di oltre piante superiori le quali, anche se non si considerano le circa esotiche naturalizzate, costituiscono la metà delle specie stimate per l intera Europa. Il motivo di un così ampio patrimonio di biodiversità in Italia è da ricercare nell elevata eterogeneità ambientale del territorio e nella sua storia, nel corso della quale si sono succedute varie dominazioni e diversi popoli, spesso depositari di lontane civiltà agricole (Blasi et al., 2005). Nel corso dei secoli la continua pressione antropica e l interazione con fattori ambientali portarono l uomo ad operare una spinta selezione nei confronti di molte specie, con il risultato di creare numerose varietà che sono state coltivate e migliorate per motivi diversi, tra cui: i) un migliore adattamento alle condizioni pedo-climatiche; ii) le esigenze dei mercati locali; iii) le necessità di sussistenza. Tali varietà presentavano un elevata variabilità intraspecifica la quale ha permesso l evoluzione di genotipi con caratteristiche tali da renderle idonee alla coltivazione in un particolare ambiente, resistenti agli stress ambientali ed alle fitopatie, dotate di caratteri nutrizionali e/o aspetti qualitativi di pregio, idonee ai bisogni dei mercati, ecc. Queste peculiarità hanno consentito la loro diffusione nello spazio e nel tempo. Da diversi anni però la variabilità intraspecifica di numerose specie è soggetta a processi degradativi, indicati come erosione genetica. Tali processi sono determinati da diversi fattori: i) diffusione di sistemi monocolturali; ii) richieste del mercato (in particolare strategie commerciali che puntano verso l uniformità del prodotto); iii) comparsa di nuove tipologie di prodotto come, per esempio, la IV gamma: un caso tipico è quello del pomodoro, per il quale sono state introdotte varietà più serbevoli, di ricorrendo sempre meno al materiale genetico tradizionale (La Malfa e Bianco, 2006); iv) esigenze del settore vivaistico (principalmente ragioni organizzative collegate alla propagazione del materiale genetico), (Blasi et al., 2005); v) riduzione del tempo libero, o il suo impiego alternativo, che provoca il consumo di ortaggi che non comportino particolari difficoltà nella fase di preparazione della pietanza (La Malfa e Bianco, 2006). Inoltre, gli agricoltori, per meglio collocare il loro prodotto sui mercati, sono spinti a scegliere varietà più produttive, standardizzate e omogenee, ma proprio per questo, a stretta base genetica. Le ragioni su menzionate, unitamente a metodi di coltivazione intensivi, hanno contribuito a creare in Puglia un'emergenza ambientale riguardante il tema dell erosione genetica. La consapevolezza che la diversità genetica rappresenta una risorsa che deve essere preservata per le generazioni future e che gli agricoltori possono svolgere il ruolo di custodi di tale biodiversità, è alla base della definizione di azioni finalizzate al recupero ed alla conservazione di specie vegetali a rischio di erosione genetica. Tali evidenze hanno portato la Regione Puglia a varare, nell ambito del PSR , una serie di misure volte alla protezione della biodiversità vegetale regionale. Più in particolare la misura 214 (Pagamenti agroambientali) contiene l azione 3 (Tutela della biodiversità), strumento operativo attraverso il quale la Regione Puglia garantisce un contributo agli agricoltori i quali, in cambio, si 79

97 impegnano a conservare in situ le risorse genetiche vegetali indicate nell'allegato 8 contenuto nella misura suddetta e, pertanto, vengono qualificati come coltivatori custodi. Il presente lavoro ha avuto come obiettivi il recupero delle informazioni circa la presenza di germoplasma orticolo a rischio di erosione genetica e, successivamente, la preparazione di schede tecniche contenenti i descrittori, essenzialmente di tipo morfologico, riguardanti le specie ed accessioni orticole contenute nell allegato 8 (Tab. 1), con il fine di supportare sia gli agricoltori, per ciò che riguarda la loro richiesta di contributo, sia i tecnici della Regione Puglia nell attività di verifica della corrispondenza fra le specie/accessioni per le quali gli agricoltori hanno chiesto il sostegno e quelle inserite nel suddetto elenco. Materiali e metodi La fase iniziale ha riguardato la localizzazione e il recupero del germoplasma a rischio di erosione genetica. Sul territorio regionale sono stati individuati i soggetti (agricoltori, vivai, privati cittadini, ecc.) in possesso del materiale necessario per la riproduzione/propagazione delle specie/accessioni (S/A) inserite nel suddetto allegato. La ricerca di tale materiale ha presentato diversi gradi di difficoltà in funzione della S/A considerata. Per alcune di esse (batata leccese, carota di Polignano, cavolo da foglia e pomodoro Mandurese) sono stati gli stessi agricoltori a fornire il germoplasma, attingendo dal materiale che loro stessi selezionano e conservano per il reimpianto della coltura. Per quanto riguarda il cavolo broccolo e la cicoria (nello specifico i mùgnuli e la cicoria all acqua o otrantina ), il materiale di propagazione (le piantine per il trapianto) è stato recuperato da alcuni vivai, che le producono in quantità relativamente limitate per alcuni agricoltori che ancora seminano queste S/A. Per altre S/A (melone di Gallipoli, melone di Morciano di Leuca e carciofo - verde e violetto, bianco e centofoglie) la ricerca del germoplasma è stata notevolmente più complessa a causa della limitata diffusione e della carenza di germoplasma di questi ecotipi. Per il melone, per esempio, l unico riferimento in nostro possesso è una tesi di laurea del 1975 nella quale sono riportati i principali caratteri del frutto (peso, colore, dimensioni, ecc.). Dopo innumerevoli ricerche nelle zone di produzione, il germoplasma è stato reperito confermando quindi il rischio di estinzione per questo ecotipo e sottolineando l importanza del suo recupero. Nella fase successiva le S/A sono state messe a coltura presso l Azienda sperimentale La Noria dell Istituto di Scienze delle Produzioni Alimentari (ISPA) del CNR di Bari, in modo da poterne studiare la morfologia e definire i principali descrittori, essenzialmente di tipo morfologico, che ne consentissero l individuazione in maniera univoca. La coltivazione delle S/A è stata realizzata in pieno campo seguendo le norme di buona pratica agricola per ciascuna delle S/A considerate. Per la definizione dei descrittori morfologici è stato svolto un lavoro preliminare incentrato sulla ricerca bibliografica di tali descrittori, con particolare riferimento alle specie orticole presenti nell allegato 8. La ricerca è stata svolta avendo come punto di partenza il sito di Biodiversity International (http://www.bioversityinternational.org/), nel quale sono disponibili pubblicazioni contenenti i descrittori di varie specie in formato.pdf. In alcuni casi (per esempio melone e carota) i descrittori della specie sono contenuti in una pubblicazione dedicata, mentre per altre (per esempio il cavolo da foglia), non è stata ancora realizzata una pubblicazione specifica. In quest ultimo caso i descrittori sono stati definiti a partire da quelli del genere. Nel caso specifico del cavolo da foglia, per esempio, i descrittori sono contenuti in una pubblicazione dal titolo Descriptors for brassica and raphanus la quale riporta quelli generici per il genere Brassica 80

98 (http://www.bioversityinternational.org/nc/publications/publication/issue/descriptors_for_bras sica_and_raphanus.html - ultimo accesso 12/07/2012). Per la compilazione delle schede descrittive relative alle diverse S/A sono stati presi in considerazione solo alcuni descrittori concernenti l aspetto morfologico della pianta (quali, per esempio, colore delle foglie, margine delle stesse, portamento della pianta, tipologia di frutto, ecc.), mentre altri (dati relativi al sito di raccolta, suscettibilità agli stress abiotici, ecc.) non sono stati considerati in quanto non pertinenti con le finalità delle schede descrittive. Risultati Per ciascuna accessione riconducibile ad una delle nove specie presenti nell allegato 8, il germoplasma è stato recuperato per consentirne la coltivazione e caratterizzazione. Il recupero del germoplasma è avvenuto attraverso l individuazione dei soggetti (agricoltori, vivai, semplici cittadini) attraverso conoscenza diretta o tramite altri soggetti (consorzi agrari, associazioni, segnalazioni da parte di enti legati al territorio, ecc.). Il risultato finale è stato la realizzazione della scheda descrittiva, contenente i descrittori morfologici utili per l identificazione della S/A, che la Regione Puglia ha inserito nel suo Bollettino Ufficiale - n. 47 del 31/03/2011. Ciascuna scheda è composta da un codice che permette di identificare la S/A in maniera univoca, dai descrittori con i relativi valori e da una foto che rappresenta l organo o la parte di pianta commestibile (Fig. 1). Il codice è formato da un numero progressivo e dalla tipologia di specie, del tipo SCHEDA n. ORT. X, dove ORT. indica che si tratta di orticole, X è un numero progressivo da 1 a 14, che sta ad indicare la specie/accessione, mentre i descrittori rappresentano il parametro discriminante della S/A. Discussione La produzione delle schede per le S/A comprese nell allegato 8 rappresenta uno dei punti fondamentali nell ambito del PSR Puglia , e il suo uso rappresenta un valido strumento sia per il potenziale agricoltore custode che ha richiesto il contributo, il quale può verificare se effettivamente la specie è meritevole di premio, sia per i tecnici della Regione Puglia, i quali possono verificare l effettiva corrispondenza fra la varietà coltivata per la quale è stato chiesto il premio e quella riportata nell allegato 8. Inoltre, le schede sono state realizzate in maniera che i vari descrittori possano essere facilmente intellegibili per chiunque, senza ricorrere all uso di codici, e della rispettiva legenda, per la loro comprensione. Infatti, i descrittori che vengono normalmente utilizzati, compresi quelli contenuti nelle pubblicazioni di Biodiversity International, associano un carattere, sia esso quantitativo che qualitativo, ad un numero crescente da 1 a 9 o, in alternativa, prevedono il valore 0 o 1 per indicare l assenza o la presenza di un determinato carattere. Tale modo di descrivere i caratteri, anche se più preciso, avrebbe diminuito la leggibilità delle schede, per cui si è scelto di tradurre il valore numerico in un elemento descrittivo. Conclusioni Il PSR Puglia rappresenta un passo importante riguardo la difesa ed il recupero delle S/A coltivate ma a rischio di erosione genetica in Puglia. La sua attuazione ha permesso, seppur in maniera non ancora esaustiva, di individuare buona parte del germoplasma vegetale a rischio di erosione e di mettere in atto una serie di misure relative alla sua difesa e valorizzazione. La realizzazione delle schede descrittive ha quindi permesso di stabilire un punto fermo nel percorso di recupero e valorizzazione di tali risorse genetiche, indicando le S/A che entrano in questo percorso, lasciando aperta la possibilità all inserimento di nuove S/A, e gettando le basi per la formazione di network (con la misura 214, subazioni 4a e 4b) 81

99 per la raccolta di altro materiale a rischio di erosione e la realizzazione di basi di dati che consentano la facile individuazione di tali S/A sul territorio. La bontà nel recupero di tali S/A è corroborata da quanto affermano Rubatzky e Yamaguchi (1997) secondo i quali, fra le fonti cui attingere per le esigenze di nuova biodiversità, rientrano le cultivar primitive di specie coltivate e le specie coltivate su piccole superfici. Bibliografia BLASI C., BOITANI L., LA POSTA S., MANES F., MARCHETTI M., Stato della biodiversità in Italia. Contributo alla strategia nazionale per la biodiversità. Palombi editori, Roma. LA MALFA, G., BIANCO, V.V., Agrobiodiversità nel settore agricolo: espressioni e nuove esigenze. Italus Hortus. 13 (2): RUBATZKY, V. E., YAMAGUCHI, M., World vegetables: principles, production, and nutritive values. Ed. Chapman & Hall, London. WORLD CONSERVATION MONITORING CENTRE, Global Biodiversity: Status of the Earth's living resources. Chapman & Hall, London. Tab. 1. Elenco delle specie ortive a rischio di erosione genetica (allegato 8) contenuto nel Programma di Sviluppo Rurale Puglia Tab. 1. List of vegetable species at risk of genetic erosion (annex 8) included into the Rural Development Programme of Apulia region. Ortaggio Nome accessione Provincia di riferimento Cavolo Da foglia, a foglia riccia e liscia Bari Cavolfiore Barese cima di cola Bari Cavolo broccolo Cima nera Bari Mugnoli Foggia, Lecce, Brindisi Carota Violetto, gialla (Di Polignano) Bari Verde di Putignano Bari Carciofo Violetto di Putignano Bari Bianco di Taranto Taranto Centofoglie Bari, Brindisi Pomodoro Manduriese Taranto Batata Batata leccese Lecce Cicoria Cicoria all acqua Lecce Melone Di Gallipoli Lecce Morciano di Leuca Lecce 82

100 Fig. 1. Esempio di scheda con descrittori del pomodoro di Manduria. Fig. 1. An example of a fact sheet with descriptors concerning the Tomato of Manduria landrace. 83

101 2.12. COMPOSIZIONE FENOLICA E VOLATILE DI OLI EXTRA VERGINI DI OLIVA MONOVARIETALI DELLE CVS CORATINA, FRANTOIO, LECCINO E PERANZANA DEL TERRITORIO DAUNO PHENOLIC AND VOLATILE COMPOSITION OF CORATINA, FRANTOIO, LECCINO AND PERANZANA MONOVARIETAL EXTRAVIRGIN OLIVE OILS FROM APULIA Antonio TRANI 1*, Michele FACCIA 1, Rossana PUNZI 1, Pasqua LOIZZO 1, Angela CASSONE 1, Emidio ALVISI 2, Giuseppe GAMBACORTA 1 1 Dipartimento di Scienze del Suolo delle Piante e degli Alimenti, Università di Bari Aldo Moro, Via Amendola 165/A, Bari, Italia 2 Azienda Agricola Villa Uva, Contrada Cruste, Lucera, Italia *Autore corrispondente: Riassunto In questo lavoro è stata studiata la composizione fenolica e volatile di oli extra vergini di oliva monovarietali delle cvs Coratina, Frantoio, Leccino e Peranzana, prodotti nel territorio Dauno. Gli oli sono stati sottoposti alle seguenti determinazioni: i) analisi qualitative di base, al fine di determinarne la categoria merceologica; ii) composizione fenolica mediante cromatografia liquida ad alte prestazioni accoppiata ad un rivelatore a serie di diodi (HPLC- DAD); iii) composizione volatile mediante microestrazione in fase solida seguita da gascromatografia accoppiata alla spettrometria di massa (SPME-GC-MS). I risultati hanno mostrato che tutti gli oli rientravano nella categoria merceologica degli extra vergine. Tra le quattro cultivar, la Coratina è risultata la più ricca in polifenoli totali e nelle forme dialdeidiche dell acido elenolico, seguita da Frantoio, Peranzana e Leccino. I profili dei composti volatili hanno mostrato la predominante presenza nello spazio di testa di tutti gli oli analizzati,delle aldeidi a 6 atomi di carbonio, in particolare della trans-2-esenale. La Coratina si è contraddistinta per la presenza di due terpeni, α-copaene and α-muurolene, presenti solo in tracce negli oli delle altre cultivar. Parole chiave: composti volatili, oli monovarietali, polifenoli Abstract In this work the phenolic and volatile composition of four monovarietal extravirgin olive oil from north Apulia region was investigated. The cvs considered were Coratina, Frantoio, Leccino and Peranzana. The samples were submitted to the following analysis: i) chemical analysis for quality assessment; ii) determination of polyphenols by high performance liquid chromatography and UV detection; iii) characterization of volatiles of head space by solid phase micro-extraction and gas-chromatography coupled with mass spectrometry. Results shown that all olive oil considered were belonging to the extravirgin category. The oil of Coratina shown the highest concentration of total polyphenols and di-aldehydic forms of elenolic acid, followed in decreasing order by Frantoio, Peranzana and Leccino. The head space of all oil analyzed were meanly constituted by C6 aldehydes, the more abundant compound was trans-2-hexenal. The Coratina oil was characterized by the presence of α- Copaene and α-muurolene, that were present only in trace in the others oils. Keywords: volatile compounds, monovarietal olive oil, polyphenols 84

102 Introduzione Gli effetti benefici del consumo dell olio extravergine di oliva sulla salute umana sono ben conosciuti ed attribuiti alla composizione in acidi grassi ed alla presenza di costituenti minori quali lo squalene, i fitosteroli ed i polifenoli (Owen et al., 2000). Le caratteristiche sensoriali di un olio extravergine di oliva sono fortemente influenzate dal contenuto quanti-qualitativo di composti polifenolici e dai composti volatili che ne caratterizzano lo spazio di testa. I composti fenolici più rappresentativi riscontrabili in un olio di oliva sono: derivati dell acido benzoico ed idrossi-benzoico (acido vanillico, siringico, gallico e gentisico); derivati dell acido cinnamico (acido orto- e para- cumarico, ferulico e sinapico); derivati dell alcol feniletilico (tirosolo ed idrossi-tirosolo); altri acidi fenolici (3,4-idrossifenilacetico); forme dialdeidiche dei secoricoidi (decarbossimetil oleouropeina [3,4-DHPEA-EDA]e decarbossimetil ligustroside [p-hpea-eda] agliconi); secoricoidi (oleuropeina e ligustroside aglicone [3,4-DHPEA-EA; p-hpea-ea]); flavoni (apigenina e luteolina); lignani ((+)- pinoresinolo e (+)-1-acetossipinoresinolo) (Bendini ed altri, 2007). I composti volatili dello spazio di testa di un alimento comprendono molecole anche molto diverse dal punto di vista chimico e biochimico, derivando da differenti vie biosintetiche, seppur strettamente interconnesse. I composti volatili che caratterizzano lo spazio di testa degli oli di oliva appartengono in gran parte alle categorie delle aldeidi, alcoli, esteri e chetoni a 6 o 5 atomi di carbonio. Esenale, trans-2-esenale, esanolo, 3-metilbutan-1-olo, sono stati ritrovati in oli di oliva europei (Angerosa, 2002). I composti volatili presenti in maggiori concentrazioni non sono necessariamente i responsabili delle caratteristiche aromatiche di un alimento. Infatti, Reiners e Grosch (1998) riportano che il trans-2-esenale presente in concentrazioni di 6mg/g ha solo un terzo dell impatto sull aroma dell 1-penten-3-one presente in pochi μg/g. A tal proposito una categoria di composti volatili molto importante, in quanto caratterizzata da basse soglie di percezione, è quella dei composti terpenici, responsabili delle fragranze di molti frutti e la cui biosintesi è strettamente legata a quella dei composti fenolici. Cultivar (Benincasa et al., 2003), regioni geografiche (Angerosa et al., 1999), stadio di maturazione (Aparicio e Morales, 1998), metodi di trasformazione (Ranalli et al., 2003) sono tutti fattori in grado di influenzare in modo determinante la frazione volatile e polifenolica degli oli. In questo lavoro sono stati realizzati quattro oli monovarietali, nel territorio dauno e nelle medesime condizioni colturali, indagando le differenze tra di essi riguardanti i composti polifenolici e volatili. Materiali e metodi Caratteristiche degli oliveti e analisi qualitative - Sono stati considerati degli uliveti estesi su 30 ha in agro di Lucera (FG), con alberi di età compresa tra 10 e 50 anni, appartenenti alla cvs Coratina, Frantoio, Leccino e Peranzana. Il sesto d impianto era regolare, mediamente 8 m sulle file e 10 m tra le file, allevati in biologico, non irriguo. Le olive sono state raccolte a maturazione tecnologica ed avviate all estrazione dell olio entro le 12 ore utilizzando un impianto continuo a 3 fasi. Sugli oli sono state condotte le analisi di base secondo i metodi ufficiali di analisi (Reg. UE 61/2011). Estrazione della frazione fenolica e analisi dei polifenoli totali - L estrazione dei composti fenolici è stata effettuata secondo la procedura riportata da Gambacorta et al. (2009). Il contenuto dei polifenoli totali è stato determinato per spettrofotometria dopo reazione con il reattivo di Folin-Ciocalteu, esprimendo i risultati in mg equivalenti di acido gallico per kg di olio. 85

103 Determinazione del profilo fenolico - Il profilo fenolico è stato determinato iniettando l estratto metanolico in un cromatografo liquido WATERS serie 600E con rivelatore a serie di diodi ed equipaggiato di iniettore Reodyne 7725i con loop da 20 μl. La separazione dei componenti fenolici è stata effettuata utilizzando una colonna Nova-Pack C 18 (3,9 x 150 mm, 4 µm) (Waters, USA) ed una fase mobile composta da acqua/acido acetico 98:2 (v/v) (A) e metanolo/acetonitrile 1:1 (v/v) (B), secondo il seguente gradiente: 0-30 min, % A; min, 70-50% A; min, 50-40% A; min, 40-0% A; min, 0% A; min, % A. L acquisizione ed elaborazione dei dati cromatografici è stata realizzata utilizzando il data-station Millenium (Waters, Milford, U.S.A.). L identificazione dei composti fenolici è stata effettuata mediante l uso di standard puri, mentre la loro quantificazione è avvenuta impiegando l acido gallico come standard interno aggiunto in fase di estrazione. Estrazione dei composti volatili - Per l estrazione dei composti volatili sono state utilizzate delle vials per SPME da 12 ml (Supelco, USA), munite di tappo a vite e setto in teflon. In ogni vial sono stati posti 2 ml di campione e sottoposti ad agitazione mediante ancoretta magnetica a temperatura di 37 C costanti. Il rapporto tra volume e spazio di testa era pertanto 0,17, il tempo di equilibrazione 10 minuti. L estrazione è stata realizzata esponendo per 20 minuti, nello spazio di testa, una fibra 50/30µm DVB/CAR/PDMS, il desorbimento è avvenuto esponendo la fibra in un iniettore split a 230 C per 3 min. Analisi HRGC/MS - La separazione ed identificazione dei composti volatili è stata realizzata su gascromatografo Agilent 6890 interfacciato con uno spettrometro di massa Agilent 5975C, equipaggiato con colonna capillare DBwax della J&W, fase stazionaria polare (polietilenglicole) lunga 60 m, 0,25 mm i.d., spessore del film 0,25 m. Le condizioni cromatografiche erano: 10 min a 50 C ed incremento di 3 C/min fino a 160 C, successivo incremento di 10 C/min fino a 240 C/min e stazionamento finale per 10 min; gas di trasporto elio alla velocità lineare di 16,7 cm/sec misurato a 50 C; iniettore: split/splitless, modalità split, rapporto di splittaggio 40:1, temperatura 230 C; MSD detector: temperatura interfaccia 240 C, temperatura sorgente 240 C, temperatura detector 150 C. Energia di frammentazione 70 ev, modalità scan da 20 a 250 uma. Analisi statistica Tutti gli oli considerati sono stati sottoposti al campionamento diretto in serbatoio alla fine della campagna olivicola e conducendo almeno 4 repliche per determinazione, per campione. Tutti i dati sono stati espressi come valore medio. Il confronto dei singoli valori analitici è stato condotto mediante ANOVA ad una via su Microsoft Excel Risultati e discussione Caratteristiche qualitative - Nella Tab. 1 sono riportate le analisi qualitative di base e dei polifenoli totali. Tutti gli oli hanno presentato caratteristiche proprie della categoria commerciale degli extra vergini. I valori di acidità libera erano compresi tra 0,13 g/100g della Leccino e 0,31 g/100g della Coratina (< 0,8 % secondo norma). Il numero di perossidi era compreso tra 2,6 meq O 2 /kg della Coratina e 8,71 meq O 2 /kg della Frantoio ( 20 meqo 2 /kg per l extra vergine), indicativi di una potenziale lunga shelf life. Il K232 è risultato compreso tra 1,78 della Coratina e 2,17 della Frantoio (limite Comunitario per l extra 2,50), il K270 è risultato molto più basso del limite dell extra ( 0,22) con valori inferiori a 0,14. Il contenuto in polifenoli totali, parametro indicativo delle caratteristiche nutraceutiche dell olio, della resistenza all ossidazione e delle note sensoriali di amaro e piccante, è risultato particolarmente legato alla cultivar. Infatti, la Coratina è risultata essere la cv in grado di 86

104 produrre oli con il più alto valore in polifenoli totali (979 mg/kg) seguita da Frantoio (723 mg/kg), Peranzana (489 mg/kg) e Leccino (383 mg/kg), differenze significative ad un valore di p<0.01. Profilo fenolico - La Tab. 2 riporta la composizione fenolica degli oli determinata per HPLC- DAD. Confermando quanto sopra riportato il contenuto in polifenoli, così determinati, mostrava il seguente ordine: Coratina > Frantoio > Peranzana > Leccino. La Coratina pertanto presentava il contenuto più alto in tutti i composti identificati ed in particolar modo dei secoricoidi e relative forme dialdeidiche (p-hpea-ea e 3,4-DHPEA-EA; p-hpea-eda e 3,4-DHPEA-EDA) e dei due lignani (+)-pinoresinolo e (+)-1-acetossipinoresinolo. L olio della Frantoio ha presentato un profilo relativamente simile a quello della Coratina da cui si differenziava per la maggior presenza della 3,4-DHPEA-EA e di luteolina, differenze queste ultime statisticamente non significative. Gli oli di Peranzana e di Leccino hanno mostrato un profilo tra loro simile ma differente da quello della Coratina e della Frantoio per una bassa concentrazione di lignani, con completa assenza del pinoresinolo, e da una netta minor presenza di 3,4-DHPEA-EA. Profilo volatile - Nell olio, la via enzimatica che porta alla degradazione ossidativa degli acidi grassi, detta via della lipossigenasi (LOX), è ritenuta responsabile della produzione dei principali composti aromatici volatili, quali aldeidi ed alcoli C6. La Tab. 3 riporta la composizione volatile degli oli determinata per SPME-HRGC-MS. Sono stati identificati 30 componenti per la Coratina, 31 per la Frantoio, 27 per la Leccino e 26 per la Peranzana. Tutti gli oli sono risultati caratterizzati dalla predominante presenza della trans-2-esenale con percentuali oscillanti dal 34,8% della Peranzana al 57,6% della Leccino. La trans-2-esenale è un adeide a 6 atomi di carbonio che conferisce all olio delle note di amaro, mandorle ed erba appena tagliata e la sua presenza in alte percentuali è indicativa dell ottima qualità della materia prima, dell ottima gestione del processo di estrazione, nonché delle ottime modalità di conservazione dell olio. La freschezza e la qualità olfattiva degli oli è confermata dalla bassa presenza dell esanale, che è stata riscontrata in percentuali variabili dall 1,7% della Coratina al 3,9% della Frantoio e dalla quasi assenza della nonanale. Al fine di mettere in luce differenze importanti attribuibili al fattore varietale è stata ricercata la presenza di terpeni, essendo la biosintesi di questi ultimi caratterizzata dall intervento di numerosi enzimi alcuni dei quali inclusi nella biosintesi dei polifenoli. Negli oli di Coratina è stata ritrovata la presenza dell α-copaene e dell α-muurolene, presenti solo in tracce negli altri oli analizzati. Conclusioni I profili dei composti fenolici sono risultati ricchi in fenoli ad alto peso molecolare (secoiridoidi e lignani), indicativo di prodotti freschi e potenzialmente con un positivo impatto sulle caratteristiche sensoriali (amaro e piccante) e nutraceutiche (capacità antiossidante). I profili dei composti volatili sono risultati caratteristici di prodotti di alta qualità, per la predominante presenza delle aldeidi a 6 atomi di carbonio, in particolare della trans-2-esenale, freschi per il favorevole rapporto trans-2-esenale/esanale e ad impatto olfattivo positivo per il favorevole rapporto esanale/nonanale. Tutti gli oli realizzati sono risultati pertanto di ottima qualità e dotati di caratteristiche proprie nettamente distinguibili. Il contenuto complessivo in polifenoli totali, determinato per via spettrofotometrica, la determinazione quanti-qualitativa per HPLC dei singoli fenoli e la caratterizzazione dei composti volatili hanno messo in evidenza differenze importanti attribuibili al fattore varietale. Tali interessanti risultati richiedono una conferma mediante uno studio ripetuto per più anni, ed eventualmente sulle stesse varietà allevate in differenti aree geografiche. 87

105 Bibliografia ANGEROSA F., Influence of volatile compounds on virgin olive oil quality evaluated by analytical approaches and sensor panels. Europeand Journal of Lipid Science and Technology, 104: ANGEROSA F., BASTI C., VITO R., Virgin olive oil volatile compounds from lipoxygenase pathway and characterization of some Italian cultivars. Journal of Agricultural and Food Chemistry, 47(3): APARICIO R., MORALES M. T., Characterization of olive ripeness by green aroma compounds of virgin olive oil. Journal of Agricultural and Food Chemistry, 46(3): BENDINI A., CERRETANI L., CARRASCO-PANCORBO A., GOMEZ-CARAVACA A.M. et al., Phenolic molecules in virgin olive oils: a survey of their sensory properties, health effects, antioxidant activity and analystical methods. An overview of the last decade. Molecules, 12 (8): BENINCASA C., DE NINO A., LOMBARDO N., PERRI E., SINDONA G., TAGARELLI A., Assay of aroma active components of virgin olive oils from southern Italian regions by SPME-GC/Ion Trap mass spectrometry. Journal of Agricultural and Food Chemistry, 51(3): GAMBACORTA G., FACCIA M., PREVITALI M. A., PATI S., LA NOTTE E., BAIANO A., Effects of olive maturation and stoning on quality indices and antioxidant content of extra virgin oils (cv Coratina) during storage. Journal of Food Science, 75(3): OWEN, R. W., GAIACOSA, A., HULL, W. E., HAUBNER, R., WüRTELE, G., SPIEFELHALDER, B., BARTSCH, H., Olive-oil consumption and health: the possible role of andioxidants. Lancet Oncology, 1: RANALLI A., POLLASTRI L., CONTENTO S., LANNUCCI E., LUCERA L., Effect of olive paste kneading process time on the overall quality of virgin olive oil. European Journal of Lipid Science and Technology, 105(2): REINERS J., GROSCH W., Odorants of virgin olive oils with different flavor profiles. Journal of Agricultural and Food Chemistry, 46:

106 Tab. 1. Caratteristiche qualitative di base degli oli. Tab. 1. Chemical characteristics related to quality evaluation of monocultivar oliveoil. Campione Acidità (g/100g) NP (meqo 2 /kg) K232 K270 K *Polifenoli totali (mg/kg) Coratina 0,31 ± 0,04 2,60 ± 0,39 1,78 ± 0,05 0,14 ± 0,00 0, ± 4 Frantoio 0,23 ± 0,02 8,71 ± 0,41 2,17 ± 0,03 0,13 ± 0,01 0, ± 28 Leccino 0,13 ± 0,01 8,70 ± 0,67 1,82 ± 0,05 0,12 ± 0,00 0, ± 18 Peranzana 0,29 ± 0,02 6,39 ± 0,87 1,86 ± 0,01 0,13 ± 0,00 0, ± 11 * Espressi in equivalenti di acido gallico Tab. 2. Composizione fenolica degli oli determinata mediante HPLC. Tab. 2. Phenol composition assesd by HPLC of monocultivar olive oil. Componente (mg/kg) Coratina Frantoio Leccino Peranzana Idrossitirosolo 3,3 1,2 0,8 0,5 Tirosolo 4,0 1,2 1,7 0,5 Acido vanillico 1,1 0,2 0,7 0,5 3,4-DHPEA-EDA 22,1 8,8 13,1 18,6 p-hpea-eda 40,3 27,0 21,8 26,0 Pinoresinolo 7,4 3,9 - - Acetossipinoresinolo 10,6 8,3 1,6 1,8 Luteolina 4,1 5,2 0,2 0,8 3,4-DHPEA-EA 18,5 21,4 4,2 3,7 p-hpea-ea 8,3 1,6 1,1 2,2 Fenoli non identificati 30,1 20,8 14,2 21,8 Fenoli totali 149,8 99,6 59,5 76,2 89

107 Tab. 3. Composizione volatile dello spazio di testa degli oli monovarietali. Tab. 3. Volatile compounds identified in the head space of the monocultivar olive oil. Componente (%) Coratina Frantoio Leccino Peranzana Caratteristiche sensoriali Solfuro di metile 0,4 0,4 0,5 0,4 Propanale 0,5 1,7-1,3 dolce, pungente, floreale Acetato di metile 1,0 0,6 2,3 1,2 estereo Acetato di etile 1,3 0,5 0,5 1,4 dolce, aromatico 2-metilbutanale 0,5 0,7 0,9 0,6 malto 3-metilbutanale 0,7 1,0 1,4 0,7 dolce, fruttato, malto Etanolo 19,7 11,2 5,6 15,7 alcolico 2-propenilciclopentano 0,9 0,9 0,9 2,2 4-metil-5-etil-3-eptanone 3,8 2,3 1,9 4,4 Trans-2-butenale 0,1 0,4 0,4-3-etil-1,5-octadiene 0,6 0,6 0,5 0,4 Esanale 1,7 3,9 3,8 3,1 verde, mela, erba tagliata 2-metil-1-propanolo 0,3 0,1 1,1 0,1 come acetato di etile 3-pentanolo 0, Trans-2-pentenale 0,6 0,9 1,0 1,3 verde, mela, floreale 1-butanolo 0,4 0,4 0,3 1,1 1-penten-3-olo 4,8 6,1 4,1 11,0 terra bagnata Trans-2-esenale 47,3 53,6 57,6 34,8 amaro, mandorle, erba 3-metil-1-esene - 0,5 0,4-3,7-dimetil-cis-1,3,6- octatriene 0,7 0,5 0,6 0,1 Acetato di esile - 0,4-0,5 verde, dolce, fruttato Acetato di cis-esen-1-olo - 0,5 0 3,7 Cis-2-penten-1-olo 1,8 2,4 1,9 3,8 banana 1-esanolo 2,2 2,8 2,5 1,3 fruttato, Cis-3-esen-1-olo 1,7 1,5 1,7 3,4 banana, fruttato Nonanale 0,1 0,1 0,2 - grasso, cera Cis-2-esen-1-olo 1,5 1,5 1,5 1,6 frutta verde 2,4-esadienale 0,4 0,7 0,9 1,9 erba tagliata Acido acetico 4,9 3,6 7,0 4,0 pungente -Copaene 0, Benzaldeide - 0,1 0,1 - mandorla Dimetilsolfossido 0,2 0,1 0,2 0,2 Benzoato di metile 0,7 0,1 - - Alfa-muurolene 0, Esanale/nonanale 12,6 27,3 27,9 22,6 t-2-esenale/esanale 28,6 18,1 13,9 15,3 90

108 2.13. EFFETTI DEL DIRADAMENTO DEI GRAPPOLI E DELLA DISPONIBILITÀ IDRICA SULLA QUALITÀ DELL'UVA E DEL VINO IN AMBIENTE CALDO-ARIDO Donato ANTONACCI 1, Rosalinda GENGHI 1, Ennio LA NOTTE 2, Antonio COLETTA 1, Sandra PATI 2 (1) CRA-UTV Unità di ricerca per l uva da tavola e la vitivinicoltura in ambiente mediterraneo. Via Casamassima, Turi BA (Italia), (2) Bioagromed-Università degli Studi - Via Napoli, 25- Foggia (Italia) Riassunto Le pratiche colturali adottate per la gestione del vigneto influenzano fortemente il comportamento vegeto-produttivo delle piante, modificando le rese, la composizione delle uve, dei mosti e dei vini. La composizione fenolica delle uve al momento della vendemmia e quella dei rispettivi vini risulta particolarmente influenzata dalle pratiche viticole impiegate. Nell ambiente caldo-arido dell'italia Meridionale, nel biennio , è stata condotta una ricerca sul vitigno maggiormente coltivato in Italia, il Sangiovese n., il quale è stato sottoposto a diradamento dei grappoli in fase di invaiatura e a differente integrazione dell ETc a partire dall allegagione. L obiettivo della sperimentazione è stato quello di ottenere una differenziazione della risposta produttiva del vitigno Sangiovese n. che, in seguito a trasformazione enologica, consentisse di individuare le migliori pratiche colturali per migliorare, differenziare e valorizzare le possibilità di espressione varietale enologica, nella regione Puglia. In entrambe le annate la tesi C2V0 (non diradata e non irrigata) ha registrato il più basso peso bacca e peso grappolo. Nelle tesi diradate sono stati registrati i valori più alti. La maggiore produzione di uva per ceppo, di uva per ettaro è stata riscontrata nelle tesi non diradate. Una migliore qualità fenolica dei vini è stata riscontrata nei vini provenienti dalle tesi diradate e sottoposte a stress idrico. Parole chiave: uva da vino, diradamento dei grappoli, stress idrico, composizione fenolica Abstract Cultural practices applied to vineyard management strongly affect the behavior of vegetation and vines production, modifying crop yields, grapes, musts and wines composition. At harvest time, grapes and wines phenolic composition is particularly influenced by the viticultural practices used. In , in the dry-hot environment of Southern Italy, a research on the Sangiovese n. vine variety, mostly cultivated in Italy, was conducted; at veraison it was subjected to cluster thinning and to different integration of the ETc from setting. The purpose of the experiment was to obtain a differentiated yield response of Sangiovese n. that, after wine processing, allows to identify the best cultural practices to improve, differentiate and enhance the wine variety expression, in Apulean region. In both years, the C2V0 thesis (nonthinned and non-irrigated) recorded the lowest bunch weight and berry weight. In thinned theses the highest values were recorded. In non-thinned theses, increased yield per vine and yield per hectare were found. A better phenolic composition was found in wines from thinned theses and subjected to water stress. Keywords: wine grape, cluster thinning, water supply, phenolic composition 91

109 Introduzione La qualità delle produzioni vitivinicole è fortemente influenzata dalle pratiche colturali adottate per la gestione del vigneto. Per conseguire una differenziazione produttiva dell uva è necessario realizzare nel vigneto diversi equilibri vegeto-produttivi. Questi possono essere conseguiti attraverso diverse tecniche colturali quali disponibilità idrica, carico di gemme, concimazione azotata, inerbimento e tipo di portainnesto. Uno degli aspetti della qualità dell uva più sensibile a queste pratiche colturali risulta essere la composizione fenolica delle bacche al momento della vendemmia. In particolare il contenuto degli antociani della buccia viene influenzato significativamente dallo stato idrico delle viti durante il periodo di maturazione (Castellarin et al., 2011). Gli antociani sono composti molto importanti per la qualità, poiché sono direttamente responsabili della colorazione delle bucce e quindi del vino (Ghiselli et al., 1998). Il diradamento dei grappoli viene considerato un mezzo indispensabile per il miglioramento qualitativo dell uva, ma i risultati ottenibili con questa tecnica sono talora contrastanti. Essi dipendono, infatti, dal carico produttivo iniziale (Campostrini et al., 1991), dall epoca e dall intensità dell intervento (Di Collalto et al., 1991; Valenti et al., 1991), dalle condizioni climatiche (Morando et al., 1991; Bertamini et al., 1991) e dalle tecniche colturali in senso lato. Il diradamento dei grappoli, effettuato durante l invaiatura, determina variazioni nel comportamento vegeto-produttivo delle piante, modificando le rese e la composizione delle uve, dei mosti e dei vini. L effetto del diradamento dei grappoli si riflette sulla maturità fenolica delle uve, incrementando gli antociani ed i flavonoidi delle bacche e la loro estraibilità, con conseguente aumento dell intensità colorante e della stabilità di colore dei vini. Questi ultimi sono, inoltre, risultati migliori per profumi e persistenza gusto-olfattiva e complessivamente più tipici, aromaticamente più complessi e più strutturati (Intrieri et al., 2005). Nell ambito del Progetto PS_042 Miglioramento e valorizzazione dell espressione varietale della produzione enologica pugliese (finanziato dalla Regione Puglia) è stato preso in considerazione uno dei vitigni più coltivati in Puglia, il Sangiovese n., il quale è stato sottoposto a diradamento dei grappoli in fase di invaiatura e a differente integrazione dell ETc a partire dall allegagione. L obiettivo della sperimentazione è stato quello di ottenere una differenziazione della risposta produttiva del vitigno Sangiovese n. che, in seguito a trasformazione enologica, consentisse di individuare le migliori pratiche colturali per migliorare e valorizzare l espressione varietale nella regione Puglia. Materiali e metodi La sperimentazione è stata condotta nel biennio in un vigneto di Sangiovese n, vitigno da vino a bacca nera, situato in Puglia nella zona pianeggiante dell agro di San Severo (FG). L ambiente climatico nel quale è stata condotta la ricerca, è stato caratterizzato nel 2007 da una temperatura minima di 3,5 C (media di dicembre) ed una temperatura massima di 36,1 C (media di luglio); nel 2008 i valori sono stati rispettivamente pari a 3,7 C (media di dicembre) e 35,2 C (media di agosto). Le precipitazioni medie annue sono state pari a circa 400 mm nel biennio , distribuite principalmente in autunno-inverno con valori ridotti nel periodo estivo (luglio-agosto-settembre). Il vigneto, con sistema di allevamento a tendone è innestato su 140 Ru ed adotta un sesto d impianto di 2,50 x 2,50 m., con una densità di impianto di ceppi per ettaro ed ha un età di 9 anni. È inoltre dotato di impianto di irrigazione a microportata di erogazione con ali adacquatrici posti nell interfila e gocciolatori da 8 L/h disposti uno per vite. Lo schema sperimentale adottato è stato a split-plot, con tre repliche, nel quale sono state impostate due parcelle in cui sono stati messi a confronto due livelli produttivi: il primo (C1) in cui si è proceduto, in fase di invaiatura, al diradamento del 30% del numero dei grappoli 92

110 per vite; il secondo (C2), in cui non è stata effettuata nessuna riduzione del numero dei grappoli per vite. Ogni parcella è stata sottoposta a due diversi regimi irrigui (V2 e V1) messi a confronto con una gestione viticola senza alcun apporto irriguo (V0). La distribuzione dell acqua è avvenuta secondo turni settimanali nel periodo allegagione-maturazione. Il volume irriguo stagionale (m 3 /ha) adottato nelle tesi V2 e V1 ha tenuto conto dell evapotraspirazione colturale (ETc) e delle precipitazioni superiori a 10 mm durante il periodo di accrescimento e maturazione della bacca (luglio-settembre). Le tesi sono state così caratterizzate: C2V0: nessuna integrazione dell ETc e nessuna riduzione del numero dei grappoli per ceppo; C1V0: nessuna integrazione dell ETc e riduzione del 30% del numero dei grappoli per ceppo; C2V1: integrazione del 24% dell ET c (640 m 3 /ha) e nessuna riduzione del numero dei grappoli per ceppo; C1V1: integrazione del 24% dell ET c (640 m 3 /ha) e riduzione del 30% del numero dei grappoli per ceppo; C2V2: integrazione del 36% dell ET c (960 m 3 /ha) e nessuna riduzione del numero dei grappoli per ceppo; C1V2: integrazione del 36% dell ET c (960 m 3 /ha) e riduzione del 30% del numero dei grappoli per ceppo. I rilievi viticoli sono stati effettuati in campo sulle file centrali di ogni parcella, considerando 10 viti per ognuna delle tre repliche, per un totale di 30 viti per tesi. A partire dall invaiatura e fino alla vendemmia, per ogni tesi, sono stati raccolti settimanalmente campioni di 100 acini per seguire l evoluzione della loro maturazione (peso della bacca, acidità titolabile, solidi solubili totali, ph). Alla raccolta commerciale, su un campione di dieci acini per ripetizione (3 ripetizioni/tesi) sono state prelevate le bucce per l estrazione dei polifenoli e per la determinazione del contenuto in antociani secondo quanto previsto da Di Stefano et al. (1991). La composizione antocianica è stata valutata in HPLC (Revilla et al., 2000). Al momento della vendemmia sono stati effettuati i rilievi produttivi, determinando: produzione per pianta, produzione per ettaro, peso medio grappolo, peso medio bacca, produzione zucchero/pianta. Le uve vendemmiate sono state sottoposte a vinificazione tradizionale in rosso con 5 giorni di macerazione e senza altri trattamenti enologici. Il contenuto polifenolico ed antocianico dei vini è stato valutato secondo quanto previsto da Di Stefano et al. (1989). Per ogni parametro, i dati ottenuti sono stati sottoposti ad elaborazione statistica utilizzando il test Anova ( one-way variance analysis ) per la separazione delle medie. Le differenze sono state confrontate con un post-hoc test (Tukey HSD test) e sono state considerate significative con p 0,05. Risultati e discussione Parametri produttivi - Nel 2007, la tesi C2V0 ha registrato il più basso peso medio bacca ed il più basso peso medio grappolo; i valori più alti sono stati registrati nella tesi C1V1 (Tab. 1). Nelle tesi C2V1 e C2V2 si è registrata la più alta produzione di uva per ceppo, produzione di uva per ettaro e produzione di zucchero per ettaro. Nella tesi C1V0 la mancata integrazione dell ETc combinata al diradamento dei grappoli ha fatto registrare la più bassa produzione ceppo, produzione ettaro e zucchero ettaro. 93

111 Tab. 1. Dati produttivi rilevati nelle tesi alla vendemmia. Tab. 1. Yield parameters measured at harvest time. Tesi-Theses C2V0 C1V0 C2V1 C1V1 C2V2 C1V2 Vendemmia del Peso medio bacca (g) 1,5 b 2,1 a 2,2 a 2,3 a 2,1 a 2,4 a Peso medio grappolo (g) 424 c 516 abc 504 bc 621 a 554 ab 585 ab N grappoli/ceppo 49 a 34,5 b 51,2 a 34,6 b 45,7 a 38,8 b Produzione ceppo (kg) 20,8 bc 17,8 c 25,8 a 21,5 abc 25,3 a 22,7 abc Produzione ettaro (t) 33,3 bc 28,5 c 41,3 a 34,40 abc 40,5 a 36,3 abc Zucchero ettaro (t) 5,99 b 5,19 b 7,93 a 6,96 ab 7,46 a 6,74 ab Vendemmia del Peso medio bacca (g) 2,8 c 2,9 bc 2,9 bc 3,1 abc 3,4 a 3,2 ab Peso medio grappolo (g) 442 b 557 ab 505 b 603 ab 493 b 697 a N grappoli/ceppo 44,5 a 31,3 b 43,7 a 31,9 b 45,3 a 31,4 b Produzione ceppo (kg) 19,7 ab 17,4 b 22,1 a 19,2 ab 22,3 a 21,9 a Produzione ettaro (t) 31,5 ab 27,9 b 35,3 a 30,8 ab 35,7 a 35,0 a Zucchero ettaro (t) 5,98 c 6,81 abc 7,94 ab 6,71 bc 7,86 ab 8,23 a In riga, a lettere diverse corrisponde una differenza statisticamente significativa per P 0,05. In rows, different letters indicate means significantly different at P<0,05. Anche nel 2008, la tesi C2V0 ha registrato sia il più basso peso medio bacca che il più basso peso medio grappolo. Il peso medio grappolo maggiore si è registrato nella tesi C1V2. In quest ultima è stata registrata la più alta produzione ceppo, produzione ettaro e zucchero ettaro. Risultati simili sono stati osservati nelle tesi C2V1 e C2V2 ad eccezione della produzione di zucchero ettaro. La minore produzione di uva per ceppo si è riscontrata nella tesi C1V0. La tesi C2V0 ha riportato la più bassa produzione di zucchero per ettaro. Parametri analitici - Nella vendemmia 2007, la tesi C1V1 ha registrato il più alto contenuto in solidi solubili totali (SST). A parità di integrazione del 36% dell ETc, la tesi con riduzione del numero di grappoli per ceppo (C1V2) ha riportato, per il rapporto tra il contenuto in solidi solubili totali e acidità titolabile (SST/AT), il valore più elevato; la tesi senza riduzione del numero di grappoli per ceppo (C2V2) ha riportato il valore più basso. Rispetto al 2007, le uve vendemmiate nel 2008 hanno mostrato, in linea di massima, un maggior livello di maturazione, come evidenziato dal rapporto SST/AT (Tab. 2). La tesi C1V0 avente la più bassa produzione di uva per ceppo ha riportato il più alto valore di SST/AT. 94

112 C2V0 C2V1 C2V2 C2V0 C2V1 C2V2 Tab. 2. Dati analitici rilevati nelle tesi. Tab. 2. Analitycal parameters measured at harvest time. Tesi-Theses C2V0 C1V0 C2V1 C1V1 C2V2 C1V2 Vendemmia del SST ( Brix) 18,0 b 18,2 b 19,2 ab 20,2 a 18,4 b 18,6 b ph 3,78 a 3,64 b 3,62 b 3,62 b 3,62 b 3,77 a AT (g/l) 4,7 b 4,7 b 4,8 b 5,3 a 4,9 ab 4,6 b SST/AT 38,6 cd 39,2 bc 39,8 ab 38,4 cd 37,5 d 40,4 a Vendemmia del SST ( Brix) 19,0 d 24,4 a 22,5 bc 21,8 c 22,0 c 23,5 ab ph 3,53 e 3,87 a 3,66 d 3,78 bc 3,75 c 3,52 e AT (g/l) 5,3 b 4,4 d 4,8 c 4,6 cd 4,3 d 6,0 a SST/AT 35,6 e 56,0 a 46,6 c 47,5 c 51,3 b 39,2 d In riga, a lettere diverse corrisponde una differenza statisticamente significativa per P 0,05. In rows, different letters indicate means significantly different at P<0, Fig. 1: Forme antocianiche libere presenti nelle uve Sangiovese n. alla vendemmia. I valori sono espressi in mg/kg di peso di uva fresca. Antocianin free forms in Sangiovese n. grapes at the harvest. The values are expressed in mg/kg fresh grapes weight. Contenuto polifenolico e forme antocianiche delle uve Sangiovese n. Il contenuto in polifenoli totali, di flavani reagenti alla vanillina e delle proantocianidine è variato in maniera differente a seconda dell annata ed è stato maggiore soltanto per le uve vendemmiate nel In particolare la tesi C1V1 ha comportato un maggior accumulo di composti fenolici. Le uve vendemmiate nel 2007 hanno riportato anche una maggiore quantità di antociani totali (delfinidina (Df), cianidina (Cy), petunidina (Pt), peonidina (Pn), malvidina (Mv) espresse come somma delle forme glucosilate non aciliche, cumaroilglucosilate e acetilglucosilate) nelle bucce rispetto alle uve vendemmiate nel 2008 (Fig. 1). Nella tesi C1V1 si è registrato il contenuto più alto pari a mg/kg; le malvidine e le peonidine sono risultate le forme antocianiche maggiormente presenti. Nel 2008 i valori delle tesi hanno evidenziato che non ci sono state influenze delle pratiche viticole applicate. In entrambe le annate, le forme glucosidiche non aciliche sono risultate superiori al 98%. 95

113 C1V0 C1V1 C1V2 C1V0 C1V1 C1V Fig. 2: Forme antocianiche libere presenti nei vini ottenuti da uve Sangiovese n. I valori sono espressi in mg/l di vino. Antocianin free forms present in wines made from Sangiovese n. grapes. The values are expressed in mg/l of wine. Analisi dei vini - Come ci si aspettava, i vini ottenuti dalle uve vendemmiate nel 2008 hanno riportato una maggiore gradazione alcolica rispetto ai vini del 2007 perché ottenuti da uve che presentavano una maggiore concentrazione in solidi solubili totali. Nel 2007, i vini ottenuti dalle uve delle tesi C2V0 e C1V2 hanno registrato il più alto contenuto in polifenoli totali. Nel 2008 le differenze tra le tesi sono risultate meno marcate evidenziando come non siano state influenzate dalle pratiche viticole applicate anche se nelle tesi con un leggero deficit idrico e minor numero di grappoli/ceppo c è stata la tendenza ad un maggior contenuto di polifenoli totali. In entrambe le annate, i vini derivanti dalla tesi C2V2 hanno riportato il minor contenuto in polifenoli totali.sia nel 2007 che nel 2008 i vini ottenuti dalle tesi condotte senza integrazione dell ETc hanno presentato un maggior contenuto in antociani totali (delfinidina (Df), cianidina (Cy), petunidina (Pt), peonidina (Pn), malvidina (Mv) espresse come somma delle forme glucosilate non aciliche, cumaroilglucosilate e acetilglucosilate). Anche nei vini le malvidine sono state le forme antocianiche maggiormente presenti. In entrambe le annate, le forme glucosidiche non aciliche sono risultate superiori al 98% (Fig. 2). Dall analisi della frazione volatile libera del C2V0 C1V0 C2V1 C1V1 C2V2 C1V2 Fig. 3: Distribuzione delle classi di molecole volatili libere (mg/l), nei vini ottenuti da uve Sangiovese n. vendemmiate nel Distribution of free volatile molecules (mg/l) in wines made from Sangiovese n. grapes harvested in vino Sangiovese ottenuto dalle uve vendemmiate nel 2008 emerge come gli alcoli siano stati i composti maggiormente presenti, seguiti dagli esteri e dagli acidi (Fig. 3). Le pratiche viticole considerate hanno influenzato la qualità delle uve e dei relativi vini. In particolare, il diradamento associato a stress idrico (C2V0) sembra causare un generale miglioramento della qualità aromatica dell uva che si ripercuote sui vini corrispondenti. I vini derivanti da uve sottoposte a stress idrico hanno presentato un contenuto in sostanze volatili del 30% superiore agli altri vini. Conclusioni La ricerca biennale sulla risposta del vitigno Sangiovese n. al diradamento dei grappoli e alla differente integrazione dell Etc ha evidenziato un effetto sulla produttività delle piante, sulla qualità delle uve e di conseguenza dei vini. In entrambe le annate, la tesi C2V0 ha presentato il più basso peso medio bacca e peso medio grappolo. I valori più alti sono stati invece registrati nelle tesi i cui grappoli sono stati diradati del 30% (C1V1 e C1V2). Sebbene in queste tesi sia stata differenziata l integrazione dell Etc, essa è stata minima (24% ETc contro 36% ETc) e tale da non evidenziare differenze significative tra le tesi per il peso bacca ed il peso grappolo. La tesi C1V0 ha riportato in entrambe le annate le più basse produzioni di uva 96

114 per ceppo e di uva per ettaro dovute al minor numero di grappoli per ceppo ed al più basso peso medio grappolo. In generale le uve vendemmiate nel 2008 hanno presentato un maggior livello di maturazione rispetto a quelle raccolte nel 2007: ciò ha portato ad una maggiore gradazione alcolica dei vini. Il contenuto in polifenoli ed antociani totali delle forme libere delle uve Sangiovese n. è variato in maniera differente a seconda dell annata: nel 2007 la tesi C1V1, caratterizzata da un leggero deficit irriguo in combinazione con il diradamento dei grappoli, ha riportato il maggior contenuto di composti fenolici e di antociani totali. Nel 2008 le differenze tra le tesi non sono state influenzate dalle pratiche viticole applicate. Lo stress idrico ha migliorato la qualità dei vini: le tesi senza integrazione dell ETc hanno riportato il più alto contenuto in polifenoli totali ed in antociani dimostrando come il deficit idrico è uno strumento importante per affinare la qualità delle produzioni pur inducendo effetti negativi sulla produttività. In generale una migliore qualità fenolica è stata notata nelle tesi diradate. Inoltre, i vini derivanti da uve sottoposte a stress idrico hanno presentato un contenuto in sostanze volatili del 30% superiore agli altri vini. Bibliografia BERTAMINI M., IACONO F., SCIENZA A., Manipolazione dei rapporti sink-source mediante diradamento dei grappoli e riflessi sulla qualità (cv Cabernet sauvignon). Vignevini, 18, 10: CASTELLARIN S.D., BUCCHETTI B., FALGINELLA L., PETERLUNGER E., Influenza del deficit idrico sulla qualità delle uve: aspetti fisiologici e molecolari. Italus Hortus, 18: DI COLLALTO G., FERRINI F., BIRICOLTI S., Risultati di ricerche sul diradamento dei grappoli della vite in ambiente toscano. Vignevini, 18 (7-8): GHISELLI A., NARDINI M., BALDINI A., SCACCINI C., Antioxidant activity of different phenolic fractions separated from an italian red wine. Journal of Food and Agricultural Chemistry, 46: HARMON, F. N., AND E. SNYDER., Effect of cluster removal upon fruit of Vinifera grapes. Proceedings of the American Society For Horticultural Science, 44: INTRIERI C., FILIPPETTI I., VALENTINI G., SEGHETTI L., Il diradamento migliora la qualità del Montepulciano a pergola. L Informatore agrario, 44: MORANDO A., GERBI V., MINATI J.L., EYNARD I., ARNULFO C., TARETTO E., MINETTI G.,1991. Confronto tra interventi di diradamento e spuntatura dei grappoli all allegagione e all invaiatura. Vignevini, 18 (7-8): VALENTI L., BRANCADORO L., MASTROMAURO F., FAILLA O., GIONGO A., BOGONI M., SCIENZA A., Il controllo della maturazione dell uva Chardonnay e Riesling renano in Oltrepo Pavese ottenuto attraverso il diradamento dei grappoli. Vignevini, 18 (7-8):

115 2.14. PROFILO ENZIMATICO DI ALCUNE ACCESSIONI DI POMODORO DA SERBO COLTIVATE IN SICILIA ENZYMATIC TRAITS IN SOME LONG STORAGE SICILIAN TOMATO FRUITS Riccardo N. BARBAGALLO 1, Cristina PATANÈ 2, Isabella DI SILVESTRO 2, Marco CHISARI 1 1 Dipartimento di Scienze delle Produzioni Agrarie e Alimentari (DISPA) - Università di Catania, Via S. Sofia 98, Catania (Italia), 2 Consiglio Nazionale delle Ricerche (CNR) - Istituto per i Sistemi Agricoli e Forestali del Mediterraneo (ISAFoM) - Str.le V. Lancia, Zona Industriale, Blocco Palma I, Catania (Italia), Riassunto Sono stati valutati 3 genotipi di pomodoro da serbo ('Montallegro', 'Filicudi', 'Principe Borghese'), coltivati in seccagno e confrontati con l ibrido commerciale 'Brigade di pomodoro da industria, testando gli enzimi ad azione elicitaria antiossidante, ascorbato perossidasi, catalasi e superossido dismutasi, insieme con il contenuto di vitamina C che contrasta l imbrunimento da polifenolossidasi, nonché le attività pectinmetilesterasi e poligalatturonasi, responsabili del rammollimento dei frutti. La buona rispondenza tra i risultati delle attività enzimatiche ed i parametri a supporto, evidenziava il ruolo strategico dell'indagine enzimatica per la selezione degli ecotipi di pomodoro da serbo presenti in Sicilia. Parole chiave: stress irriguo, vitamina C, sistema antiossidante, polifenolossidasi, pectin metilesterasi, poligalacturonasi Abstract The activities of some enzymes with antioxidant extracting properties, namely ascorbate peroxidase (APX, E.C ), catalase (CAT, E.C ) and superoxide dismutase (SOD, E.C ) were evaluated, together with the vitamin C content that may contribute to enhance the antioxidant pattern of tomato fruits and act against browning reactions due to polyphenol oxidase (PPO, E.C ) which, together with pectinase, pectin methylesterase (PME, E.C ) and polygalacturonase (PG, EC ) responsible for cell wall softening, negatively affect their shelf life. Three different long-storage tomato genotypes ('Montallegro', 'Filicudi', 'Principe Borghese'), were tested in comparison with the widespread hybrid 'Brigade cultivated in dry conditions in typical semi-arid Mediterranean environment (Sicily, Italy). The positive compliance between results of enzymes activities and the parameters evidenced the strategic role of enzymatic investigation which could represent a useful tool for the selection of long-storage tomato ecotypes present in Sicily, much requested by the market due to their storage properties and nutraceutical quality. Keywords: water stress, vitamin C, antioxidative system, polyphenol oxidase, pectin methylesterase, polygalacturonase Introduzione La salvaguardia e la valorizzazione di ecotipi caratterizzati da una elevata concentrazione di molecole ad acclarato effetto nutraceutico (Pernice et al., 2010) e da una prolungata conservabilità nel tempo, rappresentano le principali tendenze attuali della ricerca sul 98

116 pomodoro (Lycopersicum esculentum Mill.). In particolare, l'individuazione e la quantificazione di enzimi endogeni possono rappresentare degli strumenti per la valutazione del prodotto conservato dopo la raccolta e/o trasformato. Infatti, alcune attività enzimatiche costituiscono dei potenziali indici di degradazione dei frutti, mentre altre contribuiscono, insieme a composti chimici ad effetto nutraceutico (la vitamina C, ad esempio), a contrastarne la perdita di qualità. Nell ambito delle prime, un ruolo rilevante svolgono gli enzimi intracellulari degradativi, polifenolossidasi (PPO, E.C ), pectinmetilesterasi (PE, E.C ) e poligalatturonasi (PG, E.C ) (Barbagallo et al., 2009), mentre tra le seconde, ascorbato perossidasi (APX, E.C ), catalasi (CAT, E.C ) e superossido dismutasi (SOD, E.C ), contribuiscono al potenziamento del sistema elicitario antiossidante dei frutti (Vranová et al., 2002). Nella presente ricerca sono stati testati per le citate attività enzimatiche 3 genotipi di pomodoro da serbo ('Montallegro', 'Filicudi', 'Principe Borghese'), posti a confronto con l ibrido commerciale da industria Brigade e coltivati in seccagno, in un ambiente tipicamente semi-arido della Sicilia, in cui la ridotta disponibilità di acqua svolge un positivo ruolo nell attivazione di meccanismi di difesa (Barbagallo et al., 2008; Patané e Cosentino, 2010). Materiali e metodi Esperimenti in campo - La Sede di Catania del CNR-ISAFoM ha in atto una collezione di ecotipi di pomodoro da serbo, reperiti in aree diverse del Meridione d Italia, sui quali è in itinere una intensa attività di ricerca rivolta alla caratterizzazione fisiologica, agronomica, produttiva e qualitativa finalizzata ad una loro classificazione e ad una selezione dei tipi più interessanti. Le prove sono state condotte presso l Azienda Sperimentale della Facoltà di Agraria di Catania, impiegando 3 genotipi di pomodoro da serbo ('Montallegro', 'Filicudi', 'Principe Borghese') posti a confronto con l ibrido commerciale da industria 'Brigade (Asgrow Italia Vegetable Seeds, Italia), coltivati in seccagno (irrigazione soltanto al trapianto, circa 400 m 3 /ha), in un ambiente della piana di Catania. Il trapianto in pieno campo è avvenuto il 23 Aprile 2010 e la raccolta eseguita il 14 Luglio, allorché i frutti si presentavano maturi su oltre il 90% della parcella. Trenta pomodori per replica sono stati scelti a random, lavati con acqua di rubinetto per eliminare le impurità presenti, poi con acqua distillata e lasciati asciugare. Su tre pomodori per replica è stato valutato l indice di consistenza, mediante penetrometro (Bertuzzi FT011, Alfonsine, Italia) ed espresso in kg/cm 2. La restante parte dei frutti è stata omogeneizzata in Ultraturrax T25 (Janke & Kunkel, Staufen, Germania) in bagno di ghiaccio per 3 min e utilizzata per le determinazioni dei componenti antiossidanti e delle attività enzimatiche. Determinazione della Vitamina C - Acido ascorbico e deidroascobico sono stati determinati secondo il metodo riportato da Kampfenkel et al. (1995) a partire da una sospensione omogeneizzata (0.1 g) impiegando 60 g kg -1 di acido metafosforico ed effettuando le misure spettrofotometriche a 525 nm. Il saggio si basa sulla riduzione da parte dell acido ascorbico del Fe 3+ a Fe 2+ e sulla misura spettrofotometrica del Fe 2+ complessato con 2,2 -dipiridile. L acido deidroascorbico è ridotto ad acido ascorbico per preincubazione del campione con ditiotreitolo (DTT) e l eccesso rimosso con N-etilmaleimide. Il contenuto totale di vitamina C è stato calcolato come somma del contenuto di acido ascorbico e deidroascorbico ed espresso in mg kg -1 di sostanza fresca (s.f.). Determinazione degli enzimi degradativi (PME, PG, PPO) - Gli enzimi degradativi pectinmetilesterasi (PME, E.C ), poligalatturonasi (PG, EC ) sono stati estratti secondo il metodo proposto da Stevens et al. (2004) opportunamente modificato. 99

117 Un aliquota di omogeneizzato di pomodoro (10 g) è stato addizionato con 50 ml di soluzione estraente (0.1 mol L -1 di sodio acetato, 1.3 mol L -1 di NaCl and 40 mmol L -1 di 2- mercaptoetanolo a ph 7). La miscela è stata omogeneizzata in Ultraturrax T25 per 10 minuti e centrifugata a x g per 20 min at 4 C. Il surnatante è stato filtrato sottovuoto e utilizzato come estratto enzimatico. Pectinmetilesterasi (PME, E.C ). È stata saggiata in accordo al metodo proposto da Fachin et al. (2002) ed espressa in unità (U), definite in μmoli di acido rilasciati al min a 22 C per kg di prodotto fresco. Poligalatturonasi (PG, E.C ). Il saggio si basa sul rilascio dei gruppi riducenti prodotti dall enzima, secondo il metodo proposto da Gross (1982). L'attività enzimatica (U) è stata espressa in μmoli di equivalenti di acido D-galatturonico ridotti al min a 25 C per kg di prodotto fresco. Polifenolossidasi (PPO, E.C ). L attività catecolasica dell enzima è stata estratta da 20 g di omogeneizzato a cui sono stati aggiunti a 40 ml di acetone a freddo (-20 C) continuamente sotto agitazione per 10 min. La miscela è stata filtrata sottovuoto in imbuto separatore e la polvere acetonica ottenuta, raccolta e sospesa in 30 ml di tampone citratefosfato 0.1 mol L -1 a ph 7.5, mantenuta over-night a 4 C prima di essere nuovamente filtrata. La soluzione limpida è stata poi ultrafiltrata in cella equipaggiata di membrana da 50 kda (Millipore, Milano, Italia) e utilizzata come estratto enzimatico. Il saggio è stato condotto spettrofotometricamente a 505 nm impiegando acido 3,4-diidrossifenilacetico DOPAC come substrato e MBTH (3-metil-2-benzotiazolinone idrazone) come agente cromoforo, secondo il metodo proposto da Spagna et al. (2005). Una unità di attività (U) è definita come la quantità di enzima che produce un incremento di assorbanza pari a al min a 25 C nelle condizioni sopra descritte. I risultati sono stati espressi in U kg -1 di peso fresco. Determinazione degli enzimi antiossidanti (APX, CAT, SOD) - L estrazione dei tre enzimi antiossidanti, ascorbato perossidasi (APX, E.C ), catalasi (CAT, E.C ) e superossido dismutasi (SOD, E.C ) è stata condotta ponendo a contatto un aliquota di omogeneizzato di pomodoro (1 g) con 10 ml di etanolo assoluto freddo per 30 min. La sospensione è stata centrifugata a x g a 4 C e il surnatante scartato. L estrazione in etanolo è stata ripetuta due volte. Il pellet è stato in seguito sospeso in 3 ml di tampone sodio-fosfato 50 mmol L -1 a ph 7.0 contenente 0.1 ml di acido etilendiamminotetracetico (EDTA) e 3% di polivinilpirrolidone (p/v). Dopo centrifugazione a x g per 20 min a 4 C, i surnatanti sono stati raccolti e utilizzati per i successivi saggi enzimatici. Ascorbato perossidasi (APX, E.C ). L attività enzimatica è stata saggiata registrando per via spettrofotometrica la diminuzione del contenuto in ascorbato a 290 nm, secondo il metodo proposto da Ushimaru et al. (1997). Una unità enzimatica (U) è definita come la quantità di enzima in grado di ossidare 1 μmol di ascorbato al minuto a 20 C. I risultati sono stati espressi in U kg -1 di peso fresco. Superossido dismutasi (SOD, E.C ). L attività enzimatica è stata saggiata misurando la sua capacità ad inibire la fotoriduzione del blu di tetrazolio (NBT), incolore, in formazano di colore blu, in accordo al metodo proposto da Masia (1998). Una unità enzimatica (U) è definita come la quantità di enzima in grado di inibire il 50% di fotoriduzione dell NBT a 560 nm. I risultati sono stati espressi in U kg -1 di peso fresco. Catalasi (CAT, E.C ). L attività enzimatica è stata saggiata misurando per via spettrofotometrica la decomposizione di H 2 O 2, in seguito all azione dell enzima, mediante diminuzione dell assorbanza a 240 nm, in accordo al metodo proposto da Aebi (1984). Una unità enzimatica (U) è definita come la quantità di enzima in grado di decomporre 1 μmol di H 2 O 2 al minuto. Per evitare una rapida diminuzione della velocità iniziale della reazione, il 100

118 saggio è stato condotto usando basse concentrazioni di H 2 O 2 (< 0.05 M). I risultati sono stati espressi in U kg -1 di peso fresco. Reagenti - Reagenti e solventi erano di grado analitico ed acquistati presso Sigma-Fluka- Aldrich Chemicals Co. (Milan, Italy). Analisi statistica - I dati sono stati analizzati statisticamente mediante analisi della varianza a 1 via (ANOVA) utilizzando CoStat version (CoHort Software). Le differenze tra le medie sono state valutate ai fini della significatività applicando il test di Tukey-Kramer. Risultati e discussione Vitamina C - I pomodori testati si sono caratterizzati per elevati livelli vitamina C (Tab. 1), in grado di conferire ai frutti un azione bioprotettiva nei confronti dell insorgenza di patologie legate a processi degenerativi (Pernice et al., 2010). In dettaglio, i tre ecotipi di pomodoro da serbo ('Montallegro', 'Filicudi', 'Principe Borghese') posti a confronto con l ibrido commerciale da industria 'Brigade, hanno mostrato una concentrazione significativamente più elevata di vitamina C. Come noto, la vitamina C può prevenire i danni ossidativi dei frutti prolungandone la shelf life (Slimestad e Verheul, 2009). Dumas et al. (2003) hanno inoltre riportato come il contenuto di vitamina C può essere potenziato da una limitata disponibilità irrigua, benché tale effetto sia anche cultivar-dipendente. Attività degli enzimi degradativi (PME, PG, PPO) - Gli enzimi degradativi PME e PG sono i principali responsabili della perdita di turgore delle bacche di pomodoro (softening), a seguito di fenomeni di autolisi delle cellule e decompartimentalizzazione di alcuni componenti cellulari delle pareti, le sostanze pectiche che sono i loro costituenti principali (Barbagallo et al., 2009). Si ritiene tuttavia che ciò avvenga soprattutto in post-raccolta (Chung et al., 2006), con la PME che innesca la degradazione della parete cellulare e le PG che in successione agiscono con azione depolimerizzante sulla lamella mediana (Abeles e Takeda, 1990). Le attività PME e PG sono risultate significativamente più elevate nell ecotipo Filicudi, in accordo con i modesti valori di resistenza allo schiacciamento riscontrati, presentando una maggiore suscettibilità al rammollimento rispetto agli altri pomodori testati (Tab. 2). Gli ecotipi Montallegro e Principe Borghese, caratterizzati da attività PME e PG intermedie hanno mostrato una consistenza dei frutti maggiore rispetto a Filicudi. Il testimone Brigade, pur presentando attività pectinasiche elevate, per quanto inferiori rispetto a Filicudi, si è distinto per la notevole consistenza dei frutti, come probabile risultato del programma di miglioramento genetico a cui è stato sottoposto, rivolto ad una minore incidenza di altre attività degradative correlabili con la perdita di consistenza quali, ad esempio, cellulasi delle pareti cellulari. Di norma la coltivazione in condizioni di stress irriguo determina un effetto positivo sulla consistenza dei frutti, associata ad una diminuzione del turgore interno delle bacche e conseguentemente ad una pressione inferiore sulle pareti cellulari, caratterizzate da una maggiore elasticità epidermica (Guichard et al., 2011). L attività polifenolossidasica è risultata elevata in Principe Borghese e Montallegro e più contenuta nell ecotipo Filicudi e nel testimone Brigade. Tale enzima svolge un azione negativa nei confronti della stabilità dei polifenoli che consiste nella idrossilazione dei monofenoli a o-difenoli (attività cresolasica) e nell ossidazione degli o-difenoli ai correspondienti o-chinoni (attività catecolasica) che sono i principali prodotti della reazione. Gli o-chinoni sono altamente reattivi per cui possono subire polimerizzazione radicalica che ha come risultato la formazione di colorazioni indesiderate dei frutti (browning) e la perdita del valore nutrizionale per il coinvolgimento nelle reazioni di proteine e alcuni amminoacidi (Barbagallo et al., 2009). 101

119 Attività degli enzimi antiossidanti (APX, CAT, SOD) - È stato accertato il ruolo delle AOS (active oxygen species), e in particolare dell H 2 O 2, nell attivazione delle risposte di difesa a stress abiotici e biotici, benché i dettagli dei segnali di trasduzione che mediano le risposte di difesa rimangano ancora poco chiari (Vranová et al., 2002). Quando l accumulo delle AOS supera la capacità del sistema antiossidante endogeno del vegetale di rimuoverle, insorge il danno ossidativo che può colpire il sistema delle membrane cellulari. Contenuti idrici molto bassi agiscono come molecole segnale che attivano le risposte di difesa con un incremento degli enzimi ad azione antiossidante. Il sistema ad azione protettiva include superossido dismutasi, in grado di eliminare molto efficacemente O 2 - catalizzando la reazione di dismutazione di tale radicale anionico a O 2 e H 2 O 2 ; catalasi, che eliminano H 2 O 2 generato dalle ossidasi, nonché ascorbato perossidasi, uno degli enzimi del ciclo ascorbato-glutatione, anch esso coinvolto nella detossificazione da H 2 O 2, ma piuttosto labile ed inattivato ad alte concentrazioni di perossido. Il coinvolgimento e il ruolo di tali enzimi nella protezione contro lo stress ossidativo sono stati dimostrati in piante transgeniche che esprimono livelli maggiori di alcuni essi (Allen et al., 1997). Il testimone Brigade ha mostrato una maggiore concentrazione di APX e SOD. L attività CAT non si è distinta tra Brigade, Filicudi e Principe Borghese, mentre l ecotipo Montallegro ha mostrato una maggiore concentrazione dei 3 enzimi elicitari antiossidanti (Tab. 3). È ipotizzabile che la maggiore concentrazione degli enzimi antiossidanti nel testimone Brigade rispetto agli altri campioni testati possa giocare un ruolo finora sottovalutato nella definizione dell equilibrio dinamico fra componenti ad azione antiossidante e attività PPO. Ciò risulta nel genotipo Filicudi che ha presentato una bassa attività PPO, in accordo con l elevata concentrazione dei tre enzimi antiossidanti e la più elevata concentrazione di vitamina C. La cultivar Principe Borghese e soprattutto l ecotipo Montallegro, caratterizzati da una minore disponibilità degli enzimi antiossidanti, hanno mostrato una potenziale maggiore tendenza all imbrunimento, presumibilmente manifesta qualora i frutti siano sottoposti a danni di diversa natura (es. produzione fresh-cut). Conclusioni L indagine su alcune accessioni di pomodoro da serbo coltivate in condizioni di spinto deficit idrico del terreno, ha evidenziato il ruolo strategico dell'indagine enzimatica nella selezione di tali produzioni per le quali il mercato manifesta un crescente interesse dovuto alla loro elevata qualità nutraceutica e prolungata shelf life. Tali caratteristiche dipendono, oltre che da un elevato contenuto di componenti chimici nutraceutici, anche dal livello di alcune attività enzimatiche (APX, CAT, SOD) ad azione elicitaria antiossidante, antagoniste dell azione della PPO responsabile del browning dei frutti. Anche i valori dell indice di consistenza dei frutti hanno trovato un ottimo riscontro nella concentrazione di due attività enzimatiche degradative, PME e PG responsabili del softening dei frutti. In particolare, il testimone Brigade ha mostrato un elevato standard qualitativo per l elevata resistenza al rammollimento e all imbrunimento. L ecotipo Filicudi sembrerebbe particolarmente adatto alla trasformazione industriale per la minore suscettibilità all imbrunimento e la maggiore tendenza alla depolimerizzazione. Bibliografia ABELES F.B., TAKEDA F., Cellulase activity and ethylene in ripening strawberry and apple fruits. Scientia Horticulturae, 42: ALLEN R.D., WEBB R.P., SCHAKE S.A., Use of transgenic plants to study antioxidant defenses. Free Radical Biology & Medicine, 23:

120 Aebi H., Catalase in vitro. Methods in Enzymology, 105: BARBAGALLO R.N., CHISARI M., SPAGNA G., Enzymatic browning and softening in vegetable crops: studies and experiences. Italian Journal of Food Science, 21: BARBAGALLO R.N., CHISARI M., BRANCA F., SPAGNA G., Pectin methylesterase, polyphenol oxidase and physicochemical properties of typical longstorage cherry tomatoes cultivated under water stress regime. Journal of the Science of Food and Agriculture, 88: CHUNG T.T., WEST G., TUCKER G.A., Effect of wounding on cell wall hydrolase activity in tomato fruit. Postharvest Biology and Technology, 40: DUMAS Y., DADOMO M., DI LUCCA G., GROLIER P., Effects of environmental factors and agricultural techniques on antioxidant content of tomatoes. Journal of the Science of Food and Agriculture, 83: GROSS K.C., A rapid and sensitive spectrophotometric method for assaying polygalacturonase using 2-cyanoacetamide. HortScience, 17: GUICHARD S., BERTIN N., LEONARDI C., GARY C., Tomato fruit quality in relation to water and carbon fluxes. Agronomie, 21: KAMPFENKEL K., VAN MONTAGU M., INZÉ D., Extraction and determination of ascorbate and dehydroascorbate from plant tissue. Analytical Biochemistry, 225: MASIA A., Superoxide dismutase and catalase activities in apple fruit during ripening and post-harvest and with special reference to ethylene. Physiologia Plantarum, 104: PATANÈ C., COSENTINO S.L., Effects of soil water deficit on yield and quality of processing tomato under a Mediterranean climate. Agricultural Water Management, 97: PERNICE R., PARISI M., GIORDANO I., PENTANGELO A., GRAZIANO G., GALLO M., FOGLIANO V., RITIENI A., Antioxidants profile of small tomato fruits: effects of irrigation and industral processes. Scientia Hort. 126: SLIMESTAD R., VERHEUL M.J., Review of flavonoids and other phenolics from fruits of different tomato (Lycopersicon esculentum Mill.) cultivars. Journal of the Science of Food and Agriculture, 89: SPAGNA G., BARBAGALLO R.N., CHISARI M., BRANCA F., Characterization of a tomato polyphenol oxidase and its role in browning and lycopene content. Journal of Agricultural and Food Chemistry, 53: USHIMARU T., MAKI Y., SANO S., KOSHIBA K., ASADA K., TSUJI H., Induction of enzymes involved in the ascorbate-dependent antioxidative system, namely, ascorbate peroxidase, monodehydroascorbate reductase and dehydroascorbate reductase, after exposure to air of rice (Oriza sativa) seedlings germinated under water. Plant Cell Physiology, 38: VRANOVÁ E., INZÉ D., VAN BREUSEGEM F., Signal transduction during oxidative stress. Journal of Experimental Botany, 53:

121 Tab.1. Contenuto di vitamina C e consistenza delle bacche. Tab. 1. Vitamin C content and fruit firmness. Cultivar Vitamina C (mg kg -1 s.f.) Vitamina C (mg kg -1 s.f.) Montallegro c c Filicudi a a Principe Borghese b b Brigade d d Significatività *** *** I valori indicano la media di 3 repliche. **, *** significativo rispettivamente per P 0.01 e Tab. 2. Attività enzimatiche degradative, PME (pectinmetilesterasi), PG (poligalatturonasi) e PPO (polifenolossidasi). Tab. 2. Enzyme activities, pectin methylesterase (PME), polygalacturonase (PG) and polyphenol oxidase (PPO). Cultivar PME (U kg -1 s.f.) PG (U kg -1 s.f.) Montallegro 54.8 c c 50.5 a Filicudi 99.4 a a 33.6 c Principe Borghese 58.9 c d 51.8 a Brigade 73.4 b b 36.3 b Significatività *** *** *** PPO (U kg -1 s.f.) substrato L-DOPA I valori indicano la media di 3 repliche. *** significativo per P

122 Tab. 3. Attività enzimatiche, APX (ascorbato perossidasi), catalasi (CAT) e superossido dismutasi (SOD). Tab. 3. Enzyme activities, ascorbate peroxidase (APX), catalase (CAT) e superoxide dismutase (SOD). APX CAT SOD Cultivar (U kg -1 s.f.) (U kg -1 s.f.) (U kg -1 s.f.) Montallegro d b c Filicudi b a b Principe Borghese c a b Brigade a a a Significatività *** *** *** I valori indicano la media di 3 repliche. *** significativo per P

123 2.15. CARATTERISTICHE SENSORIALI DEL PECORINO DI LATICAUDA A DIVERSI PERIODI DI MATURAZIONE SENSORIAL CHARACTERISTICS OF LATICAUDA CHEESE AT DIFFERENT AGING PERIODS Carmela Maria Assunta BARONE 1, Roberto DI MATTEO 1, Antonio COPPOLA 1, Antonio ZULLO 1, Filomena INGLESE 2 1 DiSSPAPA-Facoltà Agraria-Università degli Studi di Napoli Federico II Portici, Napoli, Italia 2 ConSDABI- Sub National Focal Point italiano FAO - Biodiversità mediterranea, Contrada Piano Cappelle, Benevento, Italia, Autore corrispondente: Riassunto In Campania gli ovini di razza Laticauda sono circa 3550, distribuiti in allevamenti di ridotta consistenza (mediamente 20 capi). Il latte prodotto viene destinato alla caseificazione e il relativo formaggio è commercializzato a diversi periodi di maturazione (da 3 a 15 mesi) riscontrando il gradimento di molti consumatori. Come è ben noto, le caratteristiche sensoriali di un formaggio evolvono con la maturazione; la diminuzione dell umidità e l intensificazione della proteolisi e della lipolisi, con il progredire della stagionatura, modificano complessivamente la tessitura del prodotto, migliorandone, in alcuni casi, le caratteristiche organolettiche. Nel caso di prodotti non caratterizzati da marchi di origine, le caratteristiche sensoriali mostrano un ampia variabilità legata al bioterritorio di produzione e alle fasi del diagramma di flusso non standardizzate. Al fine di contribuire alla individuazione del periodo ottimale di maturazione e alla definizione di un disciplinare di tipicità del pecorino di Laticauda, sono state valutate le caratteristiche sensoriali del prodotto a 4 periodi di stagionatura: mesi. I formaggi sono stati ottenuti dal latte di 30 pecore munte meccanicamente; sia la caseificazione che la stagionatura sono state effettuate presso la stessa azienda, la quale alleva circa 300 ovini. Una giuria di degustazione, costituita da 8 assaggiatori addestrati, ha valutato su scala strutturata le caratteristiche della pasta (colore, dimensione dell occhiatura, consistenza al tatto) e gli indicatori olfattivi (odore pungente, stagionato, acido) e gustativi (dolce, salato, amaro, acido, piccante) di 20 forme. Dalla elaborazione statistica (ANOVA) sono risultati significativi: (a) il fattore giudice per tutti i parametri considerati; (b) il periodo di maturazione per il colore della pasta (P<0.001), più scura a 12 mesi, per l'odore e la persistenza del gusto, entrambi più accentuati a 12 mesi (P<0,05-0,01). Il pecorino di 3 e 9 mesi è risultato equilibrato per i sentori di acido e di amaro, con un gusto meno persistente, rispetto al valore assegnato al formaggio di 12 mesi. Complessivamente, ovvero come accettabilità globale, il panel di valutazione non ha individuato differenze significative tra i diversi periodi, pur dando al pecorino di 12 mesi il miglior punteggio. Parole chiave: formaggio, analisi sensoriale, laticauda, stagionatura Abstract In Campania region Laticauda sheep breed are about 3550, distributed in small farms (average 20 units). The milk produced is used to make cheese that is sold at different aging periods (from 3 to 15 months) meeting consumer s satisfaction. As is well known, the sensory characteristics of cheese evolve with the maturation; the decrease of humidity and 106

124 intensification of proteolysis and lipolysis, with the progress of the aging, change the overall texture of the product, improving, in some cases, organoleptic characteristics. In the case of products not characterized by protected designation of origin (PDO) marks the sensory characteristics show a large variability due to bio-land production and to not standardized phases of the flowchart. In order to contribute to the identification of the optimal period of maturation and the definition of a specification of the typical Laticauda cheese, we evaluated the sensory characteristics of the product to months of aging. The cheeses were obtained from 30 ewes milked mechanically; both the cheese making and ripening were obtained on the same farm, which rears about 300 sheep. The sensory evaluation was carried out with a panel of 8 trained assessors that evaluated the characteristics of the dough (color, hole size, texture to the touch) and olfactory (pungent, cheese, sour) and taste (sweet, salty, bitter, sour, spicy) indicators of 20 cheese forms. Statistical analysis (ANOVA) shows significant effect for: (a) factor judge for all parameters, (b) aging period for the color of the dough (P <0.001), darker at12 months, for the persistence of odor and taste, both more pronounced at 12 months (P <0.05 to 0.01). The cheese aged 3 and 9 months was balanced by hints of sour and bitter taste with less persistent than the value assigned to the cheese of 12 months. Overall, the evaluation panel did not identify significant differences in acceptability between considered periods, while giving the cheese of 12 months the best score. Keywords: cheese, sensory evaluation, laticauda, aging Introduzione Il pecorino di razza Laticauda in Campania è commercializzato a diversi periodi di maturazione (da 3 a 15 mesi) riscontrando il gradimento di molti consumatori. È un prodotto le cui proprietà sensoriali evidenziano un ampia variabilità legata al bioterritorio di produzione e alle diverse fasi non standardizzate del processo produttivo e che evolvono con la maturazione; la diminuzione dell umidità e l intensificazione della proteolisi e della lipolisi, con il progredire della maturazione, modificano complessivamente il prodotto (Irigoyen et al., 2001), migliorandone, in alcuni casi, le caratteristiche organolettiche. Come è noto, qualsiasi prodotto, soprattutto se di nicchia, per poter essere accettato e valorizzato deve essere disciplinato in base a norme ben precise e per poterlo fare è necessaria un approfondita conoscenza delle sue caratteristiche organolettiche. L analisi sensoriale è impiegata per misurare, analizzare ed interpretare la qualità percepita di un alimento da parte del consumatore, concetto dinamico nel tempo e nello spazio. Se è vero che le proprietà reologiche possono essere valutate strumentalmente, attraverso metodi di compressione (singola o doppia), di compressione-penetrazione, di compressionerilassamento e di compressione-taglio-estrusione, il giudizio fornito dall uomo, pur essendo soggettivo, è più completo e complesso, rispetto a quello della macchina. La consistenza di un formaggio per esempio, che è un elemento di primaria importanza per il regolare svolgimento del processo di maturazione, è anche un parametro determinante nella formulazione del giudizio di qualità da parte del consumatore che esso valuta attraverso la sensazione percepita durante la masticazione. Al fine di contribuire alla individuazione del periodo ottimale di maturazione del pecorino di Laticauda e giungere alla definizione di un disciplinare di tipicità dello stesso, sono state intraprese attività di ricerca specifiche. In questo articolo sono presentati i risultati relativi alle caratteristiche sensoriali del prodotto a 4 periodi di stagionatura: mesi. 107

125 Materiali e metodi La caseificazione e la stagionatura del formaggio sono state effettuate presso un unica azienda, la quale alleva circa 300 ovini. I formaggi sono stati ottenuti dal latte di massa di 30 pecore, munte meccanicamente, unendo il latte della sera e quello della mattina successiva. Le pecore, dopo la mungitura del mattino, venivano portate al pascolo per ritornare all ovile il tardo pomeriggio per la seconda mungitura. Le caseificazioni sono state effettuate nei mesi di giugno (5 caseificazioni a distanza di 2-3 giorni) e luglio (4 caseificazioni). Alla fine del periodo di stagionatura, mesi, da ciascuna delle 20 forme in esperimento sono stati preparati i campioni per la valutazione sensoriale e strumentale (colore e compressione). La giuria di degustazione, costituita da 8 giudici addestrati, ha valutato su una scala strutturata le caratteristiche della pasta (colore, dimensione dell occhiatura, consistenza al tatto) e gli indicatori olfattivi (odore pungente, stagionato, acido) e gustativi (dolce, salato, amaro, acido, piccante) su 3 campioni per ogni forma. I dati sono stati elaborati con procedura GLM (SAS, 2002) utilizzando un modello di ANOVA in cui il giudice e il periodo di maturazione sono stati considerati fattori fissi. La significatività dei confronti tra le medie stimate è stata valutata con il t di Student. Risultati e discussione Il latte utilizzato per le caseificazioni è risultato avere mediamente l 8.29% di grasso, il 6,70 % di proteine e il 4,19% di lattosio. Tale composizione chimica evidenzia, rispetto a quanto rilevato da Matassino e Zullo (1991) sulla stessa razza, un maggior contenuto proteico (+1.3%) e una percentuale lipidica simile (-0,3%). I risultati della ANOVA hanno evidenziato la significatività del fattore giudice per tutti i parametri considerati e del periodo di maturazione per il colore della pasta (P<0,001), più scura a 12 mesi, nonché per l'odore e la persistenza del gusto, entrambi più accentuati a 12 mesi (P<0,05-0,01) (Fig. 1 e Tab. 1). Il pecorino fresco di 3 mesi e quello stagionato 9 mesi sono risultati equilibrati per i sentori di acido e di amaro e con un gusto meno persistente, rispetto al formaggio maturato 12 mesi. Complessivamente, ovvero come accettabilità globale, il panel di valutazione non ha individuato differenze significative tra i diversi periodi, pur assegnando al pecorino di 12 mesi il miglior punteggio. In una precedente sperimentazione, sempre su pecorino di Laticauda (dati non pubblicati), la valutazione strumentale dei parametri colorimetrici e reologici ha evidenziato che da 3 a 9 mesi aumenta l indice del giallo (b*) mentre diminuiscono durezza, gommosità e masticabilità; da 9 a 12 mesi aumenta significativamente (P<0,05) la masticabilità e restano invarianti i parametri colorimetrici. Alla luce dei risultati ottenuti si può concludere che non conviene prolungare la stagionatura oltre i 12 mesi in quanto le caratteristiche sensoriali non migliorano e già dopo 9 mesi il pecorino manifesta buoni caratteri organolettici. Bibliografia IRIGOYEN A., IZCO J.M., IBANEZ F.C., TORRE P., Influence of rennet milk clotting activity on the proteolitic and sensory characteristics of an ovine cheese. Food Chemistry, 72: MATASSINO D., ZULLO A., Alcuni risultati preliminari conseguiti dal primo programma di selezione della Laticauda. In: Atti Conv. Valorizzazione e miglioramento della razza ovina Laticauda. Benevento, Dicembre SAS/STAT, User s guide: Statistic. Version 9.1 Edition. SAS Inst. Inc., Ary, NC, USA. 108

126 Fig 1. Profilo sensoriale dei formaggi ai diversi periodi di stagionatura (*P < 0,05, **P < 0,01, ***P < 0,001). Fig. 2. Quantitative sensory profile of the cheeses at different aging periods (*P < 0.05, **P < 0.01, ***P < 0.001). 109

127 Tab. 1. Significatività delle differenze fra periodi di stagionatura (*=P<0,05; **=P<0,01; ***=P<0,001) Tab. 1. Significance of comparison between aging periods (*P < 0.05, **P < 0.01, ***P < 0.001). 110

128 2.16. RECUPERO E VALORIZZAZIONE DI VARIETÀ DI FRUTTIFERI E USI TRADIZIONALI NELL APPENNINO REGGIANO RECOVERY AND EXPLOTATION OF FRUIT TREE CULTIVARS AND TRADITIONAL USES IN THE REGGIO EMILIA APPENNINES Cristina BIGNAMI 1-2, Alberto BARONI 1, Cristina BARBIERI 1, Serena Anna IMAZIO 1-2, Giuseppe MONTEVECCHI 2 1 Università di Modena e Reggio Emilia - Dipartimento di Scienze della Vita, Via Amendola, 2 - Padiglione Besta, Reggio Emilia. 2 Università di Modena e Reggio Emilia - Centro Interdipartimentale BIOGEST -SITEIA, Via Amendola, 2 - Padiglione Besta, Reggio Emilia Riassunto Nelle aree collinari e montane della provincia di Reggio Emilia, la riscoperta del savurett, una tradizionale confettura ottenuta da antiche varietà locali, rappresenta un caso di valorizzazione di risorse genetiche a rischio, che può contribuire alla loro salvaguardia e al miglioramento dell economia locale. La disponibilità di materia prima e la conoscenza delle sue caratteristiche sono fattori determinanti per garantire continuità di produzione e peculiarità qualitative del prodotto. Dal 2010 è stata quindi avviata un indagine su presenza, condizioni delle piante, caratteri pomologici e qualitativi del frutto e usi tradizionali di varietà di pero e melo da savurett. Le principali varietà impiegate, secondo ricette variabili da zona a zona in dipendenza dei frutti disponibili, sono le pere Spalèr, Nobile (Baraban), ingredienti fondamentali del savurett di Carpineti, e, talora, Aval, Trentonce, Fradel; le mele Campanino, Ferro, Limone. Le indagini hanno evidenziato che per alcune varietà (Spalèr, Aval, Nobile) sono presenti piante sparse, spesso in condizioni precarie e poco favorevoli ad un agevole gestione della produzione e della raccolta. Di recente sono stati effettuati nuovi impianti di limitata estensione. Altre varietà sono rare (Trentonce, Fradel, tra le pere; Limone, tra le mele). Le varietà utilizzate sono a maturazione invernale e con caratteristiche di elevata serbevolezza. Per il pero, la consistenza e presenza di sclereidi le rende utilizzabili prevalentemente o esclusivamente per la cottura. L analisi dei frutti campionati ha rivelato notevoli differenze tra varietà, come l elevato grado zuccherino di Spalér e Nobile, l acidità molto bassa e l elevata consistenza della polpa della pera Nobile. Parole chiave: Pyrus communis L., Malus domestica Borkh, savurett, zuccheri, acidi organic Abstract In mountainous and hilly areas of Reggio Emilia province, the rediscovery of savurett, a traditional confiture obtained by old local cultivars (cvs), represents an example of exploitation of threatened genetic resources, which can contribute to their safeguard and to the enhancement of local economy. Availability and characterization of the raw material are important to ensure continuity in production and product quality. From 2010, an investigation on pear and apple cvs once used to make savurett has started. The presence and conditions of trees and the fruit traits and quality have been considered. Different cvs are used, depending on area of production and fruit availability. Main ingredients are the pears cv Spalér and Nobile (Baraban); sometimes 111

129 other pear (Aval, Trentonce, Fradel) and apple (Campanino, Ferro, Limone) are used. Surveys showed the presence of some cv (Spalèr, Aval, Nobile) as sparse plants, sometimes very old and difficult to harvest. Recently new small orchards have been established. Other cvs are more rare (Trentonce, Fradel, among pears, Limone, among apples). These are late ripening cvs with long storability. The hardness and the graininess of the pulp make these pears mainly or exclusively suitable for cooking. Fruit analysis revealed the high sugar content of Spalér and Nobile, and the low acidity and high pulp hardness of Nobile. Keywords: Pyrus communis L., Malus domestica Borkh, savurett, sugars, organic acids Introduzione Le iniziative di valorizzazione di vecchie varietà locali da frutto e dei prodotti derivati possono contribuire, se oculatamente gestite, a garantirne la sopravvivenza, con ricadute positive sulle economie locali, sulla conservazione degli agroecosistemi e sulla salvaguardia di risorse genetiche a rischio. Il territorio reggiano conserva in molte aree caratteri di tradizionalità del paesaggio rurale e usi alimentari che si basano su materie prime locali. Nelle aree montane della provincia, un caso rappresentativo è costituito dal savurett, un concentrato di frutta prodotto da secoli nelle montagne reggiane, che è da qualche anno oggetto di valorizzazione ed è stato recentemente inserito tra i prodotti agroalimentari tradizionali dell Emilia Romagna riconosciuti dal Ministero delle Politiche Agricole, Alimentari e Forestali. Le pere ne sono l ingrediente principale e tra le varietà locali di pero cui il disciplinare di produzione fa riferimento vengono citati Pèr Spalèr, Pèr Nobel o Baraban, Pèr Aval e altre varietà autoctone della Provincia di Reggio Emilia (Con, 2011). Per quanto riguarda le mele, il disciplinare fa riferimento a mele autoctone quali Campanina, Sangue di Bue, Ferro. Non viene esclusa la possibilità di utilizzare varietà cosmopolite come Passa Crassana, per il pero, e Abbondanza, per il melo, come effettuato localmente nei decenni passati. Per quanto riguarda le varietà locali, tuttavia, la conoscenza sulle caratteristiche e sulla disponibilità di frutti sono carenti. Questa base di informazioni è indispensabile per la produzione e la riproposta di prodotti tradizionali poco noti, in quanto dalla disponibilità di materia prima e dalla conoscenza delle sue caratteristiche dipende la possibilità di produrre con sufficiente continuità negli anni e una buona costanza delle peculiarità qualitative del prodotto finale. Per questo motivo, nell ambito di progetti indirizzati al reperimento, alla caratterizzazione e alla valorizzazione di varietà da frutto della provincia di Reggio Emilia è stata avviata una indagine sugli usi tradizionali, sulla presenza, distribuzione e stato di conservazione delle piante e sulle caratteristiche pomologiche e qualitative del frutto di varietà di pero e melo dell area collinare e di media montagna dove il savurett viene prodotto. In questo lavoro sono riportati i primi risultati relativi alla attività di reperimento e alle caratteristiche delle principali varietà di pero e melo impiegati per questo prodotto, oltre a quelle di alcune varietà utilizzate più raramente. Materiali e metodi Le indagini sono state condotte nel 2010 e 2011 e sono tuttora in corso. Sono stati effettuati sopralluoghi nei territori collinari e montani della provincia di Reggio Emilia e interpellati conoscitori e proprietari delle piante segnalate o individuate per acquisire notizie sulle denominazioni varietali, sulla loro storia e sull uso del frutto. È stata quindi avviata la caratterizzazione in situ e il prelievo di campioni di frutti per l analisi delle caratteristiche pomologiche e compositive. In questa nota si riportano, con diverso grado di 112

130 approfondimento, i risultati relativi alle varietà di pero Spalér, Nobile e Aval e di melo Campanino, Melo ferro, Mela francese, Rosone e Limone. Della pera Nobile sono state esaminate tre accessioni, provenienti da diverse località e prodotte in diverse condizioni colturali: Nobile F, coltivata in frutteto familiare in area collinare; Nobile LG e Nobile LV, provenienti da coltura specializzata in un area della pianura reggiana. Sono stati rilevati il grado rifrattometrico, con rifrattometro manuale TR, l acidità titolabile, espressa come percentuale di acido malico, attraverso titolazione a ph 8,1 con NaOH 0,1 N; il ph, la durezza della polpa, con penetrometro Effegi FT327. Di alcune cultivar (cv) (pere Aval, Nobile e Spalèr; mele Campanino, Francese, Ferro, Rosa, Rosone) è stato analizzato il contenuto dei principali zuccheri e acidi organici. Gli estratti etanolici diluiti sono stati filtrati con filtri a trottola (nylon, 0,45 μm) ed iniettati in un sistema HPLC collegato ad un rivelatore a serie di diodi (DAD) ed in serie ad un rivelatore ad indice di rifrazione (IR). Zuccheri ed acidi organici sono stati simultaneamente determinati utilizzando una colonna Aminex HPX-87H (300 7,8-mm i.d.) termostatata a 50 C, ed un fase mobile costituita da 93 % H 2 SO 4 (ph = 2,0) e 7 % CH 3 CN ad un flusso di 0,4 ml/min. Risultati Sopralluoghi, reperimento delle piante, usi dei frutti - L esplorazione del territorio e i contatti diretti con i proprietari delle piante e con conoscitori locali hanno consentito di raccogliere informazioni sugli usi tradizionali dei frutti. Per quanto riguarda le ricette per la preparazione del savurett, le testimonianze raccolte e la documentazione disponibile (Istituto comprensivo Carpineti, Comune di Carpineti, 2004) riportano diverse varianti in funzione della località e della disponibilità locale di frutta. In particolare, il savurett di Carpineti è ottenuto da cottura prolungata di succo di pera Spalèr, con aggiunta, nella fase finale della cottura, di fette di pera Nobile (Baraban) che, non disfacendosi nel corso della cottura, conferiscono una particolare consistenza al preparato. In alcune località vengono utilizzate anche altre varietà di pere (Aval, Trentonce) o mele (Mela rosa, Limone, Campanino). Sono state individuate piante delle varietà indicate nel disciplinare di produzione del savurett e di altre varietà locali a maturazione autunnale o invernale i cui frutti venivano utilizzati per preparazioni tradizionali della collina e montagna reggiana, come l essiccazione, la cottura al forno o con le castagne, i savor e le marmellate (Canovi et al., 2008) e, talora, per la produzione di savurett; esse possono quindi rientrare tra le varietà autoctone cui il disciplinare fa riferimento. Tra esse, Fradel, Trentonce, Durello, Pirlein, per il pero, mela Francese, Ruggine, di Sologno, Ciocarumela, per il melo. Per alcune piante non è stato ancora possibile giungere a un identificazione. I sopralluoghi effettuati hanno evidenziato per alcune varietà (Spalér, Aval, Nobile) la presenza di piante sparse, spesso centenarie, in condizioni talora precarie e comunque con dimensioni e struttura della pianta poco favorevoli ad un agevole gestione della produzione e della raccolta, che, in caso di piante di grande taglia, viene spesso effettuata sui frutti a terra, con effetti negativi sulla qualità, o ricorrendo a carrelli, con costi elevati. Solo in tempi recenti sono stati effettuati nuovi impianti specializzati di limitata estensione. Altre varietà sono rare e a rischio di scomparsa (Trentonce, tra le pere; Limone, tra le mele). Si riportano di seguito informazioni specifiche su origine, diffusione e caratteristiche delle varietà più utilizzate come ingredienti del savurett. Le varietà di pero da savurett: notizie storiche e caratteri pomologici - Aval. Varietà invernale ancora presente nel territorio collinare e montano di Reggio Emilia, con piante sparse, generalmente non più oggetto di raccolta del frutto. Le notizie storiche sono scarse, ma testimoniano una presenza antica. Filippo Re, nei racconti di viaggio nelle montagne 113

131 reggiane (1800), inserisce la Avalla acida tra le 23 pere da autunno e da inverno elencate. Casali, nel suo dizionario dei nomi dialettali delle piante presenti nel Reggiano (1915), riporta solo il nome dialettale Pèir Aval, che attribuisce esclusivamente alle zone montane, a testimonianza della prevalete diffusione in quell area. Aval ha caratteristiche primitive, per la pezzatura piccola del frutto (Tab. 1), la durezza della polpa sino a epoca molto avanzata (fine ottobre-novembre), l astringenza, l alta presenza di sclereidi, la vigoria dell albero. Si tratta di un frutto da cuocere; tradizionalmente, veniva cotto con le castagne o usato per la produzione di savurett; per questo è stata inserito tra i principali ingredienti nel disciplinare di produzione. Nobile o Baraban. Citata da Filippo Re (1800) con il nome Barabana, dal Gallesio, che la ritiene sinonimo del pero Lauro, e da Casali (1915), che distingue i nomi dialettali Peir Nobil e Peir Baraban, quest ultimo solo utilizzato nelle zone montane, la Nobile è la pera più diffusa delle vecchie cv in tutto il territorio reggiano, dove è anche coltivata in piccoli impianti specializzati. Nella tradizione reggiana, la pera Nobile era cotta al forno o in acqua con le castagne. Ingrediente fondamentale del savurett, è anche utilizzata nelle aree di pianura per la preparazione della mostarda. Ad epoca di maturazione invernale, ha pezzatura mediopiccola e forma variabile da cidoniforme a turbinata o ovoidale, variabilità che dipende anche dall origine, da fecondazione o da partenocarpia; buccia liscia, di colore verde, con sovracolore rosso o rosa all insolazione. Spalèr. Le notizie storiche sull origine di questa varietà sono estremamente scarse, ma la sua presenza antica è testimoniata da alcuni esemplari plurisecolari (Regione Emilia Romagna, 2009 a). Campioni di frutti erano presenti in una mostra campionaria a Reggio Emilia agli inizi del 900 (Consorzio agricolo e cattedra ambulante d agricoltura, 1901). Nel corso dell indagine, un buon numero di piante è stato individuato in Comune di Carpineti, nelle zone di Marola e Pantano, ma la cv è presente anche in altre aree (Castelnovo ne Monti, Casina, Viano). Il frutto ha pezzatura medio-grossa, forma sferica o ovoidale; buccia dal colore di fondo verde-giallo, con sovracolore rosso e zone rugginose (Tab. 1 e 2). Le principali varietà di melo da savurett: notizie storiche e caratteri pomologici - Campanino. Di origini non note, questa varietà contribuiva alla produzione provinciale di mele per il 55%, nel 1929, e per il 50% nel 1948 (Breviglieri, 1949), ma ha poi subito un forte declino con l affermarsi delle varietà internazionali introdotte. Oggi resta la mela locale più diffusa in tutto il territorio reggiano, dalla pianura alla montagna, con piante sparse e qualche frutteto specializzato, non avendo mai perso una sua collocazione sul mercato locale (Roversi e Valli, 1996). Da qualche anno il Campanino è oggetto di iniziative di valorizzazione basate su tradizioni gastronomiche (mostarde, dolci). È iscritta con la sigla RER VO19 al Repertorio di razze e varietà locali della Regione Emilia Romagna (LR 1/2008), dove viene indicata come varietà esposta a medio rischio di erosione genetica (Regione Emilia Romagna, 2009 b). Il frutto è piccolo, di forma appiattita o globosa, circolare in sezione trasversale, con buccia giallo-verde, con sovracolore rosso (Tab. 1 e 2). Melo Ferro. La varietà è sicuramente presente nel Reggiano almeno dagii inizi del 900: il Pòm Ferr è infatti citato da Casali nel 1915 e nel 1929 rappresentava il 20% delle mele prodotte in provincia di Reggio Emilia, quantità che diveniva poi il 4% nel 1948 (Breviglieri, 1949). Attualmente è poco diffuso nel territorio reggiano, ma ha un posto importante tra i frutti usati tradizionalmente. Veniva infatti cotta al forno o impiegata per preparare confetture, savor e savurett, o essiccata a fette ( flépi o s ciapèli ) e conservata per l inverno, per gli usi culinari e alimentari delle famiglie (Bagnoli, 2008). Entra nel disciplinare di produzione del savurett. Il frutto è medio-piccolo, appiattito, leggermente asimmetrico in sezione 114

132 longitudinale, con buccia cerosa, di colore verde, con sovracolore rosso sfumato sul 10-20% della superficie. Le mele Rosa. Nel territorio reggiano sono presenti diverse varietà che vanno sotto la generica denominazione di Rosa : Rosa romana, Rosa mantovana, Rosa gentile. Tra esse, le più frequenti erano nel secolo scorso Rosa romana e Rosa mantovana, che fornivano nel 1948 il 10% delle mele della provincia reggiana (Breviglieri, 1949). Pum ròs, Pum ròs capolegh, Pum roset e Pum rosoun sono stati inseriti da Casali tra i nomi dialettali reggiani di meli nel Il frutto è di pezzatura media, appiattito, simmetrico, in sezione trasversale circolare. La cavità calicina è ampia e mediamente profonda, con solchi. La buccia verde, che diviene gialla all avanzare della maturazione, con sovracolore rosso; Rosone è adatto alla cottura al forno, e alla preparazione di savor, savurett e mostarde. Le caratteristiche qualitative e compositive - La durezza della polpa è notevolmente più elevata in pera Nobile e Aval rispetto a Spalèr, per le pere, mentre tra le mele, i frutti di Rosona erano caratterizzati dalla polpa meno consistente (Tab. 2). L analisi delle pere campionate ha rivelato un elevato di grado rifrattometrico sia nella pera Spalèr che in tutte le accessioni di Nobile, mentre Aval era caratterizzata dai valori più bassi (Tab. 2). Tra le due varietà esaminate, sono state riscontrate differenze rilevanti di acidità titolabile, che è risultata molto più bassa nei frutti delle due accessioni di pera Nobile rispetto a Spalèr. Questa bassa acidità è probabilmente il motivo della percezione di spiccata dolcezza all assaggio di pera Nobile, che non sarebbe giustificata dai valori del grado rifrattometrico, più bassi di quelli di Spalèr, che ha sapore dolce-acidulo. L acidità, infatti, influenza la dolcezza della frutta, mascherando il sapore degli zuccheri (Lobit et al., 2006), come confermato anche da panel test su cv di melo, da cui è emerso come la percezione della dolcezza sia influenzata dall acidità soprattutto in presenza di squilibrio tra questi due componenti (Bignami et al., 2003). Nelle pere, il fruttosio è lo zucchero prevalente, seguito da glucosio e saccarosio (Tab. 3). Nella pera Spalèr il contenuto di fruttosio, zucchero ad elevato potere dolcificante, è più elevato rispetto alle altre varietà, mentre glucosio e saccarosio si attestano a valori inferiori. Nelle mele, il fruttosio è lo zucchero più abbondante, ma anche il saccarosio è presente in apprezzabili quantità. Tuttavia nella mela Rosa il tenore di saccarosio è inferiore al glucosio. Tra gli acidi organici rilevati, l acido malico è prevalente in entrambe le specie, seguito dall acido chinico per le pere (Tab. 4). Per le mele si osservano invece differenze tra le varietà per il rapporto tra acidi chinico e citrico; in particolare, i frutti di Campanino sono risultati caratterizzati da un contenuto più che doppio di acido citrico rispetto al chinico, mentre nelle altre cv i contenuti dei due acidi erano simili. Il rapporto tra i singoli acidi influisce sulla percezione della dolcezza al consumo; l acido citrico maschera la percezione di saccarosio e fruttosio, mentre l acido malico aumenta la percezione del saccarosio (Lobit et al., 2006). Conclusioni Le indagini e le interviste effettuate hanno consentito di evidenziare la presenza nel territorio reggiano di diverse varietà di pero e melo che vi erano coltivate almeno dagli inizi del XIX secolo e i cui frutti sono entrati nella tradizionale preparazione di concentrati di frutta. Molte delle denominazioni riportate nei documenti dei secoli passati consultati non risultano però più presenti, attestando le condizioni di rischio a cui le varietà più rare sono attualmente esposte. Nell ambito delle cv esaminate più approfonditamente, sono emerse caratteristiche qualitative del frutto peculiari, che possono motivare gli usi tradizionali e la particolare qualità dei prodotti. 115

133 Ringraziamenti La presente ricerca è parte del Progetto Caratterizzazione e valutazione di varietà locali da frutto del territorio reggiano finanziato dalla Fondazione Cassa di Risparmio Pietro Manodori di Reggio Emilia. Bibliografia BAGNOLI G., Frutti e vegetali nell uso alimentare occasionale e nelle merende dei fanciulli nella tradizione popolare reggiana. In: I frutti della nostra terra. Guastalla Ambiente: BIGNAMI C., SCOSSA A., VAGNONI G., Evaluation of old apple cultivars by means of sensory analysis. Acta Horticulturae, 598: BREVIGLIERI N., Elenco per provincia delle varietà di melo diffuse fino al 1929, in produzione o non in produzione nel 1948 e preferite nei nuovi impianti. In: Atti del III Congresso Nazionale di Frutticoltura; Ferrara, 9-14 ottobre Vallecchi editore, Firenze: CANOVI E., MONTECCHI A., VALENTINI G., Frutta antica nel reggiano. In: I frutti della nostra terra. Guastalla Ambiente. CASALI C., I nomi delle piante nel dialetto reggiano. In: Atti del Consorzio di Reggio Emilia, n.1. Tipografia Bondavalli, Reggio nell Emilia. CONSORZIO AGRICOLO E CATTEDRA AMBULANTE DI AGRICOLTURA, Mostra campionaria di frutti invernali. Agricoltore reggiano, n. 38(S). CON V.A., Disciplinare Savurett. GALLESIO G., I giornali di viaggi. Trascrizioni, note e commento di Enrico BALDINI, Accademia dei Georgofili, Firenze, Nuova stamperia Parenti. ISTITUTO COMPRENSIVO CARPINETI, COMUNE DI CARPINETI, Pèr Spalèr. Guida al saporetto e all aceto, alla loro degustazione e utilizzazione. 15 pp. LOBIT P., GENARD M., SOING P., HABIB R., Modelling malic acid accumulation in fruits: relationships with organic acids, potassium, and temperature. Journal of Experimental Botany, 57 (6): RE F., Viaggio agronomico per la montagna reggiana e dei mezzi di migliorare l agricoltura delle montagne reggiane; manoscritto edito a cura di Carlo CASALI, Officine grafiche reggiane, Reggio nell Emilia. REGIONE EMILIA ROMAGNA, 2009a. I patriarchi da frutto dell Emilia Romagna. Ermes Agricoltura, Bologna. I libri di Agricoltura, 4. REGIONE EMILIA ROMAGNA, 2009b. Determinazione del 31/12/2009. All. 3., L.R. N. 1/2008 Tutela del patrimonio di razze e varietà locali di interesse agrario del territorio emiliano-romagnolo. Allegato 3. Campanino RER VO19. Scheda tecnica per l iscrizione al repertorio: ROVERSI A., VALLI R., Valorizzazione di germoplasma locale di melo e pero in frutteti da reddito della provincia di Reggio Emilia. In: Atti del Congresso Nazionale sulla Biodiversità: Germoplasma locale e sua valorizzazione. Alghero:

134 Tab. 1. Caratteristiche del frutto di antiche varietà invernali di pero e melo dell Appennino reggiano (media±deviazione standard). Tab. 1. Fruit characteristics of pear and apple old winter varieties of Reggio Emilia Appennines (mean values±standard deviation). Peso (g) Altezza (cm) Diametro (cm) Altezza/Diametro PERO Aval 44,1 ±15,5 4,1 ±0,5 4,2 ±0,5 1,0 ±0,1 Nobile F 107,0 ±11,5 7,1 ±0,5 5,2 ±0,3 1,5 ±0,1 Nobile LV 122,8 ±19,6 7, 9 ±0,6 5,5 ±0,3 1,4 ±0,1 Nobile LG 134,2 ±25,1 7,9 ±0,7 6,0 ±0,3 1,4 ±0,1 Spalèr 132,3 ±47,0 6,3 ±0,9 5,9 ±0,7 1,1 ±0,1 MELO Campanino 116,1 ±21,5 5,5 ±0,5 6,1 ±0,3 0,9 ±0,0 Mela francese 64,2 ±17,3 4,4 ±0,4 5,1 ±0,5 0,9 ±0,1 Mela Limone 55,5 ±31,3 5,9 ±0,8 4,0 ±1,1 1,5 ±0,2 Rosona 165,7 ±28,2 5,4 ±0,4 7, 5 ±0,5 0,7 ±0,1 Tab. 2. Caratteristiche qualitative del frutto di antiche varietà invernali di pero e melo dell Appennino reggiano (media±deviazione standard). Tab. 2. Qualitative characteristics of pear and apple old winter varieties of Reggio Emilia Appennines (mean values±standard deviation). Sovracolore (%) Durezza (kg/cm 2 ) Brix Acidità titolabile ( ) PERO Aval 0 ±0 8,2 ±1,4 13,3 ±1,6 - - Nobile F 41 ±16 8,2 ±1,0 16,2 ±0,8 - - Nobile LV 51 ±16 7,4 ±0,5 15,5 ±1,1 0,8 ±0,1 4,50 ±0,02 Nobile LG 46 ±13 9,4 ±0,7 14,7 ±0,9 1,1 ±0,2 4,55 ±0,06 Spalèr 32 ±25 6,3 ±0,9 17,1 ±1,7 7,4 ±0,1 2,80 ±0,01 MELO Campanino 40 ±13 7,4 ±0,8 13,3 ±1,1 6,7 ±0,02 3,04 ±0,01 Mela francese 55 ±19 9,0 ±0,9 15,3 ±1,5 - - Mela Limone 0 ±0 7,0 ±0,5 14,2 ±1,3 - - Rosona 15 ±11 3,8 ±0,2 16,0 ±0,7 7,9 ±0,1 3,20 ±0,03 ph 117

135 Tab. 3. Principali zuccheri (g/100 g) e sorbitolo rilevati nei frutti di antiche varietà invernali di pero e melo dell Appennino reggiano (media±deviazione standard). Tab. 3. Main sugars (g/100 g) and sorbitol determined in pear and apple old winter varieties of Reggio Emilia Appennines (mean values±standard deviation). Fruttosio Glucosio Saccarosio Sorbitolo PERO Aval 6024,9 ±724,4 1589,1 ±155,2 580,3 ±166,5 2042,8 ±257,9 Nobile L G 6122,6 ±247,7 1664,6 ±372,8 1357,0 ±31,6 1554,0 ±300,7 Nobile LV 6690,1 ±303,6 1523,1 ±667,8 1639,6 ±377,7 1510,6 ±225,9 Nobile F 6892,2 ±541,8 1588,4 ±254,2 1089,6 ±345,1 1800,6 ±81,5 Spalèr 8306,9 ±1257,3 1104,9 ±582,8 694,9 ±468,7 1842,1 ±1020,2 MELO Campanino 4881,3 ±461,6 1552,0 ±603,1 3258,9 ±230,8 972,2 ±324,0 Mela Ferro 5510,1 ±221,6 1133,1 ±163,1 2229,0 ±225,4 530,7 ±21,6 Mela Francese 6014,8 ±556,4 1681,5 ±239,3 2661,7 ±770,1 922,5 ±523,8 Mela Rosa 5613,3 ±626,1 2258,7 ±264,3 1475,1 ±875,9 607,2 ±72,3 Mela Rosona 6000,3 ±419, ,6 ±105,5 3507,1 ±488,8 785,7 ±41,4 Tab. 4. Principali acidi organici (g/100 g) rilevati nei frutti di antiche varietà invernali di pero e melo dell Appennino reggiano (media ± deviazione standard). Tab. 4. Main organic acids (g/100 g) determined in pear and apple old winter varieties of Reggio Emilia Appennines (mean values±standard deviation). Ac citrico Ac malico Ac chinico PERO Aval 117,9 ±56,6 524,3 ±7,5 149,1 ±29,7 Nobile L G 25,1 ±2,0 171,8 ±39,9 164,4 ±12,2 Nobile LV 111,4 ±15,9 304,8 ±15,7 134,9 ±11,5 Nobile F 96,3 ±7,6 210,3 ±23,5 169,7 ±17,2 Spalèr 80,0 ±59,6 549,6 ±129,8 149,4 ±20,6 MELO Campanino 189,0 ±63,9 941,1 ±84,3 92,3 ±2,8 Mela Ferro 83,7 ±12,3 791,6 ±85,3 109,8 ±12,7 Mela Francese 91,8 ±34,7 705,9 ±64,7 207,0 ±13,5 Mela Rosa 100,0 ±13,2 718,6 ±115,9 151,8 ±21,7 Mela Rosona 138,1 ±28,4 1093,4 ±27,8 122,2 ±12,5 118

136 2.17. IL PROGETTO ESPLORA: RISULTATI PRELIMINARI IN FRAGOLA OTTOPLOIDE THE ESPLORA PROJECT: PRELIMINARY RESULTS IN OCTOPLOID STRAWBERRY Federica BRANDI 1, Gianluca BARUZZI 1, Guido CIPRIANI 2, Walther FAEDI 1 1 CRA, Unità di Ricerca per la Frutticoltura di Forlì (CRA-FRF), 2 CRA, Centro di Ricerca per la Frutticoltura, Roma Ciampino Italia (CRA-FRU) Riassunto La fragola coltivata Fragaria ananassa è una specie frutticola di grande interesse economico, nel ventennio la produzione mondiale è aumentata dell 83% fino ad oltrepassare i 3 milioni di tonnellate; dal 2000 al 2008 si è registrato un ulteriore aumento del 24%; la superficie coltivata a fragola, stimata nel 2008 in circa ettari, ha subito, come la produzione, un trend positivo ma con valori meno significativi (Faedi et al., 2010). L interesse economico giustifica pienamente i numerosi programmi di breeding, privati e pubblici, in atto in Italia su questa specie. I principali obiettivi di questa intensa attività di ricerca genetica mirano al miglioramento dell adattabilità e del comportamento agronomico delle piante e della consistenza, dolcezza e qualità organolettica dei frutti. F. ananassa, è una specie allo-octoploide (2n = 8x = 56) derivata dall ibridazione di due progenitori ottoploidi (F. chiloensis e F. virginiana). Negli ultimi anni la specie diploide F. vesca è stata oggetto di intensa ricerca scientifica che ha portato allo sviluppo, di importanti strumenti di genetica e genomica, come le mappe genetiche. Il successivo trasferimento dei risultati ottenuti a F. ananassa è stato possibile grazie all elevato grado di omologia e collinearità esistente fra il genoma della fragola coltivata e quello della specie diploide. Nell ambito del progetto ESPLORA, finanziato dal MiPAAF, il CRA-FRF ha l obiettivo di costruire una mappa di linkage della fragola ottoploide. Su una progenie di semenzali ottenuta dall incrocio Alba x un clone di F. chiloensis si sono stati impiegati circa 180 coppie di marcatori micro satelliti SSR (Simple sequence repeat) disegnati prevedendo l aggiunta della sequenza del primer universale M13 all estremità 5 del forward di tutti i microsatelliti ( tgtaaaacgacggccagt ). Sono inoltre stati utilizzati 86 ulteriori microsatelliti, distribuiti lungo tutti i Linkage Group. Gli alleli sono stati separati tramite ABI I risultati iniziali mostrano una elevata percentuale di alleli nulli, insieme all identificazione di diversi rapporti di segregazione. Parole chiave: Fragaria ananassa, microsatelliti, mapping, marcatori molecolari Abstract The cultivated strawberry (Fragaria ananassa) is the most economically important soft fruit species and, hence, numerous breeding programs earmarked for superior commercial varieties aimed at specific requirements of regional markets have been established virtually in every corner of the world where strawberries are grown as a cash crop. As part of the ESPLORA project financed by Italy s Agriculture Ministry, CRA-FRF is building a map of the cultivated octoploid F. x ananassa using a population of 66 individuals from the cross of Alba x F. chiloensis clone (characterized by white fruit). The nearly 180 primer pairs developed in the genus Fragaria (vesca, chiloensis, ananassa species) that were used in parental screens, we added a tgtaaaacgacggccagt motif to each oligonucleotide in a primer pair to reduce 119

137 PCR amplification costs ( PIGtailing ). Another 86 primer pairs distributed in all LG were also used. Each primer was fluorescently labelled with FAM, HEX and NED and genotype detection subsequently performed. Keywords: Fragaria ananassa, octoploid mapping, molecular markers, SSR Introduzione La fragola a frutto grosso (Fragaria x ananassa) è oggetto da circa due secoli di un intensa attività di miglioramento genetico finalizzata alla costituzione di nuove varietà. L elevato livello di ploidia (ottoploide) e l interazione con l ambiente, particolarmente accentuata, consentono un ampia variabilità fenotipica anche se si parte da una base genetica piuttosto ristretta. Fragaria x ananassa deriva dall ibridazione fra due specie ottoploidi americane F. chiloensis e F. virginiana e solo poche piante ottenute originariamente da questo incrocio sono i progenitori di tutte le attuali varietà coltivate (Faedi et al., 2010). Le prime attività di miglioramento genetico della fragola in Italia furono avviate nel 1960 e condotte, in Emilia Romagna, dall Istituto di Coltivazione Arboree dell Università di Bologna (ICA). Alla fine degli anni 70 l attività di ricerca dell ICA si unì a quella dell allora Istituto Sperimentale per la Frutticoltura di Forlì, oggi CRA Unità di Ricerca per la Frutticoltura (CRA-FRF) questa collaborazione diede un forte impulso all attività di breeding che mirava a raggiungere ambiziosi obiettivi sanitari, qualitativi ed estetici tuttora validi. Da alcuni anni l attività di breeding tradizionale può sfruttare gli strumenti messi a disposizione dalle tecniche di biologia molecolare. Infatti, negli ultimi dieci anni, la fragola è stata al centro di un intensa attività di studi biomolecolari tanto che, nel 2010, il genoma della fragola diploide (F. vesca) è stato completamente sequenziato (Shulaev et al., 2010) e si è arrivati a sviluppare marcatori molecolari associati con tratti fenotipici e impiegati per caratterizzare germoplasma di interesse (Ashley et al., 2003; James et al., 2003; Lewers et al., 2005; Deng, 2001). L elevato livello di colinearità fra la specie diploide e quella ottoploide fa si che molti degli strumenti sviluppati sulla prima siano impiegati sulla seconda. In uno sforzo che fa parte del progetto ESPLORA finanziato dal MIPAAF, CRA-FRF sta costruendo una mappa di linkage in F. x ananassa di cui qui si riportano i primissimi risultati. Materiali e metodi Lo studio è stato condotto su 66 semenzali ottoploidi ottenuti da un incrocio fra la varietà Alba (F. x ananassa) e un clone di F. chiloensis caratterizzato da frutti colorati di bianco a maturazione e coltivati presso l azienda sperimentale del CRA-FRF. Il DNA è stato isolato da foglie giovani impiegando DNease plant minikit (Qiagen), seguendo le istruzioni della ditta e diluito a 1-10 ng/ul per le successive amplificazioni tramite PCR (Polymerase chain reaction) con protocollo touchdown, come indicato da Sargent et al. (2003). Sono stati individuate circa 180 coppie di primer, sviluppate all interno del genere Fragaria (specie: vesca chiloensis, ananassa), ad ogni coppia di primer è stata aggiunta la sequenza universale: tgtaaaacgacggccagt utilizzando così la tecnica del PIGtailing. Con questa metodologia è stato fatto un primo screening sui parentali e 6 semenzali. Visto la complessità dei profili ottenuti con molti di questi 180 primer si è ritenuto opportuno concentrare l attività progettuale su un ulteriore pool di primer, già testati su fragola ottoploide.e risultati estremamente polimorfici Le 86 coppie di primer, marcati con i fluorofori FAM, HEX e NED, sono stati testati sui due parentali e su 14 individui della progenie per verificarne i polimorfismi, quindi l analisi è stata estesa a tutta la popolazione ad oggi disponibile. I prodotti PCR sono stati frazionati tramite elettroforesi capillare (

138 genetic analyzer Applied Biosystem), i dati così generati sono stati elaborati utilizzando il software Gene Mapper (Applied Biosystem). Risultati e discussioni L analisi, effettuata finora, utilizzando gli 86 primer maggiormente polimorfici, ha interessato il 50% dei marcatori su circa il 70% della popolazione. I risultati, finora ottenuti, evidenziano che il 68% dei genotipi amplificano prodotti PCR con i primer testati. Di questi, 23 primer amplificano da due a otto prodotti PCR, con una media di 6 per coppia di primer: questo risultato va tenuto in considerazione dato che l analisi è condotta su una specie ottoploide altamente eterozigote dalla quale ci si aspetta una diversità allelica quattro volte superiore rispetto ad una diploide. Inoltre, alcune coppie di primer sono derivate da geni espressi, molti dei quali sono noti per esistere in cluster anche in genomi diploidi e di conseguenza è plausibile aspettarsi un più alto numero di prodotti di PCR rispetto a quelli teorici per un individuo ottoploide. Lo studio dei picchi allelici ha consentito l identificazione di diversi rapporti di segregazione: bb x ab, aa x ab, aa x bb, ab x aa, ab x ab, ab x an, ab x bb, ab x bn, ab x nn, an x ab, an x an, ab x bb, an x bn, and an x nn, dove ad ogni lettera corrisponde una lunghezza allelica e dove con la lettera n è indicato un allele nullo. L elevata percentuale di alleli nulli (circa il 64%) è dovuto all'impiego di SSR sviluppati in specie diverse F. chiloensis e F. x ananassa. Nel complesso, il profilo allelico del clone di F. chiloensisis a frutto bianco è sempre stato più semplice di quello di F. x ananassa (Fig.1). Conclusioni La costruzione di mappe genetiche in specie poliploidi incontra difficoltà pratiche legate essenzialmente all origine genetica della specie ed alla ridondanza dei genomi che determinano la ploidia stessa. Nell immediato l attività prevede l analisi della separazione allelica e solo gli alleli monodose verranno impiegati per la costruzione della mappa di linkage. I possibili legami in coupling o repulsion verranno presi in esame in una fase successiva, seguendo l approccio suggerito per il raggiungimento del medesimo obiettivo nella canna da zucchero (Da Silva et al., 1995;. Grivet et al., 1996; Aitken et al., 2005) e applicato anche per fragola ottoploide da Lerceteau et al. (2003) e Rousseau-Gueutin et al. (2008). Bibliografia AITKEN K. S., JACKSON P. A., MCINTYRE C. L., A combination of AFLP and SSR markers provides extensive map coverage and identification of homo(eo)logous linkage groups in a sugarcane cultivar. Theoretical and Applied Genetics, 110: ASHLEY MV., WILK JA., STYAN SMN., CRAFT KJ., JONES KL., FELDHEIM KA., LEWERS KS., ASHMAN TL., High variability and disomic segregation of microsatellites in octoploid Fragaria virginiana Mill (Rosaceae). Theoretical and Applied Genetics, 107: DA SILVA J., HONEYCUTT R. J., BURNQUIST W., AL-JANABI S.M., SORRELLS M. E., Saccharum spontaneum L Ses 208 genetic linkage map combining RFLP-based and PCR-based markers. Molecular Breeding, 1: DAVIS T. M., YU H., A linkage map of the diploid strawberry, Fragaria vesca. Journal of Heredity, 88:

139 DENG C., DAVIS TM., Molecular identification of the yellow fruit color (c) locus in diploid strawberry: a candidate gene approach. Theoretical and Applied Genetics, 103: FAEDI W., Mondo e mercato. In: La fragola. Bayer CropScience. GRIVET L., DHONT A., ROQUES D., FELDMANN P., LANAUD C., RFLP mapping in cultivated sugarcane (Saccharum spp.): Genome organization in a highly polyploid and aneuploid interspecific hybrid. Genetics, 142: JAMES CM., WILSON F., HADONOU AM., TOBUTT KR., Isolation and characterisation of polymorphic microsatellites in diploid strawberry (F. vesca L.) for mapping, diversity studies and clone identification. Molecular Ecology Notes, 3: 171. LERCETEAU-KOHLER E., GUERIN G., LAIGRET F., DENOYES-ROTHAN B., Characterization of mixed disomic and polysomic inheritance in the octoploid strawberry (Fragaria ananassa) using AFLP mapping. Theoretical and Applied Genetics, 107: LEWERS KS., STYAN SMN., HOKANSON SC., BASSIL NV., Strawberry GenBank-derived and genomic simple sequence repeat (SSR) markers and their utility with strawberry, blackberry, and red and black raspberry. Journal of the American Society for Horticultural Science, 130: ROUSSEAU-GUEUTIN M., LERCETEAU-KOHLER E., BARROT L., SARGENT D.J., MONFORT A., SIMPSON D., ARUS P., GUERIN G., DENOYES-ROTHAN B., Comparative genetic mapping between octoploid and diploid Fragaria species reveals a high level of colinearity between their genomes and the essentially disomic behavior of the cultivated octoploid strawberry. Genetics, 179: SARGENT DJ., HADONOU AM., SIMPSON D. W., Development and characterization of polymorphic microsatellite markers from Fragaria viridis. Molecular Ecology Notes, 3: SHULAEV V. et al., The genome of woodland strawberry (Fragaria vesca). Nature Genetics, 43:

140 Fig. 1. Profilo allelico dei due parentali clone di F. chiloensis (sopra) e varietà di F. x ananassa (sotto) Fig. 1. Allelic profile of F. chiloensis (top) and F. x ananassa (bottom). 123

141 2.18. TRATTAMENTO DELLA PASTA DI OLIVE CON UN METODO AD ULTRASUONI E INFLUENZA SULLA QUALITÀ DELL OLIO EXTRAVERGINE DI OLIVA OTTENUTO DA DUE DIFFERENTI CULTIVAR PUGLIESI (CORATINA E PARANZANA) HIGH-POWER ULTRASOUND IN OLIVE PASTE PRETREATMENT. EFFECT ON VIRGIN OLIVE OIL CHARACTERISTICS OF TWO APULIAN VARIETIES (CORATINA AND PARANZANA) Maria Lisa CLODOVEO 1, Domenico LA NOTTE 2, Viviana DURANTE 1, Giuseppe GAMBACORTA 3 1 DISAAT- Dipartimento di Scienze Agro-Ambientali e Territoriali Università degli Studi di Bari, Via Amendola 165/A, Bari. 2 Bioagromed: Istituto per la ricerca e le applicazioni biotecnologiche per la sicurezza e la valorizzazione dei prodotti tipici e di qualità Università di Foggia, via Napoli 25, Foggia, Italia. 3 Dipartimento di Biologia e Chimica Agro Forestale ed Ambientale Università, di Bari Aldo Moro, via Amendola 165/A, Bari, Italia Riassunto Il mercato delle macchine ed impianti per l estrazione dell olio vergine dalle olive richiede innovazioni che consentano di incrementare le rese e nel contempo di preservare la qualità dell olio presente nel frutto. Nel processo di estrazione dell'olio di oliva è noto che per estrarre un surplus di olio è necessario prolungare i tempi di gramolazione o, in alternativa, incrementare le temperature di processo. Tuttavia tale scelta tecnologica può compromettere la qualità del prodotto soprattutto se lo spazio di testa della gramola non è saturato con gas inerte: possono infatti innescarsi processi di ossidazione a carico degli acidi grassi insaturi con conseguente diminuzione nel contenuto di sostanze polifenoliche e riduzione delle caratteristiche organolettiche e salutistiche del prodotto. La gramola da un punto di vista impiantistico non è uno scambiatore termico efficiente a causa della limitata superficie di scambio tra fluido riscaldante e pasta di olive. Lo scopo di questo lavoro è mostrare i risultati ottenuti impiegando gli ultrasuoni in fase di gramolazione evidenziando gli effetti sulle caratteristiche dell'olio e sulle rese di estrazione. Gli ultrasuoni sono onde meccaniche sonore. L applicazione degli ultrasuoni alla pasta di olive determina effetti termici, meccanici, biologici, biochimici e di cavitazione. Le onde penetrando nei tessuti vegetali, cedono parte della loro energia sotto forma di calore (effetto termico). La forza esercitata dalle onde sonore sulle cellule vegetali determina fenomeni di vibrazione delle strutture cellulari che causano variazioni di pressione all interno dei compartimenti. Le variazioni di pressione prodotte alterano la permeabilità della membrana cellulare liberando così i lipidi contenuti all interno della cellula (effetto biologico e biochimico). Infine il passaggio di ultrasuoni attraverso i tessuti vegetali determina ciclicamente la formazione di onde depressorie e pressorie ad altissima velocità. Durante la prima fase di depressione si ha lo sviluppo di microbolle all interno della cellula, mentre durante la fase di compressione si ha l implosione delle microbolle. Questo fenomeno fisico è chiamato cavitazione e determina la rottura dei tessuti vegetali (effetto meccanico). Questo evento causa la rottura della membrana cellulare: il grasso contenuto nella cellula si libera dalle forze interne presenti nell oliva. L applicazione degli ultrasuoni sulla pasta di olive, impiegando drupe sia della cv. Coratina che della cv. Paranzana, ha dimostrato un effetto positivo sulla fase di gramolazione. I tempi di riscaldamento della pasta si riducono e possono essere estratti quantitativi maggiori di sostanze nutrizionali e funzionali, quali clorofille, carotenoidi e tocoferoli. 124

142 Parole chiave: olio vergine di oliva, gramolazione, ultrasuoni, qualità Abstract A large increase in the demand for high-quality virgin olive oil continuously stimulating the search for new technologies. In olive oil extraction process, is known that to extract greater oil amount longer kneading time at optimal temperature is needed or, alternatively, higher process temperature. However, both high temperature and longtime of malaxation goes in damage of oil quality, oxidation processes are enhanced and losses in sensory characteristics take place. The malaxer is a heat exchanger characterized by a low overall heat transfer coefficient. At industry scale, extra malaxation time is required to reach the optimal paste temperature, usually around minutes for 30 C. The aim of this work is to show the results obtained from experiments carried out, at laboratory scale, applying high-power ultrasounds during the malaxation step and its effect on oil characteristics. High-power ultrasound application on olive paste has shown a positive effect on length of malaxation step. It provides a quick-heating of olive paste without alteration of olive oil composition. Two main mechanisms are involved in the ultrasonic treatment on olives and on olive paste: a thermal effect and a mechanical effect. The thermal effect was due to the attenuation characteristics of the medium. The mechanical effect is due to cavitation or particulate streaming which cause violent movement of the particles of the medium. Sound waves, which have frequencies higher than 20 khz, are mechanical vibrations in a solid, liquid and gas. Unlike electromagnetic waves, sound waves must travel in a matter and they involve expansion and compression cycles during travel in the medium. Expansion pulls molecules apart and compression pushes them together. The expansion can create bubbles in a liquid and produce negative pressure. The bubbles form, grow and finally collapse. Close to a solid boundary, cavity collapse is asymmetric and produces high-speed jets of liquid that have strong impact on the solid surface and can disrupt biological cell walls. The mechanical effect of ultrasounds promotes the release of soluble compounds from the plant body by disrupting cell walls and improves mass transfer also in the olive tissues. The ultrasound technology provides a reduction of malaxing time improving extractability of oil and its antioxidant content both of Coratina and Paranzana variety. Keywords: virgin olive oil, malaxing, ultrasound, quality Introduzione Il settore dell olio di oliva è una realtà molto importante nel comparto agroalimentare italiano. I tre quarti della produzione nazionale si concentra nelle regioni meridionali quali Puglia, Calabria, Sicilia e Campania. La produzione nazionale è in genere di qualità medio-alta e la sua risonanza in termini di immagine a livello internazionale è molto forte. Tuttavia negli ultimi anni il prezzo dell olio d oliva è notevolmente diminuito: analizzando gli andamenti produttivi degli ultimi 5 anni si rileva un incremento medio della produzione mondiale del 18% per anno. Tale incremento è stato determinato dalla razionalizzazione produttiva nei tradizionali paesi della UE (Spagna, Italia, Grecia), dall intensificarsi delle esportazioni di paesi terzi (Tunisia, Turchia) e dall emersione di nuovi paesi produttori (Argentina, Australia e Sud). Questo fenomeno ha generato un surplus produttivo. Tale surplus ha condizionato i mercati continuamente al ribasso al di là di ogni considerazione sul valore intrinseco del prodotto e della qualità. Per uscire dalla crisi l olivicoltura italiana deve orientarsi verso produzioni di alta gamma che soddisfino le aspettative del consumatore offrendo un prodotto 125

143 di qualità che si distingua per le caratteristiche organolettiche e salutistiche. In quest ottica nasce l'idea di individuare nuove strategie tecnologiche mirate ad incrementare la quantità e la qualità degli oli vergini. Gli ultrasuoni sono già stati applicati con successo su altre matrici alimentari. Il loro impiego si è dimostrato efficace nella disintegrazione delle cellule, nei processi di estrazione di biomolecole, nell attivazione o accelerazione di reazioni enzimatiche, nelle operazioni di miscelazione, omogeneizzazione, dispersione di polveri in liquidi. Gli ultrasuoni favoriscono inoltre il degassamento di soluzioni, la disattivazione di enzimi e l inattivazione microbica. Il mercato delle macchine ed impianti per l industria alimentare è un settore dinamico ed investe energia nello sviluppo di innovazioni impiantistiche in grado di semplificare i processi di trasformazione [1]. La sfida attuale riguarda la fase di gramolazione. Questa fase consiste in un lento rimescolamento della pasta di olive a temperature controllate per tempi che oscillano dai 45 ai 60 minuti a seconda delle caratteristiche della materia prima. Lo scopo della gramolazione è quello di favorire la coalescenza delle minuscole goccioline di olio, liberate dai tessuti vegetali durante la frangitura, in gocce di dimensioni superiori più facilmente separabili durante la successiva fase di centrifugazione [2; 3; 4]. Questa operazione avviene in batch ed è l unico punto di discontinuità all interno di un processo continuo. Per incrementare la capacità lavorativa dell impianto, e per consentire alle macchine poste a monte ed a valle della gramola di lavorare in modo continuo, si collocano diverse gramole in parallelo con un aggravio di un investimento impiantistico che si ripercuote sui costi di produzione [5]. Per determinare se il trattamento di sonicazione può ridurre il tempo di gramolazione e migliorare la qualità complessiva del VOO risultante, sono state eseguite prove sperimentali applicando il trattamento di sonicazione [6] alla pasta di olive prima della gramolazione. I risultati di questa ricerca possono portare a significativi progressi tecnologici nella produzione di olio vergine di oliva. Materiali e metodi Materiale vegetale - Olive delle varietà Coratina e Paranzana sono state raccolte in un uliveto nei pressi di Bari (Puglia-Italia) nella stagione 2011/2012. Le drupe sono state raccolte in modo casuale e in fase di maturazione ottimale. La raccolta è stata fatta a mano, utilizzando rastrelli. Le olive sono state messe in contenitori fenestrati da 30 kg e subito trasportate all impianto pilota [7]. La figura 1 mostra il diagramma di flusso del piano sperimentale. Apparato ad ultrasuoni - Elmasonic S60H: Frequenza - 35 khz; volume - 4,25 l; dimensioni - 240x137x150 mm potenza W. Analisi chimiche - La determinazione dell acidità, dei perossidi e dei coefficienti di assorbimento specifico nell UV (K 270 e K 232 ) sono state effettuate secondo i metodi analitici descritti nel regolamento EEC/2568/91 e successive modifiche ed integrazioni [8; 9]. I contenuti di carotenoidi e di clorofilla sono stati determinati colorimetricamente secondo il metodo di Minguez et al. (1991) [10]. Il contenuto di fenoli totali è stato valutato seguendo la procedura riportata da Montedoro et al. [11]. Il contenuto fenolico totale è stato espresso come mg di equivalenti di acido gallico per kg di olio. I tocoferoli sono stati determinati mediante HPLC secondo il metodo riportato da Psomiadou e altri (2000) [12].,Gli esperimenti sono stati eseguiti in triplicato e i risultati sono stati espressi come media ± SD (deviazione standard). L'analisi statistica è stata effettuata utilizzando il software Microsoft Excel. Differenze significative tra i trattamenti sono stati determinati usando l ANOVA ad una via seguita da'' t-test''. 126

144 Risultati e discussione La Figura 2 mostra i profili di temperatura della pasta di olive (Paranzana) sottoposta prima a trattamento di sonicazione per diversi intervalli di tempo e successivamente gramolata. I tempi di gramolazione sono stati standardizzati in tutte le prove misurando esattamente 30 minuti a patire dal momento in cui la pasta ha raggiunto i 30 C. Dall analisi dei risultati si evince che la temperatura della pasta di olive aumenta all aumentare del tempo di sonicazione. Nel campione non trattato (A) la temperatura della pasta di olive misurata dopo frantumazione era di circa 21 C (±0,5). La temperatura della pasta di olive dopo il trattamento di sonicazione era di circa 23 C (± 0,5), 25,5 C (± 0,5 ), 27 C (± 0,5), 29 C (± 0,5) e 30 C (± 0,5) utilizzando 2 (B), 4 (C), 6 (D), 8 (E) e 10 (F) minuti di sonicazione, rispettivamente. I profili di temperatura ottenuti con la cultivar Coratina hanno un andamento simile. Tutti i campioni estratti erano classificabili come oli extra vergine di oliva. Nessuna differenza significativa era attribuibile al trattamento ad ultrasuoni. In generale, carotenoidi, clorofille e tocoferoli aumentano all aumentare del tempo di sonicazione (Fig. 3a, 3b e 3d). La cultivar Coratina mostrava un contenuto in clorofille superiore alla Paranzana in quanto le olive avevano un grado di invaiatura inferiore; al contrario il contenuto in carotenoidi risultava superiore nella cultivar Paranzana. I polifenoli, invece, diminuivano all aumentare del tempo di sonicazione in entrambe le varietà considerate. Questo effetto era probabilmente dovuto all'azione dell'ossigeno, infatti tale gas agisce sia come cofattore in molte reazioni enzimatiche, sia come promotore di ossidazioni non enzimatiche, e la sua attività ossidativa aumenta all aumentare della temperatura. Conclusioni L applicazione degli ultrasuoni può migliorare il processo di gramolazione in quanto comporta il riscaldamento della pasta di olive, effetto utile a contrarre i tempi morti della gramolazione. Infatti circa il 30% del tempo totale di gramolazione è impiegato per portare la pasta di olive dalla temperatura ambiente di C alla temperatura di processo di C. L incremento della temperatura si traduce in una riduzione della viscosità della pasta di olive. Sul piano impiantistico la viscosità della pasta rappresenta un termine chiave dell efficienza del processo di separazione centrifuga della fase oleosa. Infatti, dopo la gramolazione, l olio viene separato dalla sansa e dalle acque di vegetazione per mezzo del decanter. Il processo di separazione si basa sulla legge di Stokes dalla quale si evince che la velocità di sedimentazione di una particella sottoposta ad una forza centrifuga è inversamente proporzionale alla viscosità del fluido. Pertanto al diminuire del valore di viscosità aumenta la velocità di sedimentazione e quindi l efficienza del processo di estrazione centrifuga dell olio dalle paste di oliva. Attraverso l applicazione di questa tecnologia innovativa si può ottenere una riduzione dei tempi di gramolazione e di conseguenza dei costi di investimento. Inoltre, l applicazione degli ultrasuoni sulla pasta di olive, impiegando olive sia della cv. Coratina che della cv. Paranzana, ha dimostrato un effetto positivo sulla qualità degli oli estratti: l azione meccanica degli ultrasuoni determina quantitativi maggiori di sostanze nutrizionali e funzionali, quali clorofille, carotenoidi e tocoferoli rispetto al metodo tradizionale. Bibliografia [1] AMIRANTE P., CLODOVEO M.L., DUGO G., LEONE A., TAMBORRINO A., Advance technology in virgin olive oil production from traditional and de-stoned pastes: influence of the introduction of a heat exchanger on oil quality. Food Chemistry, 98:

145 [2] AMIRANTE R., CATALANO P., Fluid dynamic analysis of the solid-liquid separation process by centrifugation. Journal of Agricultural Engineering Research, 77 (2): [3] AMIRANTE R., CINI E., MONTEL G.L., PASQUALONE A., Influence of mixing and extraction parameters on virgin olive oil quality. Grasas Aceites, 52: [4] AMIRANTE P., CLODOVEO M.L., LEONE A., TAMBORRINO A., Influence of different centrifugal extraction systems on antioxidant content and stability of virgin olive oil. In: PREEDY V. R. and WATSON R. R. (a cura di). Olives and olive oil in health and disease prevention. Oxford: Academic Press: [5] CLODOVEO M.L., Malaxation: Influence on virgin olive oil quality. Past, present and future - An overview. Trends in Food Science & Technology, 25(1): [6] FENG H., BARBOSA-CANOVAS G., WEISS J. (a cura di) Ultrasound Technologies for Food and Bioprocessing, Springer, Food Engineering Series. [7] CLODOVEO M.L., DELCURATOLO D., GOMES T., COLELLI G., Effect of different temperatures and storage atmospheres on Coratina olive oil quality, Food Chemistry, 102(3): [8] EU REGULATION Off J Eur Com, L248: [9] EU REGULATION Off J Eur Com, L295: [10] AMIRANTE P., CLODOVEO M.L., TAMBORRINO A., LEONE A., Influence of the crushing system: phenol content in virgin olive oil produced from whole and destoned pastes. In: PREEDY V. R. and WATSON R. R. (a cura di). Olives and olive oil in health and disease prevention. Oxford: Academic Press, 2010: [11] O'BRIEN W.D. jr, Ultrasound-biophysics mechanisms. Progress in Biophysics and Molecular Biology, 93(1-3):

146 Fig. 1. Diagramma di flusso della prova sperimentale. Fig. 2. Profilo delle temperature della pasta di olive ottenuta impiegando la tecnologia tradizionale (A) e un trattamento ad ultrasuoni prima della gramolazione per tempi crescenti (B, C, D, E, F). 129

147 a b c d Fig. 3. Variazioni nel contenuto in Carotenoidi totali (mg/kg) (a), Clorofille (mg/kg) (b), Fenoli totali (mg/kg) (c) and Tocoferoli (mg/kg) (d) negli oli vergini di oliva ottenuti impiegando la tecnologia tradizionale (A) e un trattamento ad ultrasuoni prima della gramolazione per tempi crescenti (B, C, D, E, F). 130

148 2.19. VALORIZZARE I PRODOTTI DELLA BIODIVERSITÀ: IL PACKAGING NELL ORIENTAMENTO DI ACQUISTO VALORIZE THE PRODUCTS OF BIODIVERSITY: THE PACKAGING IN PURCHASE WILLINGNESS Carlo COSENTINO 1*, Rosanna PAOLINO 1, Severino ROMANO 2, Anna Chiara BLASI 1, Pierangelo FRESCHI 1 1 Dipartimento di Scienze delle Produzioni Animali - Università Degli Studi Della Basilicata - Viale dell Ateneo lucano, Potenza 2 Dipartimento Tecnico-Economico Gestione Territorio - Università Degli Studi Della Basilicata - Viale dell Ateneo lucano, Potenza * Autore corrispondente: Riassunto Il presente lavoro ha valutato in una crema viso prodotta con latte di asina l influenza del packaging sulle scelte del consumatore. La ricerca è stata condotta su un focus group di 300 persone (48% uomini e 52% donne) a cui è stata somministrata una scheda valutativa composta da 10 domande suddivise in quattro aree in cui erano valutati i seguenti aspetti: profilo del consumatore e abitudini di consumo; percezione del prodotto; percezione della carta di confezionamento; percezione degli elementi comunicativi. Il panel ha valutato separatamente prima tre packaging differenti per tipo di carta da confezione (opaca, lucida, lucida con trama in rilievo) e, successivamente, tre packaging differenti per l informazione: A) solo naming Asinella; B) naming Asinella più dicitura prodotto naturale; C) naming Asinella più dicitura prodotto naturale più Made in Basilicata. Per il prodotto confezionato in carta opaca si è evidenziata una propensione all acquisto (4,1) significativamente più elevata (P<0,05) rispetto agli altri due imballaggi (2,56 e 2,94, rispettivamente per la carta lucida e lucida con trama in rilievo). Inoltre, il packaging B ha invogliato maggiormente all acquisto (4,09; P<0,05) e ha fatto percepire il prodotto come più affidabile (3,89; P<0,05). Parole chiave: latte di asina, packaging, naming, cosmetici Abstract The present study evaluated the role of packaging on customer preferences on a face cream produced with jennet milk. The research was conducted by survey on a panel of 300 persons (48% men and 52% women). Panel evaluated the effect of two aspects of packaging design on purchase willingness: type of paper (matte, glossy, and glossy with relief texture); type of product communication (A only naming Asinella, B Asinella and wording natural product, C Asinella and wording natural product and Made in Basilicata). Panel showed the highest purchase willingness (4.1, P<0.05) toward product packaged with matte paper (2.56 and 2.94 in glossy and in glossy with relief texture, respectively). Furthermore, type B was elected as the most compelling information that determines more buy willingness (4.09; P<0,05) and that inspires greater reliability of product (3.89; P<0,05). Keywords: jenny milk, packaging, naming, cosmetics 131

149 Introduzione Il presente lavoro è stato sviluppato nell ambito di una più ampia ricerca finalizzata alla salvaguardardia della specie asinina attraverso la valorizzazione del latte come alimento e come materia prima nella produzione di cosmetici (Cosentino et al., 2011, 2012a). I cosmetici derivati dal latte d asina prevengono l invecchiamento contrastano la disidratazione e la perdita di elasticità della cute soprattutto nelle parti più esposte del corpo (Orsingher, 2011). Altre proprietà del latte d asina sono ascrivibili al suo elevato contenuto in lisozima, che attenua gli stati flogistici della cute, e all azione antiossidante degli acidi grassi in esso contenuti, capaci di ripristinare e proteggere le membrane delle cellule cutanee (Polidori et al., 2007, 2008a; Tesse et al., 2009; Paolino et al., 2011; Simos et al., 2011; Cosentino et al., 2012b). D altro canto, anche l industria cosmetica, così come accaduto per quella alimentare, negli ultimi anni sta subendo un evidente modifica strutturale suggerita da una quota crescente di consumatori che sceglie prodotti realizzati con processi/sostanze naturali (Power, 2010; Khraim, 2011). La domanda di cosmetici naturali si concentra prevalentemente nel Nord-America ed in Europa. I consumatori, di questo segmento definiti Lohas (Lifestyle of Health and Sustainability), hanno un livello di istruzione medio-alto, forte propensione all acquisto e preferenza per prodotti naturali e di basso impatto ambientale. Per questi consumatori risulta fondamentale il packaging che, espressione del concetto di marchio e delle caratteristiche del prodotto, ha un impatto diretto sugli acquisti. La funzione del packaging è di esaltare le qualità, trasmettere l informazione del prodotto, facilitare l uso, il trasporto, promuovere l acquisto, aumentarne il valore aggiunto (Taskin et al., 2011; Qing et al., 2012). La commercializzazione di prodotti cosmetici a base di latte di asina, congiuntamente ad un valido packaging e ad azioni di marketing in grado di esaltare la qualità anche in funzione del suo contesto produttivo, potrebbe contribuire a valorizzare questa specie e a salvaguardare la conservazione dei diversi tipi genetici asinini. Il presente lavoro ha valutato, in una crema viso prodotta con latte di asina, l influenza del packaging sulle scelte del consumatore. Materiali e metodi Panel - Il panel è stato selezionato inviando un questionario a 3400 persone che dovevano indicare il numero di confezioni acquistate in un anno dei seguenti cosmetici: crema viso, crema corpo, crema mani, crema idratante per labbra, crema doposole o crema solare. Gli intervistati che hanno acquistato, di tutti i prodotti sopra riportati, almeno 2 confezioni in un anno sono stati selezionati come focus group. Nello specifico, nel panel, il numero medio di acquisti per prodotto/anno è risultato: crema viso 3,21; crema corpo 2,9, crema mani 3,29, crema idratante labbra 2,76, crema solare 2,83. Sono state così selezionate 300 persone. Il panel costituto per il 48% da uomini e per il 52% da donne, aveva un età media di 33 anni (± 11,14 d.s.). Naming - La funzione comunicativa del packaging è sostenuta dagli elementi iconici e testuali rappresentati dal logotipo e dal naming di prodotto. Il logotipo è stato sviluppato partendo dagli elementi più rappresentativi del prodotto, esprimendo la delicatezza associata al latte d asina con uno specifico schema cromatico basato su un morbido tono di marrone, e rafforzando il concetto di naturalezza preferendo a un iconografia concettuale e astratta (che dà l idea di artificiale ), la rappresentazione diretta della fonte del prodotto: l asino. Il naming Asinella, sebbene individuato come miglior scelta anche dagli allevatori, è stato tuttavia sottoposto a un test su 50 soggetti rappresentanti il consumatore-tipo. Il panel ha individuato il naming esprimendo la preferenza fra una terna di nomi commerciali reputati idonei (Asinus, Asinella, Donkey). 132

150 Test - Il questionario somministrato è stato sudiviso nelle seguenti aree di analisi: I) profilo del consumatore e abitudini di consumo; II) percezione del prodotto; III) percezione della carta di confezionamento; IV) percezione del packaging. Le domande delle aree I e II hanno consentito di individuare il profilo del consumatore e i suoi orientamenti rispetto alla provenienza geografica e ad altre informazioni riportate nel packaging del prodotto. Nell area III abbiamo esaminato l effetto di tre tipologie di packaging (carta da imballaggio) sulle scelte del consumatore e sulla percezione di naturale del prodotto. Le domande dell area IV hanno permesso di verificare tutti gli aspetti comunicativi delle tre proposte oggetto del test: A) solo naming Asinella; B) naming Asinella più dicitura prodotto naturale; C) naming Asinella più dicitura prodotto naturale più Made in Basilicata. Il questionario è stato pre-validato attraverso un pilot test su un panel di 15 persone. I risultati relativi alle risposte multiple delle prime due aree del formulario, percezione e orientamento all acquisto di un prodotto, che hanno un carattere esclusivamente descrittivo sono riportati in forma di semplice incidenza percentuale. Le domande a risposta multipla in cui si articolano le aree II, III e IV sono riportate come didascalia nei grafici 1-3. Analisi statistica - I dati relativi alle aree percezione della carta di imballaggio e percezione del packaging sono stati sottoposti al test di Turkey (α = 0,05). Risultati Percezione del prodotto - Si è evidenziata una propensione all acquisto per i cosmetici italiani a base di sostanze naturali, con una chiara informazione sulla etichetta. In particolare, il panel ha espresso un elevato grado di preferenza per i cosmetici naturali rispetto a quelli ordinari (64 %, grafico 1-A) e per i cosmetici italiani rispetto a quelli internazionali (55%, grafico 1-B). Inoltre, il panel ha considerato importante la chiarezza dell informazione riportata sull etichetta (91%, grafico 1-C) e il tipo di confezione (43%, grafico 1-D). Percezione della carta da imballaggio - La carta opaca è risultata significativamente la più gradita (P<0,05) in quanto, secondo il panel, evoca la percezione di naturale più efficacemente della carta lucida (simile ai competitor) e della carta lucida e con trama in rilievo (grafico 2). Conseguentemente, la propensione all acquisto per la confezione in carta opaca (4,1) è risultata significativamente più elevata (P<0.05) rispetto a quella per gli altri due imballaggi (2.56 carta lucida e 2.94 carta lucida con trama in rilievo, grafico 2). Percezione del packaging - In questa sezione il panel ha giudicato il messaggio della tipologia B più convincente sull acquisto (4,09, P<0,05) e sull affidabilità del prodotto (3,89, P<0,05) (grafico 3). Conclusioni La tipicità di un prodotto si riferisce a caratteristiche qualitative che traggono origine dal legame che esso ha con il territorio; tale legame diventa elemento determinante per la sua differenziazione da altri prodotti, con la possibilità di conferire allo stesso una posizione di vantaggio competitivo sul mercato. È anche vero però, che un eccessiva presenza di prodotti tipici provenienti da una stessa area o regione, si può tradurre per il consumatore in un messaggio non chiaro circa il legame tra prodotto e territorio. Diventa quindi necessario governare il sistema delle produzioni tipiche in modo tale che tipologia di prodotto e regione di origine siano tra loro coerenti (Polidori et al., 2008b). In questo ambito risulta evidente come un appropriata comunicazione collettiva su una determinata regione come luogo della 133

151 tipicità potrebbe costituire un importante base per il processo di costruzione/ricostruzione dell immagine dei singoli territori e della promessa di qualità che essi portano (Rocchi et al., 2006). Dal lavoro svolto emerge che anche per i prodotti onocosmetici naturali le scelte del consumatore sono significativamente influenzate dal packaging che, nello specifico, era orientato a esaltare il concetto di un prodotto naturale realizzato con processi a basso impatto in una regione, la Basilicata, in cui le attività agricole e zootecniche estensive rappresentano ancora un importante uso della risorsa terra. Tuttavia, nel presente lavoro il naming Made in Basilicata non ha influenzato in maniera significativa l accettabilità del campione sottoposto all indagine. Tale fatto probabilmente è attribuibile alla scarsa notorietà della regione e del proprio territorio presso i consumatori. Probabilmente il brand Made in Basilicata non è ancora percepito come rappresentativo di un territorio incontaminato, naturale e direttamente collegabile alla salubrità e naturalezza di un prodotto, come quello oggetto di studio, che su tali qualità fonda la propria posizione di vantaggio competitivo. Si pone, quindi, alle istituzioni un problema di governance per una efficiente utilizzazione delle differenti forme di certificazione e comunicazione. Pertanto, ulteriori prove dovranno valutare come apportare un plusvalore al prodotto derivante dall indicazione dell area geografica di produzione. Bibliografia COSENTINO C., VALENTINI V., FRESCHI P., PAOLINO R., Il latte di asina nella cosmesi. Indagine conoscitiva tra innovazione e tradizione. Cosmetic Technology, 14 (3): COSENTINO C., PAOLINO R., FRESCHI P., CALLUSO A. M., 2012a. Jenny milk production and qualitative characteristics. Journal of Dairy Science, 95 (6): COSENTINO, C., PAOLINO, R., 2012b. Il latte di Asina uno stabilizzante naturale per i formaggi a pasta dura. Puntare su allevamenti. ALSIA Agrifoglio, 41: KHRAIM H. S., The influence of brand loyalty on cosmetics buying behavior of UAE female consumers. Inter. J. of Marketing Studies, 3 (2): ORSINGHER A., Latte di asina, elisir di lunga vita per la pelle. In: Fondazione iniziative zooprofilattiche e zootecniche (ed). Latte di asina produzione, caratteristiche e gestione dell azienda asinina (Brescia), 82: PAOLINO R., COSENTINO C., Andamento qualitativo e attività antiossidante del latte di asine derivate Martina Franca a diversi stadi di lattazione. Scienza e Tecnica Lattiero- Casearia, 62 (6): POLIDORI P., BEGHELLI D., MARIANI P., VINCENZETTI S., 2008a. Donkey milk production: state of the art. Italian Journal of Animal Science, 8(2): POLIDORI R., MARANGON F., ROMANO S., 2008b. Sistemi locali e produzioni agroalimentari di qualità:risorse, vincoli, strategie. Italian Journal of Agronomy, n. 3 (1suppl.): POLIDORI P., VINCENZETTI S., Quantificazione del lisozima nel latte di asina in fasi diverse della lattazione. In: Atti II Convegno nazionale sul latte d asina: perché, (Roma): POWER C., Cosmetics, Identity and Consciouneusness. Journal of Consciousness Studies, 17(7-8): QING H., ZHANG K., ZHANG C.F., CHEN M.R., Packaging design research and analysis based on graphic visual. In: Atti IPCSIT Coimbatore Conferences (Singapore), 18:

152 ROCCHI B., ROMANO D., Geografie del tipico: le concezioni di qualità di fronte alla crescita del mercato. In: Rocchi B., Romano D. (a cura di): Tipicamente buono: Concezioni di qualità lungo la filiera dei prodotti agro-alimentari in Toscana. Franco Angeli, Milano. SIMOS Y., METSIOS A., VERGINADIS I., D ALESSANDRO A. G., LOIUDICE P., JIRILLO E., CHARALAMPIDIS P., KOUIMANIS V., BOULAKA A., MARTEMUCCI G., KARKABOUNA S., Antioxidant and anti-platelet properties of milk from goat, donkey and cow: An in vitro, ex vivo and in vivo study. International Dairy Journal, 21: TASKIN E., SARIOGLU S., The linguistic analysis of brand names with analytic hierarchy process and an application in Turkish biscuit market. Innovative Marketing, 7 (1): TESSE R., PAGLIALUNGA C., BRACCIO S., ARMENIO L., Adequacy and tolerance to ass's milk in an Italian cohort of children with cow's milk allergy. Italian Journal of Pediatrics, 35: 1-4. Graf. 1. Area II, Percezione del prodotto: domande a risposta multipla. Graph. 1. Area II, Perception of the product: multiple choice questions. A Preferisco i prodotti cosmetici naturali ai prodotti cosmetici ordinari B Preferisco i prodotti cosmetici italiani ai prodotti cosmetici internazionali 7% 12% 29% 64% 34% 54% C Preferisco i prodotti cosmetici con un'etichetta che mi informi in modo chiaro sul loro contenuto D La confezione di un prodotto cosmetico incide sulla mia preferenza d'acquisto 3% 6% 16% 43% 91% 41% molto poco non so 135

153 Graf. 2. Area III, Percezione della carta. Graph. 2. Area III, Perception of paper type a b b a b b La tipologia di carta aggiunge valore al concetto di "prodotto naturale" La tipologia di carta influenza la propensione all'acquisto opaca lucida lucida e con trama in rilievo *A lettere diverse corrispondono differenze statisticamente significative (P<0.05) Graf. 3. Area IV, Percezione del packaging. Graph. 3. Area IV, Perception of packaging a b b a b b L'informazione della confezione invoglia maggiormente all'acquisto L'informazione della confezione riporta elementi sufficienti a risultare affidabile Packaging A Packaging B Packaging C *A lettere diverse corrispondono differenze statisticamente significative (P<0.05) 136

154 2.20. EFFETTO DI DIFFERENTI PRATICHE AGRICOLE SULLA CAPACITÀ ANTIOSSIDANTE TOTALE IN DUE VARIETÀ DI INSALATA EFFECT OF DIFFERENT AGRICULTURAL PRACTICES ON TOTAL ANTIOXIDANT CAPACITY IN TWO VARIETIES OF SALAD Maria Stella FODDAI 1*, Irene BAIAMONTE 1, Nicoletta NARDO 1, Federica INTORRE 1, Sandra DI FERDINANDO 2, Giuseppe MAIANI 1, Flavio PAOLETTI 1 1 Istituto Nazionale di Ricerca per gli Alimenti e la Nutrizione, via Ardeatina 546, Roma 2 Agenzia Regionale per lo Sviluppo e l Innovazione dell Agricoltura del Lazio, Via R. Lanciani 38, Roma *Autore corrispondente: Riassunto La qualità nutrizionale di un alimento è influenzata da numerosi fattori, quali le condizioni pedoclimatiche, le differenze genotipiche, le pratiche agricole, il grado di maturazione, l esposizione alla luce del sole. L obiettivo del nostro lavoro di ricerca è quello di studiare la variazione della qualità nutrizionale in due varietà di insalata, lattuga romana (Lactuca sativa var. longifolia cv Integral) e lattuga foglia di quercia (Lactuca sativa var. capitata cv Naturel), provenienti da due aziende site nella regione Lazio, una con i campi di coltivazione in conversione da convenzionale a biologico (tesi A) e l altra da biologico a biodinamico (tesi B) con trattamenti di varia formulazione o senza trattamenti. Questo lavoro nasce da un progetto di ricerca della durata triennale sulla Valutazione di schemi di conversione all agricoltura biologica e biodinamica in aziende tipo della Regione Lazio, finanziato e coordinato dall Agenzia Regionale per lo Sviluppo e l Innovazione dell Agricoltura del Lazio, e si trova nella seconda annualità progettuale. Come indice di qualità nutrizionale è stato scelto di valutare la capacità antiossidante totale (TAC), parametro che indica l azione sinergica tra gli antiossidanti presenti nell alimento. Le due varietà di insalata sono state analizzate con due diversi metodi analitici, il FRAP (Ferric Reducing Antioxidant Power) ed il TEAC (Trolox Equivalent Antioxidant Capacity). I risultati ottenuti dalla tesi A mostrano che la TAC, misurata con entrambi i metodi, è significativamente maggiore (P<0.05) a favore del prodotto biologico rispetto al convenzionale per entrambe le varietà di insalata. Inoltre, per il biologico, la lattuga romana presenta valori medi di FRAP significativamente maggiori (P<0.05) rispetto alla lattuga foglia di quercia (4.55 mmol Fe 2+ /kg vs 4.19 mmol Fe 2+ /kg); il contrario si verifica con il convenzionale, dove la lattuga foglia di quercia presenta valori medi di FRAP significativamente maggiori (P<0.05) rispetto alla lattuga romana (2.14 mmol Fe 2+ /kg vs 1.90 mmol Fe 2+ /kg). Lo stesso andamento si osserva per il TEAC. Per quanto concerne il confronto delle insalate del campo con la tesi B (biologico vs biodinamico con o senza trattamenti), le due varietà di lattuga si comportano in modo diverso. La lattuga romana ottenuta dalla coltivazione biodinamica trattata ha un valore di TAC significativamente maggiore (P<0.05) della lattuga coltivata con tecnica sia biologica che biodinamica non trattata, con valori medi di FRAP di 2.15 mmol Fe 2+ /kg, 1.89 mmol Fe 2+ /kg e 1.72 mmol Fe 2+ /kg; per la lattuga varietà foglia di quercia differenze significative (P<0.05) si osservano fra il prodotto biologico e biodinamico trattato e il prodotto biodinamico non trattato con valori medi di FRAP rispettivamente di 3.62 mmol Fe 2+ /kg, 3.20 mmol Fe 2+ /kg e 3.16 mmol Fe 2+ /kg. Il confronto fra le due varietà della tesi B mostra un valore della TAC significativamente maggiore a favore della varietà foglia di quercia verso la varietà romana 137

155 per tutte le pratiche agricole. In conclusione i risultati ottenuti sia per la tesi A che per la tesi B, anche se preliminari, dimostrano che, malgrado le simili condizioni pedoclimatiche e la stessa area geografica di produzione, la pratica agricola influenza la qualità nutrizionale. Parole chiave: pratiche agricole, lattuga, capacità antiossidante totale Abstract The nutritional quality of food is influenced by many factors, such as pedo-climatic conditions, genetic differences, agricultural practices, degree of maturation, exposure to sunlight. The aim of our research is to study the variation of the nutritional quality of two varieties of lettuce, romaine lettuce (Lactuca sativa var. longifolia cv Integral) and oak leaf lettuce (Lactuca sativa var. capitata cv Naturel), coming from two farms in the Lazio region, one having growing fields in conversion from conventional to organic (thesis A) and the other from organic to biodynamic (thesis B), the latter following two types of manuring, with or without treatments. This work belongs to a three-year research project on "Evaluation of patterns of conversion to organic and biodynamic farms in the Lazio Region", funded and coordinated by the Regional Agency for the Development and the Innovation of the Agriculture of Lazio, and it is in the second year. As index of nutritional quality, it was evaluated the total antioxidant capacity (TAC), which indicates the synergistic action of antioxidants in the food matrix. The two varieties of lettuce were analyzed by two different analytical methods, FRAP (Ferric Reducing Antioxidant Power) and TEAC (Trolox Equivalent Antioxidant Capacity). The results obtained from the thesis A show that the TAC values, measured by both methods, are significantly higher (P<0.05) in the organic product compared to the conventional one for both varieties of lettuce. Moreover, the organic romaine lettuce has significantly higher mean values (P<0.05) of FRAP respect to oak leaf lettuce (4.55 mmol Fe 2+ /kg vs 4.19 mmol Fe 2+ /kg); on the contrary the conventional oak leaf lettuce has mean FRAP values significantly higher (P<0.05) than romaine lettuce (2.14 mmol Fe 2+ /kg vs 1.90 mmol Fe 2+ /kg). The same trend is observed for TEAC values. Regarding the thesis B (organic vs biodynamic with or without treatments), the two varieties of lettuce present a different trend. The treated biodynamic romaine lettuce has TAC values significantly (P<0.05) higher than organic and not treated biodynamic one, with mean FRAP values of 2.15 mmol Fe 2+ /kg, 1.89 mmol Fe 2+ /kg and 1.72 mmol Fe 2+ /kg; for oak leaf lettuce significant (P<0.05) differences are observed between both the organic and the treated biodynamic product and the untreated biodynamic product, with mean FRAP values of 3.62 mmol Fe 2+ /kg, 3.20 mmol Fe 2+ /kg and 3.16 mmol Fe 2+ /kg respectively. The comparison between the two varieties of the thesis B shows a significantly higher values of the TAC for the oak leaf lettuce for all agricultural practices. In conclusion, these preliminary results show that, despite similar pedo-climatic conditions and the same geographical area of production, the agricultural practices affect the nutritional quality of food. Keywords: agricultural practices, lettuce, total antioxidant capacity Introduzione La qualità nutrizionale di un alimento è influenzata da numerosi fattori, quali le condizioni pedoclimatiche, le differenze genotipiche, le pratiche agricole, il grado di maturazione, l esposizione alla luce del sole. Come parametro di qualità nutrizionale è stato scelto di valutare la capacità antiossidante totale (TAC), che considera l azione cumulativa e sinergica 138

156 di tutti gli antiossidanti presenti nella matrice, fornendo un parametro completo piuttosto che la semplice somma dei singoli antiossidanti. L obiettivo di questo studio è quello di valutare la variazione della TAC in due varietà di insalata, lattuga romana (Lactuca sativa var. longifolia cv Integral) e lattuga foglia di quercia (Lactuca sativa var. capitata cv Naturel), provenienti da due aziende site nella regione Lazio, una con i campi di coltivazione in conversione da convenzionale a biologico (tesi A) e l altra da biologico a biodinamico (tesi B). Questo lavoro nasce da un progetto di ricerca della durata triennale sulla Valutazione di schemi di conversione all agricoltura biologica e biodinamica in aziende tipo della Regione Lazio, finanziato e coordinato dall Agenzia Regionale per lo Sviluppo e l Innovazione dell Agricoltura del Lazio, e si trova nella seconda annualità progettuale. Materiali e metodi Campionamento del materiale vegetale - Per la tesi A (campo in conversione da convenzionale a biologico), i campioni di lattuga romana e di lattuga foglia di quercia sono stati forniti dall azienda Rattoniz. Per la tesi B (campo in conversione da biologico a biodinamico), i campioni di lattuga romana e lattuga foglia di quercia sono stati forniti dall azienda Agricoltura Nuova. In questo campo sono previste due modalità di applicazione del metodo biodinamico, una che prevede dei trattamenti dati sotto forma di preparati: fertilizzazione con 500p (corno letame), 501 (corno silice), compost e miscela multifloreale Arcoiris; l altra modalità senza trattamenti utilizza solo il compost e la miscela multifloreale Arcoiris. Determinazione della Capacità Antiossidante Totale (TAC) - Le insalate sono state campionate ed omogeneizzate al fine di procedere all estrazione in triplicato degli antiossidanti idrosolubili e liposolubili secondo la metodica descritta da Pellegrini et al. (2003). La Capacità Antiossidante Totale (TAC) dei campioni è stata valutata mediante il metodo FRAP (Ferric Reducing Antioxidant Power) (Benzie e Strain, 1996) ed il metodo TEAC (Trolox Antioxidant Capacity) (Re et al., 1999). Il metodo FRAP si basa sulla capacità degli antiossidanti di ridurre un complesso incolore tripiridilitriazinico ferrico (TPTZ-Fe3 + ) nella sua forma ferrosa di intenso colore blu (TPTZ- Fe2 + ). Questa reazione è seguita spettrofotometricamente a 593 nm. La variazione di assorbanza è proporzionale al potere riducente degli antiossidanti presenti nella soluzione. Il metodo TEAC si basa sulla capacità delle molecole antiossidanti di catturare radicali liberi; viene utilizzato il radicale ABTS +, un cromoforo verde-blu con assorbimento caratteristico a 734 nm. L aggiunta di antiossidanti al radicale cationico preformato comporta la sua riduzione a ABTS, determinando una decolorazione che può essere misurata spettrofotometricamente e che è proporzionale alla presenza di antiossidanti nel campione (Re et al., 1999). Analisi statistica - I valori sono presentati come valori medi±deviazione standard (n=6). Le differenze tra le pratiche agricole e tra le due varietà di lattuga sono state testate mediante il t- test di Student. P<0.05 è il livello di significatività usato. Risultati e discussione Nella Tab. 1 sono riportati i valori di FRAP e TEAC (media deviazione standard) per la tesi A. I risultati mostrano che la TAC misurata sia con il metodo FRAP che con il metodo TEAC è significativamente (P<0.05) maggiore a favore del prodotto biologico rispetto al prodotto convenzionale per entrambe le varietà di insalata. Inoltre per il prodotto biologico, la lattuga romana presenta valori significativamente maggiori di FRAP rispetto alla lattuga foglia di 139

157 quercia; il contrario si verifica invece con il prodotto convenzionale. Anche nel caso del metodo TEAC si osserva lo stesso andamento. Nella Tab. 2 sono riportati i valori di FRAP e TEAC (media deviazione standard) per la tesi B. I risultati mostrano che le due varietà di insalata si comportano in modo diverso. La lattuga romana ottenuta dalla coltivazione biodinamica trattata ha un valore della TAC misurata sia con il metodo FRAP che con il metodo TEAC significativamente maggiore della lattuga romana coltivata con tecnica sia biologica che biodinamica non trattata, mentre per la lattuga foglia di quercia differenze significative si osservano fra il prodotto biologico e biodinamico trattato e il prodotto biodinamico non trattato. Il confronto delle due varietà mostra un valore della TAC significativamente maggiore a favore della varietà foglia di quercia verso la varietà romana per tutte le pratiche agricole. Conclusioni I risultati ottenuti sia per la tesi A che per la tesi B anche se preliminari, dimostrano che malgrado le simili condizioni pedoclimatiche e la stessa area geografica di produzione, la pratica agricola influenza la qualità nutrizionale. Bibliografia PELLEGRINI N., SERAFINI M., COLOMBI B., DEL RIO D., SALVATORE S., BIANCHI M., BRIGHENTI F., Total antioxidant capacity of plant foods, beverages and oils consumed in Italy assessed by three different in vitro assays. Journal of Nutrition, 133 (9): BENZIE I.F.F., STRAIN J.J., The ferric reducing ability of plasma (FRAP) as a measure of antioxidant power : The FRAP assay. Analytical Biochemistry, 239: RE R., PELLEGRINI N., PROTTEGENTE A., PANNALA A., YANG M., RICE-EVANS C., Antioxidant activity applying an improved abts radical cation decolorization assay. Free Radical Biology & Medicine, 26:

158 Tab. 1. Valori medi e deviazione standard della capacità antiossidante totale: confronto tra varietà e tra pratiche agricole (Tesi A) Analisi statistica: t-test. Apici diversi nella stessa riga indicano differenze significative (P<0.05) Tab. 1. Mean values and standard deviation of total antioxidant capacity: comparison between varieties and between agricultural practices (Thesis A). Statistical analysis: Student t-test. Different superscript letters in the same row indicate statistically significant differences (P<0.05). Varietà Biologica Convenzionale FRAP (mmol Fe 2+ /kg) Lattuga romana a b Foglia di quercia c d P < 0.05 < 0.05 TEAC (mmol Trolox/kg) Lattuga romana a b Foglia di quercia c d P <0.05 <0.05 Tab. 2. Valori medi e deviazione standard della capacità antiossidante totale: confronto tra varietà e tra pratiche agricole. (tesi B) Analisi statistica: t-test. Apici diversi nella stessa riga indicano differenze significative (P<0.05) Tab. 2. Mean values and standard deviation of total antioxidant capacity: comparison between varieties and among agricultural practices (thesis B). Statistical analysis: Student t-test. Different superscript letters in the same row indicate statistically significant differences (P<0.05). Varietà Biologica Biodinamica trattata Biodinamica non trattata FRAP (mmol Fe 2+ /kg) Lattuga romana a b a Foglia di quercia c d d P <0.05 <0.05 <0.05 TEAC (mmol Trolox/kg) Lattuga romana a b a Foglia di quercia c d d P <0.05 <0.05 <

159 2.21. VALORIZZAZIONE DELLA BIODIVERSITÀ VITICOLA: CARATTERIZZAZIONE AGRONOMICA ED ENOLOGICA DI ALCUNI VITIGNI AUTOCTONI DEL FRIULI VENEZIA GIULIA EXPLOITATION OF THE GRAPEVINE BIODIVERSITY: AGRONOMIC AND OENOLOGICAL CHARACTERIZATION OF SOME AUTOCHTHONOUS GRAPEVINE VARIETIES FROM FRIULI VENEZIA GIULIA Massimo GARDIMAN, Mirella GIUST, Marina NIERO, Annarita PANIGHEL, Fabiola DE MARCHI, Mirko DE ROSSO, Antonio DALLA VEDOVA, Riccardo FLAMINI Consiglio per la Ricerca e la sperimentazione in Agricoltura - Centro di ricerca per la viticoltura (CRA-VIT). Viale XXVIII aprile, 26 Conegliano (TV), Riassunto Il mantenimento della biodiversità viticola va perseguito, oltre che attraverso la conservazione ex situ del germoplasma nelle collezioni ampelografiche, anche con la valorizzazione dei vitigni autoctoni che nell evoluzione della viticoltura sono stati soppiantati dalla diffusione di quelli internazionali, purché dotati di buone potenzialità enologiche. La coltivazione di queste varietà può rappresentare fonte di ottime opportunità di valorizzazione economica, storica e culturale di prodotti tradizionali legati al territorio. Con questo obiettivo sono state approfondire le conoscenze sulle potenzialità viticole ed enologiche di cinque varietà autoctone e di antica coltivazione, caratteristiche del patrimonio viticolo friulano: Cividin e Sagrestana a bacca bianca, Cjanorie, Fumat e Pignolo a bacca nera. Ciascuno dei cinque vitigni è stato seguito per un triennio ( ). Sono stati effettuati i rilievi delle epoche fenologiche di germogliamento, fioritura, invaiatura e maturazione, dei principali parametri produttivi del vigneto (fertilità, produzione uva per ceppo, peso medio grappolo ed acino, peso legno potatura) e dell uva alla raccolta (zuccheri, acidità, ph, acido tartarico ed acido malico, indici di antociani totali ed estraibili). Nelle bucce sono stati determinati i profili degli acidi idrossicinnamiltartarici e dei flavonoli, e gli indici di flavonoidi e di antociani totali. Inoltre, negli estratti delle varietà a bacca rossa sono stati determinati i profili degli antociani delle bucce, e su tutti i campioni i flavan-3-oli monomeri e l indice di polifenoli totali dei vinaccioli. L'uva raccolta è stata sottoposta a micro vinificazione seguendo un protocollo standardizzato e sui vini ottenuti sono state effettuate le analisi chimico-fisiche dei principali parametri enologici e sono stati determinati i profili organolettici, mediante degustazione svolta da panel di assaggiatori addestrati. L analisi complessiva dei dati rilevati sulle cinque varietà durante il triennio ha permesso di effettuare una dettagliata valutazione del loro comportamento vegeto-produttivo e di approfondirne la caratterizzazione qualitativa dell uva. Sostanzialmente tutte le varietà allo studio si sono dimostrate in grado di fornire interessanti prodotti da un punto di vista dei principali parametri analitici ed alla degustazione. Parole chiave: vitis, germoplasma, vino Abstract The grapevine biodiversity protection should be fostered not only through the ex-situ conservation in germplasm collections, but also through the exploitation of old and neglected local varieties that, during the evolution of viticulture, have been replaced by international ones. Furthermore, the diffusion of typical products, historically and culturally related to the 142

160 territory, can be a source of great economic opportunities. This work had the main goal to deepen the knowledge on viticultural and wine-making potential of five native varieties part of the wine heritage of Friuli Venezia Giulia: Cividin and Sagrestana (white), Cjanorie, Fumat and Pignolo (red). Each of the five varieties was followed for three years ( ). Main phenological stages (budbreak, flowering, veraison and ripening) and productive characters (bud fertility, yield per vine, average cluster and berry weight, weight of pruning wood, were recorded. The main parameters of the berry at the harvest were assessed: sugar, acidity, ph, tartaric and malic acids, total and extractable anthocyanin indexes. Hydroxycinnamyltartaric acid and flavonol profiles and total flavonoid and anthocyanin contents of skins, were determined. The anthocyanin profile of red grapes, was studied. Moreover, the seeds flavan-3-ol monomers content and total polyphenols were determined in all samples. The corresponding wines were produced by performing standard microvinification techniques. The main oenological parameters of wines were determined, and sensory analysis was performed by a trained panel. The data collected allowed detailed assessment of the vegetative and productive behavior, and to perform qualitative characterization of the grape. All the varieties studied showed interesting oenological characteristics. Keywords : vitis, germplasm, wine Introduzione Il mantenimento della biodiversità viticola deve essere perseguito, oltre che attraverso la conservazione ex situ del germoplasma nelle collezioni ampelografiche, anche con la valorizzazione dei vitigni autoctoni, purché dotati di buone potenzialità enologiche, che nell evoluzione della viticoltura sono stati relegati in secondo piano. La coltivazione di queste varietà può rappresentare fonte di ottime opportunità di valorizzazione economica, storica e culturale di prodotti tradizionali strettamente legati al territorio. Nell ambito delle attività previste dal Progetto per l attuazione delle attività contenute nel programma per la conservazione, caratterizzazione, uso e valorizzazione delle risorse genetiche vegetali per l alimentazione e l agricoltura (RGV-FAO), è stata condotta una ricerca su alcuni vitigni autoctoni e di antica coltivazione nella regione Friuli Venezia Giulia: Cividin e Sagrestana a bacca bianca, Cjanorie, Fumat e Pignolo a bacca nera. Queste varietà nel passato erano relativamente diffuse ed apprezzate, ma nel corso del tempo la loro area di coltivazione si è progressivamente ridotta principalmente a causa della loro scarsa resistenza alla fitopatie (in particolare per quanto riguarda il Cividin nei confronti dell oidio) ed alla grande diffusione dei vitigni internazionali (Marzotto, 1923; Calò e Costacurta, 1991; Costantini et al., 1997; De Zan et al., 2009). Alcuni di questi vitigni sono già iscritti al Registo Nazionale delle Varietà di Vite (Pignolo dal 1977, Cividin e Cjanorie dal 2006) ma sono coltivati su superfici molto ridotte, anche se recentemente alcune aziende vitivinicole hanno iniziato ad utilizzarli ed impiegarli in produzioni enologiche singolari ed apprezzate. L obiettivo di questa ricerca è l approfondimento delle conoscenze sulle potenzialità viticole ed enologiche di questi cinque interessanti vitigni, caratteristici del patrimonio viticolo friulano, al fine di una loro maggiore valorizzazione e diffusione in coltura. Materiali e metodi Tutti i vitigni sono stati valutati presso la collezione dell Azienda Pantianicco dell ERSA, a Beano di Codroipo (UD). La località è situata in pianura, 65 m s.l.m., il terreno è ricco di scheletro, e la forma di allevamento delle viti è a Guyot. Durante le annate 2008, 2009 e 143

161 2010 per ciascun vitigno sono stati effettuati i rilievi delle epoche fenologiche, dei principali parametri produttivi quantitativi e qualitativi della bacca alla raccolta. In particolare durante la stagione vegetativa sono state rilevate le principali fasi fenologiche (Lorenz et al., 1994): germogliamento (BBCH 08), fioritura (BBCH 65), invaiatura (BBCH 83) e maturazione (BBCH 89). Per la caratterizzazione produttiva sono state rilevate la fertilità reale, potenziale e quella delle prime tre gemme basali, il peso medio di uva per ceppo ed peso medio di grappolo ed acino. Sul mosto fiore alla raccolta sono stati determinati contenuto in zuccheri (Brix), acidità totale, ph, acido tartarico e malico. Sulle varietà a bacca nera sono stati determinati i contenuti in antociani totali ed estraibili. Alla potatura è stato misurato il peso del legno asportato. Campioni delle uve raccolte alla vendemmia sono stati sottoposti a microvinificazione e sul vino ottenuto sono state effettuate le analisi chimico-fisiche dei principali parametri enologici (alcool, zuccheri riduttori, estratto netto, ph, acidità totale e volatile, polifenoli totali per le varietà a bacca rossa) e i profili organolettici sono stati determinati mediante degustazione svolta da panel di assaggiatori addestrati. Per approfondire le conoscenze sulle potenzialità enologiche delle cinque varietà è stato condotto lo studio chimico degli estratti delle bucce e dei vinaccioli delle uve vendemmiate nel 2009 e 2010 con i metodi già proposti (Di Stefano e Cravero, 1991; Flamini e Di Stefano, 2008). Negli estratti delle bucce sono stati determinati i profili dei flavonoli glicosidi, degli antociani e degli acidi idrossicinnamiltartarici, e gli indici di flavonoidi e di antociani totali. Negli estratti dei vinaccioli sono stati determinati i flavan-3-oli monomeri (catechina ed epicatechina) e l indice di polifenoli totali. Risultati e conclusioni Per quanto riguarda le epoche fenologiche (Tab. 1) tutte le varietà germogliano nella prima metà di aprile, la fioritura avviene pressoché contemporaneamente a fine maggio, mentre maggiori differenze si sono notate all invaiatura: Pignolo e Sagrestana sono decisamente più precoci delle altre. Fumat è il vitigno più tardivo, e la sua raccolta è stata effettuata mediamente a inizio ottobre. Per quanto riguarda gli aspetti produttivi (Tab. 2), tutte le varietà hanno dimostrate di raggiungere mediamente buoni livelli zuccherini (20-21 Brix) e di acidità (7-9 g/l), tranne Cjanorie che ha avuto accumuli di zucchero leggermente minori delle altre. La produzione di uva per ceppo è generalmente buona (3-4 kg/ceppo). Molto ricche di antociani si sono rivelate le uve di Fumat. In relazione alla composizione chimica dell uva sono stati riscontrati maggiori contenuti di flavonoli nel Pignolo, mentre nel Cjanorie sono stati riscontrati contenuti molto bassi di miricetina pur essendo una varietà a bacca rossa. Nelle bucce di Cividin sono stati riscontrati maggiori livelli di acido trans-caffeiltartarico ed acido glutationil-caffeiltartarico, due composti antiossidanti di rilevante importanza. Nella fig. 1 è riportata la composizione percentuale degli antociani nelle bucce delle tre varietà a bacca rossa studiate. Il Cjanorie è caratterizzato da maggiori contenuti di cianina e peonina, mentre per il Fumat ed il Pignolo l antociano principale risulta la malvina. Il Fumat è risultato il vitigno caratterizzato dai maggiori indici di antociani e di flavonoidi totali nelle bucce, e da maggiori contenuti di antociani acilati (acetati e paracumarati) coinvolti nella stabilità del colore dei vini. Lo studio dei vinaccioli ha evidenziato livelli tendenzialmente più elevati di (+)-catechina e (-)-epicatechina nel Cividin, ed un maggior indice di polifenoli totali. I vini ottenuti (Tab. 3) dalle uve di tutte le varietà presentano una buona gradazione alcolica naturale, normalmente superiore al 12 % accompagnata da una acidità importante nelle varietà a bacca bianca Le due varietà rosse Fumat e Pignolo hanno fornito vini ricchi in polifenoli totali (oltre 1500 mg/l) e, nel caso di Fumat, anche di antociani (655 mg/l). Alla degustazione il vino di Sagrestana si è rivelato dotato di una buona intensità, tipicità e finezza 144

162 olfattiva, odori positivi, con sentori di frutta matura e floreale; sapido e strutturato. Il Cividin è risultato avere una buona intensità e tipicità olfattiva, ed odori positivi con sentori di frutta matura, con una buona acidità, sapido e strutturato, molto piacevole (Fig. 2). Il Pignolo è risultato avere una elevata intensità del colore, una buona intensità e tipicità olfattiva, ed odori positivi con sentori di frutta rossa e confettura, piuttosto astringente al gusto. Il Fumat è risultato caratterizzato da una ottima intensità e piacevolezza nel colore, buona intensità, tipicità e finezza olfattiva, odori positivi con sentore di frutta rossa e confettura, buona struttura, con una rilevante acidità. Il Cjanorie ha espresso un colore non molto intenso, ma buona intensità olfattiva ed odori positivi, sentore di confettura; buona struttura, con una buona acidità (Fig. 3). Nel complesso i risultati chimici e sensoriali indicano che i vini ottenuti da queste varietà sono dei prodotti con interessanti caratteristiche tipiche. Ringraziamenti Si ringraziano A. Fabbro, F. Bregant e S. Fontanot dell ERSA-FVG per la preziosa collaborazione prestata. Bibliografia CALÒ A., COSTACURTA A., Delle viti in Friuli. Ed Arti Grafiche Friulane, Udine. COSTANTINI E., MATTALONI C., PETRUSSI C., La vite nella storia e nella cultura del Friuli. Forum Editrice, Udine. DEL ZAN F., FAILLA O., SCIENZA A., La vite e l'uomo. Dal rompicapo delle origini al salvataggio delle reliquie. Ed. ERSA. DI STEFANO R., CRAVERO M.C., Metodi per lo studio dei polifenoli dell uva. Rivista di Viticoltura ed Enologia, 2: FLAMINI R., DI STEFANO R., High performance liquid chromatography analysis of grape and wine polyphenols. In: Hyphenated techniques in grape & wine chemistry. John Wiley & Sons: LORENZ D.H., EICHHORN K. W., BLEI-HOLDER H., KLOSE R., MEIER U., WEBER E., 1994: Phänologische Entwicklungsstadien der Weinrebe (Vitis vinifera L. ssp. vinifera). Vitic. Enol. Sci., 49: MARZOTTO N., Ampelografia del Friuli contenente la descrizione di 42 vitigni con notizie sulla loro importanza viticola ed enologica. Tip. Domenico Del Bianco e Figlio, Udine. 145

163 Tab. 1. Epoca delle fasi fenologiche rilevate (media triennio ). Tab. 1.- Main phenological phases of the five varieties (three year average ). varietà colore germogliamento (BBCH 08) fioritura (BBCH 65) invaiatura (BBCH 83) maturazione (BBCH 89) Cjanorie N 12-apr 28-mag 11-ago 14-set Cividin B 9-apr 29-mag 14-ago 21-set Fumat N 8-apr 26-mag 16-ago 4-ott Sagrestana B 14-apr 29-mag 4-ago 9-set Pignolo N 9-apr 28-mag 1-ago 16-set Tab. 2. Parametri produttivi e qualitativi delle varietà (media triennio ). Tab. 2. Productive and qualitative characteristics of the five grape varieties (three year average ). Varietà Fertilit à reale uva per ceppo (kg) Peso medio grappolo (g) acino (g) brix Mosto alla raccolta Acidità totale (g/l) ph Acido tartarico (mg/l) Acido malico (g/l) Antociani (mg/kg) Tot. Estraib. Peso legno potatura (kg) Cjanorie 1,52 3, ,27 18,7 7,0 3,1 4,70 3, ,02 Cividin 2,08 4, ,76 20,2 9,0 3,1 5,87 5, ,21 Fumat 1,49 2, ,93 21,0 9,8 3,0 5,27 5, ,74 Sagrestana 1,71 4, ,36 21,2 8,3 3,0 5,00 5, ,96 Pignolo 0,99 3, ,83 19,9 6,7 3,5 3,45 5, ,96 Tab. 3. Principali parametri rilevati nei vini ottenuto dalla cinque varietà (media triennio ). Tab. 3. Main parameters of the wines obtained from the five grape varieties (three year average ). Varietà Alcol (% vol) Estratto netto (g/l) Acidità (g/l) ph Ac. tartarico (g/l) Polifenoli totali (mg/l) Antociani (mg/l) volatile totale Cjanorie 12,15 26,2 0,48 4,65 3,66 1, Cividin 12,88 22,1 0,27 8,75 2,91 2, Fumat 12,87 29,2 0,50 5,35 3,80 1, Sagrestana 13,00 19,8 0,30 7,10 3,20 2, Pignolo 12,91 34,6 0,56 4,20 4,48 2,

164 Fig. 1. Profilo degli antociani delle tre diverse varietà a bacca rossa studiate nelle annate 2009 e Sono riportati i cinque antociani monoglucosidi (delfinidina-3-o-monoglucoside: Dp3G; cianidina-3- O-monoglucoside: Cy3G; petunidina-3-o-monoglucoside: Pt3G; peonidina-3-o-monoglucoside: Pn3G; malvidina-3-o-monoglucoside: Mv3G), le somme degli antociani acetati e paracumarati, la malvidina-3-o-(6-o-caffeoil) monoglucoside (Mv3G6cf). Le barre indicano le semidispersioni per due campioni ripetuti. Fig. 1. Anthocyanin profiles of the three red grape varieties (harvests 2009 and 2010). The five anthocyanin monoglucosides (delphinidin-3-o-monoglucoside: Dp3G; cyanidin-3-o-monoglucoside: Cy3G; petunidin-3-o-monoglucoside: Pt3G; peonidin-3-o-monoglucoside: Pn3G; malvidin-3-omonoglucoside: Mv3G), sum of acylated and p-coumarated anthocyanins, and malvidin-3-o-(6-ocaffeoyl) monoglucoside (Mv3G6cf), are reported. Bars show differences between data for two replicate samples. 147

165 Fig. 2. Profilo sensoriale dei vini ottenuti dalle varietà a bacca bianca. Fig. 2. Sensory profiles of Cividin and Sagrestana white wines. Fig. 3. Profilo sensoriale dei vini ottenuti dalle varietà a bacca nera. Fig. 3. Sensory profile of Fumat, Pignolo and Cjanorie red wines. 148

166 2.22. INFLUENZA DEL TRATTAMENTO DOMESTICO DI COTTURA SULLA QUALITÀ NUTRIZIONALE IN CAMPIONI DI RADICCHIO ROSSO DI TREVISO INFLUENCE OF DOMESTIC COOKING ON NUTRITIONAL QUALITY OF RED CHICORY (RADICCHIO ROSSO DI TREVISO) Federica INTORRE*, Simona VALENTINI, Maria Stella FODDAI, Elena AZZINI, Francesca IOANNONE, Giuseppe MAIANI Istituto Nazionale di Ricerca per gli Alimenti e la Nutrizione, via Ardeatina 546, Roma * Riassunto La qualità di un alimento dipende dalle sue caratteristiche organolettiche, nutrizionali ed igienico-sanitarie che, a loro volta, sono funzione non solo di una serie di fattori pre-raccolto, quali il tipo di cultivar, le condizioni geografiche e pedoclimatiche e le pratiche agronomiche, ma anche di fattori post-raccolto di trasformazione e conservazione che mirano innanzitutto al miglioramento delle caratteristiche organolettiche ed alla tutela della sicurezza igienica, ma inevitabilmente modificano la qualità nutrizionale. In particolare, il trattamento domestico di cottura comporta un cambiamento nel contenuto in nutrienti e non nutrienti di importanza biologica, in modo essenzialmente dipendente dalla tecnica utilizzata e dalla sua durata così come dallo stato fisico, forma e dimensione dell alimento. Scopo di questo lavoro è l identificazione e la quantificazione di alcune molecole naturali ad azione antiossidante (carotenoidi e polifenoli) in campioni di radicchio rosso di Treviso tardivo (Cichorium intybus L. var. Silvestre) e la valutazione dell impatto della cottura sul contenuto di tali molecole. In particolare il radicchio è stato analizzato non cotto, cotto al forno a tre diverse temperature (150 C, 170 C, 190 C), cotto alla griglia (150 C) o bollito (100 C); ogni trattamento è stato effettuato per due diversi tempi, scelti in seguito a test preliminari finalizzati a definire una combinazione ottimale tempo-temperatura. I carotenoidi identificati nel radicchio sono la luteina ed il beta-carotene, con concentrazioni rispettivamente di 0.31±0.03 mg/100g e 0.04±0.01 mg/100g nel campione non cotto. La cottura alla griglia non ha determinato differenze nel contenuto in carotenoidi rispetto al radicchio non cotto, mentre in seguito alla bollitura si sono osservate diminuzioni significative (P<0.05); la cottura al forno ha comportato invece andamenti diversi a seconda della combinazione tempo-temperatura di cottura (150 C per 8 e 10 minuti, 170 C per 6 e 8 minuti, 190 C per 6 e 7,5 minuti). I polifenoli maggiormente presenti nei campioni analizzati sono l acido clorogenico, la quercetina e la quercetina-3-glucoside, con concentrazioni rispettivamente di 0.92±0.07 mg/100g, 6.12±0.78 mg/100g e 0.13±0.12 mg/100g nei campioni di radicchio non cotto. La concentrazione di acido clorogenico significativamente (P<0.05) è aumentata a seguito della cottura al forno indipendentemente dalla combinazione tempo-temperatura utilizzata (fino a 2.49±0.09 mg/100g per la cottura a 190 C per 7,5 minuti) ed è diminuita con la bollitura (fino a 0.39±0.35 mg/100g). La quercetina e il suo derivato glucosidico hanno subito cambiamenti significativi solamente a seguito della cottura alla griglia a 150 C per 20 minuti: mentre la concentrazione della quercetina è raddoppiata (P<0.05), la quercetina-3-glucoside si è ridotta notevolmente in seguito allo stesso trattamento, anche se in modo non significativo. In conclusione, i risultati dimostrano che la cottura influenza la qualità nutrizionale dell alimento, in modo dipendente dal processo utilizzato. Di conseguenza, è importante quantificare sia i nutrienti che le molecole non nutrienti di importanza biologica nell alimento 149

167 di partenza ma anche seguire il loro destino fino al consumo per verificarne effettivamente la quantità ingerita e quindi i loro potenziali effetti sullo stato di salute. Questo lavoro di ricerca è stato realizzato nell ambito del progetto QUalità ALImentare e FUnzionale (QUALIFU) finanziato dal MiPAAF Parole chiave: Radicchio, cottura, molecole bioattive Abstract Food quality depends on organoleptic, nutritional and hygienic-sanitary characteristics which in turn are related to both pre-harvest (type of cultivar, geographic and pedo-climatic conditions, agricultural practices) and post-harvest factors (technological processes and domestic treatments) aiming to improve the organoleptic and hygienic-sanitary properties but inevitably changing the nutritional quality. In particular, domestic cooking affects food nutrient and non-nutrient content, depending on the type and the length of treatment as well as the type of food and its physical status. The aim of this work was to identify and quantify in late red chicory samples (Cichorium intybus L. var. silvestre) the antioxidant compounds (carotenoids and phenolic compounds) and to evaluate the effect of domestic cooking on their content. In particular, the red chicory was analyzed as raw product, oven-cooked (150 C, 170 C, 190 C), grilled (150 C) and boiled (100 C); each cooking process was performed at two different temperatures, following preliminary tests for the identification of the best heating conditions (time-temperature). The HPLC analysis of the red chicory extracts revealed the presence of lutein and betacarotene, whose concentrations were respectively 0.31±0.03 mg/100g and 0.04±0.01 mg/100g in the raw sample. Whereas the grilled samples were not significantly different from the raw ones, both lutein and beta-carotene content significantly (P<0.05) decreased after boiling; oven cooking implied significant differences depending on the different heating conditions (150 C for 8 and 10 minutes, 170 C for 6 and 8 minutes, 190 C for 6 and 7,5 minutes). Chlorogenic acid, quercetin and quercetin-3-glucoside were the most representative phenolic compounds, whose concentrations were respectively 0.92±0.07 mg/100g, 6.12±0.78 mg/100g e 0.13±0.12 mg/100g in raw samples. Chlorogenic acid concentration significantly (P<0.05) increased with oven cooking, regardless the heating condition (up to 2.49±0.09 mg/100g at 190 C for 7,5 minutes) and decreased with boiling (up to 0.39±0.35 mg/100g). Both quercetin and quercetin-3-glucoside changed in grilled samples at 150 C for 20 minutes: quercetin levels doubled in values (P<0.05), while quercetin-3-glucoside levels considerably diminished, although not to a statistical significant level. In conclusion, the results show that domestic cooking influences the food content of carotenoids and polyphenols, changing the nutritional quality. Consequently, it is necessary to quantify both nutrient and non-nutrient compounds non only in raw but also in cooked food, in order to verify their fate during processing and their potential health effects. Sponsorship: This research was supported by the Italian Ministry of Agricultural, Food and Forestry Policies QUalità ALImentare e FUnzionale (QUALIFU) Project Keywords red chicory, cooking, bioactive compounds 150

168 Introduzione Numerosi studi epidemiologici hanno dimostrato che un elevato consumo di alimenti di origine vegetale contribuisce a prevenire malattie cronico-degenerative, quali malattie cardiovascolari (Rimm et al., 1996) e alcune forme di cancro (Williams e Hord, 2005). Alla base dell effetto protettivo di tali alimenti è la presenza di molecole bioattive nutrienti (quali carotenoidi e vitamina C) e non-nutrienti (quali ad esempio molecole fenoliche), coinvolte in una serie di meccanismi biologici che sono alla base dei processi degenerativi. Tali molecole sono metaboliti secondari delle piante e la loro presenza dipende dalla varietà, dalle pratiche agronomiche e dalle condizioni geografiche e pedoclimatiche ma anche da una serie di trattamenti post-raccolto di trasformazione e conservazione che mirano innanzitutto al miglioramento delle caratteristiche organolettiche ed alla tutela della sicurezza igienica dell alimento, ma che inevitabilmente influenzano la qualità nutrizionale. In particolare, il trattamento domestico di cottura modifica in modo significativo il contenuto in nutrienti e non nutrienti di importanza biologica, in modo essenzialmente dipendente dal trattamento utilizzato e dalle condizioni di cottura applicate (tempo e temperatura) (Miglio et al., 2008; Pellegrini et al., 2009). Obiettivo di questo lavoro è stata l identificazione e la quantificazione di alcune molecole naturali ad azione antiossidante (carotenoidi e polifenoli) in campioni di radicchio rosso di Treviso tardivo (Cichorium intybus L. var. Silvestre) e la valutazione dell impatto della cottura sul contenuto di tali molecole. Materiali e metodi Campionamento del materiale vegetale - 20 Kg di radicchio rosso di Treviso tardivo (Cichorium intybus L. var. Silvestre) di pezzatura standard (20-25 cm) provenienti dallo stesso lotto sono stati tagliati a metà verticalmente, lavati sotto acqua corrente, asciugati per 30 minuti ed infine divisi in 4 parti, ognuna da destinarsi ad un tipo di trattamento: tal quale (nessuna cottura), cottura al forno a tre diverse temperature (150 C, 170 C, 190 C), cottura alla griglia (150 C) e bollitura (100 C); ogni trattamento di cottura è stato effettuato per due diversi tempi, scelti a seguito di test preliminari finalizzati a definire una combinazione ottimale tempo-temperatura. Al termine della cottura, i campioni sono stati raffreddati a temperatura ambiente (22±2 C) ed è stata effettuata la valutazione delle proprietà meccaniche e del grado di cottura; in seguito sono stati congelati rapidamente a -45 C ed infine liofilizzati. Estrazione e quantificazione dei carotenoidi - I carotenoidi sono stati estratti utilizzando la metodica descritta da Sharpless et al. (1999) e analizzati tramite un sistema HPLC Perkin- Elmer ISS 200 (Maiani et al., 1995). Estrazione e quantificazione dei polifenoli - I polifenoli sono stati estratti in acqua e acetone 70%; gli estratti sono stati analizzati tramite un sistema HPLC ESA modello 580 (Azzini et al., 2010). Analisi statistica - I valori sono presentati come valori medi±deviazione standard (n=4). Le differenze tra campione non cotto e cotto sono state testate mediante il t-test per dati appaiati. P<0.05 è il livello di significatività usato. Risultati e discussione Nella Tab. 1 è riportato il contenuto in carotenoidi nei campioni di radicchio analizzati. La cottura alla griglia non ha determinato differenze significative nella concentrazione di luteina e beta-carotene rispetto al campione non cotto, mentre con la bollitura si sono osservate diminuzioni significative (P<0.05) di entrambi i composti. La cottura al forno ha comportato 151

169 un andamento diverso a seconda della combinazione tempo-temperatura: a seguito di 10 minuti di cottura, anche se alla temperatura più bassa (150 C), si è osservata una significativa diminuzione (P<0.05) dei valori di luteina, diminuzione che è avvenuta anche a seguito della cottura a 190 C; inoltre la cottura al forno ha determinato sempre un aumento dei livelli di beta-carotene, indipendentemente dalla combinazione tempo-temperatura utilizzata. Nella Tab. 2 è riportato il contenuto in polifenoli nei campioni di radicchio. La concentrazione di acido clorogenico è significativamente (P<0.05) aumentata con la cottura al forno, indipendentemente dalla combinazione tempo-temperatura utilizzata e raggiungendo comunque il valore più alto con la cottura a 190 C per 7,5 minuti; inoltre è tendenzialmente aumentata con la grigliatura mentre è diminuita significativamente (P<0.05) con la bollitura. La quercetina e il suo derivato 3-glucoside non hanno subito variazioni significative di concentrazione con la cottura, eccetto che nella cottura alla griglia a 150 C per 20 minuti. Si osserva però un andamento opposto; la concentrazione della quercetina è significativamente (P<0.05) raddoppiata, mentre il suo derivato 3-glucoside si è ridotto notevolmente in seguito allo stesso trattamento, anche se in modo non significativo. Sebbene la cottura sia generalmente associata ad una ridotta qualità nutrizionale dell alimento a causa della perdita di nutrienti e non-nutrienti dovuta fondamentalmente al riscaldamento che può comportare processi di ossidazione e degradazione termica (Kalt, 2005), i risultati ottenuti dimostrano che la cottura non ha sempre un effetto negativo, in quanto una combinazione ottimale tempo-temperatura, che risulta essere diversa a seconda del trattamento di cottura utilizzato, può promuovere la destrutturazione della matrice cellulare e il conseguente aumento della estraibilità e disponibilità dei composti analizzati; infatti sia i carotenoidi, che si trovano in associazione a complessi proteici di membrana nei cloroplasti o cromoplasti, che i polifenoli, associati a componenti della parete cellulare e accumulati nei vacuoli e negli apoplasti, vengono rilasciati con il calore da tali compartimenti (Kalt, 2005; Bernhardt e Schlich, 2006). Conclusioni In conclusione, i risultati dimostrano che la cottura influenza la qualità nutrizionale dell alimento, in modo dipendente dalle condizioni impiegate. Di conseguenza, è importante quantificare sia i nutrienti che le molecole non nutrienti di importanza biologica nell alimento di partenza ma anche seguire il loro destino fino al consumo per verificarne effettivamente la quantità ingerita e quindi i loro potenziali effetti sullo stato di salute. Bibliografia AZZINI E., INTORRE F., VITAGLIONE P., NAPOLITANO A., FODDAI M.S., DURAZZO A., FUMAGALLI A., CATASTA G., ROSSI L., VENNERIA E., TESTA M.F., RAGUZZINI A., PALOMBA L., FOGLIANO V., MAIANI G., Absorption of strawberry phytochemicals and antioxidant status changes in humans. Journal of Berry Research, 1: BERNHARDT S., SCHLICH E., Impact of different cooking methods on food quality: Retention of lipophilic vitamins in fresh and frozen vegetables. Journal of Food Engineering, 77: MAIANI G., PAPPALARDO G., FERRO-LUZZI A., RAGUZZINI A., AZZINI E., GUADALAXARA A., TRIFERO M., FROMMEL T., MOBARHAN S., Accumulation of beta-carotene in normal colorectal mucosa and colonic neoplastic lesions in humans. Nutrition & Cancer, 24:

170 MIGLIO C., CHIAVARO E., VISCONTI A., FOGLIANO V., PELLEGRINI N., Effects of different cooking methods on nutritional and physicochemical characteristics of selected vegetables. Journal of Agricultural and Food Chemistry, 56: KALT W., Effects of production and processing factors on major fruit and vegetable antioxidants. Journal of Food Science, 70: R11-R19. PELLEGRINI N., MIGLIO C., DEL RIO D., SALVATORE S., SERAFINI M., BRIGHENTI F., Effect of domestic cooking methods on the total antioxidant capacity of vegetables. International Journal of Food Sciences and Nutrition, 60 (Suppl 2): RIMM E.B., ASCHERIO A., GIOVANNUCCI E., SPIEGELMAN D., STAMPFER M.J., WILLETT W.C., Vegetable, fruit, and cereal fiber intake and risk of coronary heart disease among men. Journal of the American Medical Association, 275: SHARPLESS K.E., ARCE-OSUNA M., BROWN-THOMAS J., GIL L.M., Value assignment of retinol, retinyl palmitate, tocopherol and carotenoid concentrations in standard references material 2383 (baby food composite). Journal of AOAC International, 82: WILLIAMS M.T., HORD N.G., The role of dietary factors in cancer prevention: Beyond fruits and vegetables. Nutrition in Clinical Practice, 20: Tab. 1. Contenuto in carotenoidi nei campioni di radicchio (valori medi±deviazione standard) (n=4). Analisi statistica: t-test per dati appaiati. *=P<0.05 rispetto al non cotto Tab. 1. Carotenoid content in red chicory samples (mean±standard deviation) (n=4) Statistical analysis: paired t-test. *=P<0.05 compared to raw sample. Trattamento Temperatura ( C) Tempo (minuti) Luteina (mg/100g peso fresco) Beta-carotene (mg/100g peso fresco) Non cotto 0.31± ±0.01 Forno ±0.15* 0.05±0.01* Forno ±0.02* 0.04±0.01 Forno ±0.22* 0.05±0.01* Forno ±0.24* 0.08±0.02* Forno ±0.06* 0.04±0.01 Forno 190 7,5 0.27± ±0.01* Griglia ± ±0.01 Griglia ± ±0.01 Bollitura ±0.02* 0.03±0.00* Bollitura ±0.06* 0.02±0.00* 153

171 Tab. 2. Contenuto in polifenoli nei campioni di radicchio (valori medi±deviazione standard) (n=4) Analisi statistica: t-test per dati appaiati. *=P<0.05 rispetto al non cotto Tab. 2. Polyphenol content in red chicory samples (mean±standard deviation) (n=4) Statistical analysis: paired t-test. *=P<0.05 compared to raw sample Trattamento Temperatura ( C) Tempo (minuti) Acido clorogenico (mg/100g) Quercetina (mg/100g) Quercetina-3- glucoside (mg/100g) Non cotto 0.92± ± ±0.12 Forno ±0.58* 6.06± ±0.03 Forno ±0.16* 6.00± ±0.02 Forno ± ± ±0.03 Forno ±0.39* 7.53± ±0.01 Forno ±0.23* 7.52± ±0.06 Forno 190 7,5 2.49±0.09* 8.75± ±0.14 Griglia ± ± ±0.03 Griglia ±0.06* 13.00±0.66* 0.03±0.01 Bollitura ±0.09* 5.62± ±0.02 Bollitura ±0.35* 6.94± ±

172 2.23. CARATTERIZZAZIONE QUALITATIVA DI FRUTTI DI FRAGARIA A DIVERSA PLOIDIA FRUIT QUALITY IN FRAGARIA GENOTYPES WITH DIFFERENT PLOIDY Maria Luigia MALTONI, Daniela GIOVANNINI, Irene QUACQUARELLI, Walther FAEDI Consiglio per la Ricerca e la Sperimentazione in Agricoltura -Unità di Ricerca per la Frutticoltura di Forlì (CRA-FRF) -Via la Canapona, 1 bis Forlì - Italy Riassunto Numerosi studi hanno evidenziato l elevato valore nutraceutico delle fragole (Fragaria ananassa) rispetto ai frutti di altre specie della famiglia delle Rosacee. Al contrario, pochissime sono ancora le conoscenze sulla qualità dei frutti di altre specie o ibridi del genere Fragaria. Nel 2010, l Unità di Ricerca per la Frutticoltura di Forlì del CRA ha avviato uno studio finalizzato quantificare, ai fini del breeding, il range di variabilità qualitativa dei frutti in Fragaria. Frutti maturi di 28 accessioni diverse per specie di appartenenza e caratteristiche agro-pomologiche (12 F. vesca; 7 F. moschata; 6 F. ananassa; 1 ibrido F. chiloensis F. ananassa e 2 ibridi di origine sconosciuta) sono stati caratterizzati per numerosi tratti qualitativi. Il range di variazione di ciascun carattere easminato è risultato ampio all interno della medesima specie e, soprattutto, tra specie/ibridi diversi. L applicazione della tecnica statistica della cluster analysis al set di dati rilevati ha consentito di suddividere in gruppi le 28 accessioni sulla base della similarità qualitativa dei frutti. Parole chiave: fragola, germoplasma, variabilità genetica, polifenoli totali Abstract Octoploid F. ananassa strawberries are known as being highly endowed with nutritional and protective compounds in comparison to other fruits. However, information about the fruit quality of other Fragaria species or hybrids is still limited. The CRA-FRF of Forlì has started a study to investigate the range of variation of important fruit traits in its rich Fragaria spp. germplasm collection for breeding purposes. In 2010, ripe fruits of 28 Fragaria accessions, inlcuding 12 diploid (F. Vesca); 7 hexaploid (F. Moschata); 6 octoploid (F. ananassa) and 1 octoploid hybrid (F. chiloensis F. ananassa); and 2 hybrids of unknown ploidy, were sampled and the most important quality traits of each measured. The range of variation of each qualitative trait was large within and among ploidy groups. Multivariate cluster analysis was applied to the dataset of qualitative measures to discover natural groupings in the 28 accessions based on the similarity of their fruit traits. Keywords: strawberry, germplasm, variability exploitation, total polyphenols Introduzione Il genere Fragaria comprende numerose specie, diverse tra loro per caratteristiche agronomiche e pomologiche (Bucci et al., 2010). Alcune di queste sono di origine europea, come la diploide F. vesca (2n=2x=14), più comunemente conosciuta come fragolina di bosco, caratterizzata da frutti piccoli, in genere molto aromatici e poco sodi, e l esaploide F. moschata (2n=6x=42), caratterizzata da frutti rotondi, di pezzatura di poco superiore a quella delle fragole diploidi, di colore variabile dal rosso chiaro al violaceo e dal tipico aroma 155

173 moscato. La quasi totalità delle cultivar di fragola oggi commercializzate appartengono alla specie F. ananassa, ottoploide (2n=8x=56), che deriva da un incrocio interspecifico casualmente avvenuto nel 1766 tra due specie ottoploidi, F. chiloensis e F. virginiana. Questo incrocio ha generato un ibrido fertile con frutti molto più grossi rispetto a quelli delle due specie di origine. Numerosi studi hanno dimostrato che i frutti di F. ananassa sono dotati di elevato valore nutrizionale, soprattutto se comparati con quelli di altri fruttiferi della famiglia delle Rosacee (Tulipani et al., 2008; Carkeet et al., 2008). Sono invece ancora molto limitate le conoscenze sulle caratteristiche qualitative dei frutti delle altre specie o ibridi appartenenti al genere Fragaria. L accurata caratterizzazione genetica e fenotipica del germoplasma è la premessa indispensabile per valorizzare al meglio le potenzialità delle risorse genetiche attraverso specifiche azioni di breeding. Nell ambito del progetto Risorse Genetiche Vegetali del MiPAAF, finalizzato alla salvaguardia ed alla valorizzazione del germoplasma vegetale, il CRA-FRF ha avviato un indagine sulla composizione qualitativa dei frutti di Fragaria spp. presenti nella collezione costituita presso la propria azienda sperimentale di Magliano-Forlì, di cui vengono qui riportati i primi risultati. Materiali e metodi Lo studio è stato condotto nel 2010 su 28 accessioni (Tab.1) di Fragaria spp.. Per ogni accessione, in corrispondenza della raccolta principale, sono stati prelevati 3 campioni di frutti maturi, per un totale di 500 g. Di ogni campione sono stati rilevati singolarmente il peso ed il colore dell epidermide (coordinate colorimetriche L*, a*, b*); sul succo ottenuto da più frutti sono stati determinati il contenuto di solidi solubili (SSC), con rifrattometro digitale; l acidità titolabile (AT), con titolature automatico; l acido L-ascorbico (AA), con l RQflex Merck; il contenuto dei principali zuccheri (saccarosio, glucosio e fruttosio) e dei principali acidi organici (acido citrico, malico e quinico) mediante HPLC dotato, rispettivamente, di rilevatore IR e detector a diodi; su una ulteriore quota di frutti liofilizzati si è rilevato per via spettrofotometrica il contenuto di polifenoli totali (PHT), secondo il metodo proposto da Proteggente et al. (2002); la capacità antiossidante totale (CAT), col biosaggio descritto da Gao et al. (2000) ed il contenuto di antociani totali (ACYT) col metodo proposto da Wrolstad et al. (2005). Per ogni variabile e accessione sono stati calcolati la media e l errore standard (ES). Sui dati normalizzati è stata applicata la cluster analysis con il software SYSTAT 11. Risultati e discussione Le diverse specie e ibridi di Fragaria hanno mostrato un ampia variabilità per molte delle variabili qualitative analizzate. Il gruppo delle accessioni diploidi (F. vesca) si è contraddistinto per l elevato contenuto di SSC e di zuccheri solubili, di AT e di acidi organici, di PHT e CAT (tabb. 2 e 3). Le accessioni esaploidi di F. moschata si sono differenziate per il colore scuro dell epidermide, riportando i valori più bassi delle coordinate colorimetriche L*, a* e b*, per l elevato contenuto di antociani e zuccheri, per i bassi livelli di AT e AA. Le ottoploidi (F. ananassa e F. chiloensis F. ananassa), infine, hanno evidenziato i livelli più bassi di SSC, dei singoli zuccheri, di ACYT (risultati superiori soltanto a quelli delle diploidi cv Snovit e Yellow wonder, che avendo il frutto bianco sono prive di antociani) ed il più alto contenuto di AA. Tra i gruppi sono state riscontrate differenze di rilievo anche nella composizione percentuale dei singoli zuccheri ed acidi organici: le ottoploidi, in particolare, si sono distinte per un basso contenuto di fruttosio (44% a fronte del 52-55% degli altri due gruppi) ed elevato di saccarosio (15% rispetto al 10% delle esaploidi e 7% delle diploidi). 156

174 L acido malico, inoltre, è risultato percentualmente molto più rappresentato (23% del totale) nelle fragole ottoploidi rispetto alle altre (circa 10%), al contrario del quinico (7% contro il 16%). La cluster analysis, effettuata sui dati delle sole variabili biochimiche e di colore ha separato le accessioni di Fragaria in 3 gruppi distinti corrispondenti al livello di ploidia, suggerendo che questa influisca significativamente sulle componenti legate al gusto ed alla salubrità del frutto. Le selezioni Sel 4 e Sel 7, ibridi interspecifici a corredo cromosomico sconosciuto, si sono collocate nel raggruppamento di F. moschata, nonostante, dal punto di vista fenotipico, entrambe le selezioni mostrino caratteri comuni a F. ananassa e F.moschata. Nel raggruppamento delle diploidi (F. vesca), i genotipi rifiorenti si sono collocati in un sottogruppo distinto rispetto alle unifere (con l unica eccezione della cv Minja), suggerendo che anche questo carattere possa influenzare la composizione qualitativa dei frutti. Conclusioni Il presente studio, ancorché preliminare, ha già rivelato l esistenza di una ampia variabilità nella qualità dei frutti nel genere Fragaria. Se confermata su un più ampio numero di genotipi e per più anni, da questa variabilità il breeding potrà certamente attingere importanti informazioni per azioni più mirate al miglioramento del sapore e della salubrità delle fragole. Bibliografia BUCCI A., FAEDI W., BARUZZI G., Origine and evoluzione. In: La fragola. Bayer CropScience: CARKEET C., CLEVIDENCE B.A., NOVOTNY J.A., Anthocyanin excretion by humans increases linearly with increasing strawberry dose. The Journal of Nutrition, 138 (5): GAO, X., OHLANDER, M., TEPPSSON, N., BJORK, L., TRAJKOVSKI, V., Changes in antioxidant effects and their relationship to phytonutrients in fruits of sea buckthorn (Hippophae rhamnoides L.) during maturation. Journal of Agricultural Food Chemistry, 48 (5): WROLSTAD R.E., ACREE T.E., DECKER E.A., PENNER M.H., REID D.S., SCHWARTZ S.J., SHOEMAKER C.F., SMITH D.M., SPORNS P., Characterization and measurement of anthocyanins by UV-Visible spectroscopy. In: Handbook of food analytical chemistry, Wiley press: PROTEGGENTE R., PANNALA A. S., PAGANA G., VAN BUREN L., WAGNER E., WISEMAN S., VAN DE PUT F., DACOMBE C., RICE-EVANS C. A., The antioxidant activity of regularly consumed fruit and vegetable reflects their phenolic and vitamin C composition. Free Radical Research, 36 (2): TULIPANI S.,MEZZETTI B.,CAPOCASA F., BOMPADRE S., BEEKWILDERJ., RIC DE VOS C.H., CAPANOGLU E., BOVY A., BATTINO M., Antioxidants, phenolic compounds, and nutritional quality of different strawberry genotypes. Journal of Agricultural and Food Chemistry, 56 (3):

175 Tab.1. Elenco, pedigree e livello di ploidia delle 28 accessioni di Fragaria caratterizzate per la qualità dei frutti nel presente studio Tab.1. List, pedigree and ploidy of the 28 Fragaria accessions whose fruit quality was assessed in the present study Accessione Pedigree Ploidia Sel Sara x Alpine 2x=14 Sel Snovit x Regina delle Valli 2x=14 Sel Elba x Norrlands 2x=14 Alpine 1 Sconosciuto 2x=14 Frana di Mezzo 2 accessione autoctona 2x=14 Frana Torrente Sotto 2 accessione autoctona 2x=14 Minja Sconosciuto 2x=14 Norrlands Sconosciuto 2x=14 Regina delle Valli 1 Sconosciuto 2x=14 Sara Norrlands x Minja 2x=14 Snovit Sconosciuto 2x=14 Yellow wonder 1 Sconosciuto 2x=14 Sel Profumata di Tortona x op 6x=42 Sel Profumata di Tortona x Capron Royal 6x=42 Sel Profumata di Tortona x op 6x=42 Sel Profumata di Tortona x op 6x=42 Sel Profumata di Tortona x op 6x=42 Sel 4 Profumata di Tortona x F. ananassa incerta Sel 7 Profumata di Tortona x F. ananassa incerta Capron Royal vecchia varietà francese 6x=42 Profumata di Tortona vecchia varietà italiana 6x=42 Sel (F. chiloensis x op) x F. ananassa 8x=56 Alba Sconosciuto 8x=56 Onda (Sel x Honeoye) x Marmolada 8x=56 Unica Sel x Miss 8x=56 Zeta Sel x Miss 8x=56 Sel TN Queen Elisa x x=56 Sel Onda x Camarosa 8x=56 1 =rifiorente; 2 accessioni spontanee di F. vesca provenienti dall Appennino Tosco-Emiliano; Sel=accessioni ottenute dall attività di breeding del CRA-FRF 158

176 Tab. 2. Peso, contenuto di solidi solubili (SSC), acidità titolabile (AT), e coordinate colorimetriche L*, a*, b* dei frutti delle 28 accessioni di Fragaria raggruppate per il livello di ploidia. Tab. 2. Weight, soluble solids content (SSC), titratable acidity (AT), colour coordinates L*, a*, b* in the fruit of the 28 Fragaria accessions grouped according to their ploidy. Ploidia Peso (g) SSC (%) AT (meq/100 g pf) L* a* b* Diploide 2,2±0,4 1 10,7±0,2 12,9±0,2 36,5±0,5 41,3±0,4 22,9±0,4 Diploide 2 1,7±0,4 12,4±0,8 12,5±0,4 68,1±0,4 4,0±0,7 42,7±0,7 Esaploide 3,3±0,4 11,5±0,2 7,7±0,3 32,2±0,9 28,8±1,0 12,8±0,8 Ottoploide 29,8±0,8 7,2±0,2 9,9±0,5 41,5±1,7 37,0±1,2 23,5±0,6 Sel 4 3 5,7±0,8 8,8±0,1 8,7±0,1 37,8±0,3 39,5±0,6 21,2±0,3 Sel 7 3 4,5±0,5 10,0±0,1 8,4±0,1 34,7±0,4 30,3±0,8 14,6±0,2 1 media±errore standard; 2 accessioni con frutto bianco; 3 livello di ploidia sconosciuto Tab. 3. Contenuto dei principali zuccheri ed acidi, polifenoli totali (PHT), capacità antiossidante totale (CAT), antociani totali (ACYT) e contenuto di acido ascorbico (AA) nei frutti delle 28 accessioni di Fragaria raggruppate per il livello di ploidia. Tab. 3. Single sugars and organic acid content, total polyphenols (TPH), total antioxidant capacity (TAC), total anthocyanins (TACY) and ascorbic acid content (AA) in the fruit of the 28 Fragaria accessions grouped according to their ploidy. Ploidia Saccarosio g/100 pf Glucosio g/100 pf Fruttosio g/100 pf A.citrico g/100 pf A.malico g/100 pf A.quinico g/100 pf PHT mg/g pf CAT µmol/g pf ACYT mg/100 g pf AA mg/100 g pf Diploide 0,5±0,03 3,1±0,09 4,4±0,11 1,3±0,02 0,2±0,01 0,3±0,02 3,2±0,1 26,2±0,4 9,4±0,8 32,0±1,6 Diploide 2 0,6±0,01 3,5±0,39 5,0±0,63 1,3±0,08 0,2±0,01 0,3±0,07 2,6±0,2 22,3±0,6 0,2±0,1 28,5±1,0 Esaploide 1,0±0,18 3,8±0,13 5,2±0,15 0,9±0,06 0,1±0,01 0,2±0,02 2,1±0,1 20,4±0,7 13,0±1,2 19,2±0,8 Ottoploide 0,7±0,11 2,0±0,09 2,0±0,12 0,9±0,05 0,3±0,03 0,1±0,01 2,1±0,2 12,6±0,9 7,1±0,8 42,0±1,7 Sel 4 3 0,4±0,01 3,0±0,04 4,1±0,04 0,6±0,06 0,3±0,04 0,1±0,02 1,6±0,2 14,4±0,3 18,7±5,7 11,2±0,7 Sel 7 3 0,5±0,01 3,3±0,18 4,6±0,21 1,0±0,01 0,1±0,01 0,2±0,01 2,5±0,2 24,9±0,4 5,3±0,6 28,0±2,3 1 media±errore standard; 2 accessioni con frutto bianco; 3 livello di ploidia sconosciuto 159

177 * = varietà/selezione rifiorente Fig. 1. Raggruppamento delle 28 accessioni di Fragaria sulla base della similarità (algoritmo di Ward) dei caratteri rilevati. Fig. 1. Dendrogram of 28 strawberry accessions grouped according to the similarity (Ward s algorithm) of their fruit traits. 160

178 2.24. BETALAINE E ATTIVITÀ ANTIOSSIDANTE IN OPUNTIA TUNA E CONFRONTI CON OPUNTIA FICUS-INDICA BETALAIN AND ANTIOXIDANT ACTIVITY IN OPUNTIA TUNA AND COMPARISONS WITH OPUNTIA FICUS-INDICA Carmine NEGRO, Alessio APRILE, Erika SABELLA, Luigi DE BELLIS, Antonio MICELI 1 Università del Salento, Dipartimento di Scienze e Tecnologie Biologiche ed Ambientali, Via Prov.le Lecce - Monteroni, Lecce, Italy Riassunto L Opuntia tuna (L.) Miller è una piante morfologicamente e fisiologicamente molto vicina alla specie coltivata Opuntia ficus-indica (L.) Miller. A differenza del comune fico d india, l Opuntia tuna presenta un ampia variabilità fenotipica evidenziabile nella struttura dei cladodi e nelle dimensioni e composizioni dei frutti. In Italia la distribuzione di Opuntia tuna è limitata al sud Italia e la coltivazione ha uno scopo puramente ornamentale. Tuttavia, in Messico, centro di origine del genere Opuntia, queste piante sono molto apprezzate, sia per i frutti che per i cladodi. Recentemente gli interessi scientifici sul genere Opuntia sono notevolmente aumentati a seguito di scoperte che hanno evidenziato un loro possibile ruolo nella riduzione dei livelli di colesterolo totale nel sangue (Wolfram et al., 2003). I fichi d india rientrano tra le specie vegetali contenenti betalaine. In questo lavoro sono state prese in considerazione due specie di fico d india (O.ficus-indica e O.tuna) e confrontati tra loro cinque campioni caratterizzati da differenti livelli di colorazione viola dei frutti. Estratti contenenti i metaboliti secondari in fase acquosa sono stati analizzati mediante sistema HPLC/DAD/MS che ha consentito di rilevare la presenza di betanina e di isobetanina e di quantificarne il contenuto. Il quantitativo di betanina ritrovato nei diversi campioni varia sino a 0,84 g/kg peso fresco, mentre quello di betalaine totali sino a 1,85 g/kg peso fresco; campioni con colorazione gialla della polpa sono risultati privi di tali molecole, mentre i campioni viola hanno mostrato elevate concentrazioni. Sono stati valutati il contenuto fenolico negli estratti, così come l attività antiossidante. I risultati hanno evidenziato che il potere antiossidante dei campioni sembra dipendere dalla somma di fenoli e betalaine; è stata messa in evidenza una corrispondenza diretta tra attività antiossidante e componente fenolica, mentre è assente una correlazione diretta tra attività antiossidante e contenuto in betalaine totali e betanine. Parole chiave: Opuntia, attività antiossidante, betalaine, HPLC/MS Abstract Elephantear pricklypear (Opuntia tuna (L.) Miller) plants are morphologically and physiologically very close to the widely cultivated Opuntia ficus-indica (L.) Miller. In Italy, its distribution is limited to Southern Italy and the cultivation has a merely decorative purpose. However, in Mexico, its center of origin, they are appreciated both for fruit as for cladods. Recently the scientific interests on Opuntia have greatly increased since evidences in reducing blood lipid and total cholesterol (Wolfram et al., 2003). 161

179 In this work two species of prickly pear (O.ficus-indica and O.tuna) were compared. Extracts containing the secondary metabolites were analyzed by HPLC/DAD/MS system allowing to measure betanin and isobetanin contents. The highest betanin value among samples was 0.84 g / kg fresh weight, while highest betacyanin value was 1.85 g / kg fresh weight. Phenolic contents were quantified as well as antioxidant activity. The results showed that the antioxidant activity is correlated with phenol and betalain amount; moreover it was highlighted a direct correlation between antioxidant activity and phenolic compounds, while no direct correlation between antioxidant activity and total content of betacyanins and betanin was reported. Keywords: Opuntia, Antioxidant activity, betalain, Liquid Chromatography-Mass Spectrometry Introduzione Le betalaine sono pigmenti vegetali prodotti da un ristretto numero di specie vegetali che non producono antocianine ed hanno sviluppato vie biosintetiche alternative per la produzione di sostanze in grado di imprimere colorazioni viola a frutti, fiori e porzioni di pianta. Molte piante dell ordine delle Caryophyllales hanno la capacità di accumulare betalaine, così come le piante del genere Opuntia oggetto di questo studio. Le betalaine sono pigmenti idrosolubili contenenti azoto, localizzate nei vacuoli, e presentano un forte potere riducente, proteggendo le piante dal danno ossidativo. Le betalaine sono state isolate per la prima volta dalla barbabietola rossa, Beta vulgaris L., da cui deriva il nome (Castellanos-Santiago e Yahia, 2008). Le betalaine nelle piante svolgono un ruolo attrattivo per gli animali pronubi, agiscono contro le specie reattive dell ossigeno (ROS), proteggono le parti ferite, intervengono in presenza di infezioni fungine e possono anche proteggere dai dannosi raggi UV-B (Xiao- Hong, et al., 2009). Negli ultimi anni diversi studi hanno cercato di fare chiarezza sulla composizione della via biosintetica delle betalaine; si è scoperto che possono esserci due percorsi differenti, caratterizzati da due diverse molecole di partenza: tirosina e tiramina. La sintesi delle betalaine prevede il coinvolgimento di numerosi enzimi che non sono ancora stati totalmente caratterizzati, ma pare siano condizionati dai cambiamenti di luce e dalla presenza di citochinine (Hinz et al., 1997). La classificazione delle betalaine dipende dal colore dei pigmenti: le betacianine che sono rosso-viola (comprendono quattro sottogruppi tra cui le betanine e amarantine) e le betaxantine che sono giallo-arancio (comprendono tre sottogruppi). A livello commerciale le betalaine destano grande interesse poiché possono costituire coloranti alimentari naturali (per conferire al cibo un migliore aspetto evitando l utilizzo di coloranti sintetici), ed essere usati come additivi alimentari. Grazie alle loro proprietà antiossidanti possono svolgere un ruolo attivo contro l insorgenza di patologie degenerative e disturbi legati allo stress ossidativo. Lo stress ossidativo porta modificazioni biochimiche che possono causare malattie degenerative, cardiopatie ed alcune forme di cancro. Studi recenti hanno dimostrato i benefici che questi pigmenti possono avere sulla salute umana (Azaredo, 2006). Le betalaine vengono assorbite nell intestino umano e successivamente arrivano nel circolo sanguigno dove si trovano incorporate nelle lipoproteine LDL e nelle membrane cellulari dei globuli rossi; LDL e globuli rossi arricchiti di betalaine risultano, rispettivamente, più resistenti all ossidazione e meno sensibili all emolisi. In Messico vengono utilizzate come trattamento per la tosse, come antivirale e antimicrobico. 162

180 Lo scopo di questo lavoro è la caratterizzazione biochimica di diversi campioni di fico d india e valutarne la qualità sulla base della quantità in fenoli, betalaine e attività antiossidante. Materiali e metodi Materiale vegetale - Il materiale vegetale utilizzato è costituito da 3 campioni di acrosarchi di Opuntia tuna (L.) Miller e 2 campioni di Opuntia ficus-indica (L.) Mill, provenienti dall Orto Botanico dell Università del Salento e campionati nel 2010, nel mese di ottobre. In particolare i tre campioni di Opuntia tuna presentavano una polpa con diverse gradazioni del colore viola (nominati in seguito Campione 1, 2, 3), un campione di Opuntia ficus-indica aveva anch esso polpa di colore viola (Campione 4), mentre un campione di Opuntia ficus-indica aveva polpa di colore bianco-verde (Campione 5). Estrazione betalaine e sostanze ad attività antiossidante - I campioni di acrosarchi di Opuntia sono stati prelevati dal sito ed immediatamente congelati ad una temperatura di -20 C, dopo rapido congelamento in azoto liquido. 25 g di polpa sono stati opportunamente omogeneizzati in 50 ml di metanolo freddo acidulato allo 0,1%, successivamente evaporato a pressione ridotta a freddo ed il contenuto risospeso in acqua acidulata. Analisi lc/ms su estratti di polpa di fichi d india - L analisi di spettrometria di massa accoppiata alla cromatografia liquida è stata realizzata seguendo il protocollo descritto da Castellanos-Santiago e Yahia (2008). Determinazione delle sostanze fenoliche totali - La determinazione delle sostanze fenoliche totali è stata condotta tramite metodo di Folin-Ciocalteau. Questo metodo si basa sulla reazione redox che si instaura tra i composti fenolici ed il complesso formato dagli acidi fosfotungstenico e fosfomolibdico. A 0,5 ml di campione diluito 1:10, si aggiungono 2,5 ml di acqua, 0,5 ml di reattivo di Folin e si agita per 4 minuti. Successivamente si aggiungono 2 ml di Na 2 CO 3 e 4,5 ml di acqua. Dopo 60 minuti si effettua una lettura allo spettrofotometro ad una lunghezza d onda di 765nm. La quantificazione è effettuata utilizzando la curva di taratura dell acido gallico ed i risultati sono espressi in acido gallico equivalenti (GAE). Determinazione attività antiossidante con metodo orac (Oxygen Radical Absorbance Capacity) - Per la determinazione dell attività antiossidante sono state eseguite analisi in coerenza con il protocollo descritto da Ou et al. (2001) Risultati e discussione Analisi hplc/ms degli estratti di O. tuna e O. ficus-indica - La caratterizzazione biochimica dei composti presenti in O. tuna ed O. ficus-indica è stata condotta mediante HPLC/MS ed ha consentito di identificare le betalaine contenute negli estratti e, utilizzando la retta di taratura per la betanina, di quantificarne i livelli nei vari campioni. In Fig. 1 è riportato il profilo UV a 540 nm relativo ad un campione di Opuntia tuna caratterizzato da frutti con polpa viola. La quantificazione dei contenuti in betalaine ha evidenziato una certa variabilità nei campioni di Opuntia tuna con valori compresi tra 0,33 (Campione 3), 0,56 (Campione 2) e 1,85 g/kg di polpa fresca (Campione 3). Il campione viola di Opuntia ficus-indica (Campione 4) contiene 0,54 g/kg, mentre quello bianco-verde (Campione 5) non contiene betalaine (Tab. 1). I valori sono stati calcolati utilizzando come standard la molecola betanina. Tali risultati sono simili a quanto riportato da Stintzing e collaboratori, che, nel 2005, hanno evidenziato che i frutti viola posseggono il maggior contenuto in betalaine, mentre è minore nei frutti rossi e arancio e quasi nullo nei frutti verdi. Inoltre, i valori di betanine riscontrati nei frutti di fico d india sono simili e in un caso addirittura superiori a quelli ritrovati da Gasztonyi e collaboratori (2001) su campioni di diverse varietà di barbabietole rosse (Beta vulgaris L.), specie da cui 163

181 normalmente si estraggono per scopi commerciali queste sostanze. I valori ritrovati da Gasztonyi et al. nelle barbabietole rosse sono pari a circa 0,40-0,50 g/kg. I frutti di O. tuna possono rappresentare quindi una valida alternativa alla barbabietola rossa come fonte primaria di betanina. Fenoli totali in estratti di polpa di fichi d India - L estratto grezzo ottenuto dalla polpa di fico d india è stato anche analizzato mediante metodo di Folin-Ciocalteau per quantificare il contenuto di fenoli totali. Il quantitativo di sostanze fenoliche totali è molto variabile nei 5 campioni analizzati, ed oscillano tra un valore di 0,531 g/kg di estratto di polpa nel campione di Opuntia ficus-indica di colore bianco-verde (Campione 5), sino ad un valore 1,265 g/kg nel Campione 2 (Tab. 1). In generale i valori riscontrati sono in linea con la letteratura (Stintzing et al., 2005), sebbene il campione 2 abbia evidenziato un quantitativo significativamente superiore. Attività antiossidante - I risultati mostrano che l attività antiossidante è compresa tra 8000 e µmol di trolox equivalenti per kg di polpa rispettivamente per il campione 5 e il campione 2 (Tab. 1). Tali risultati sono in accordo con quanto riportato da Stintzing (2005) per alcune varietà di fico d india cresciute in Salinas, California, USA. L attività antiossidante non sembra correlata al contenuto di betalaine come dimostra il basso valore di regressione ottenuto (R 2 = 0,37) tra i dati dell attività antiossidante e quelli del contenuto in betanine. È stata osservata, invece, correlazione tra i contenuti in sostanze fenoliche ed attività antiossidante (R 2 = 0,84). L attività antiossidante osservata è il risultato, quindi, di un effetto sinergico dovuto alla presenza di più classi di composti biologicamente attivi (fenoli) e non di una singola classe (betalaine). Conclusioni L analisi LC/MS effettuata sui frutti di fico d india ha consentito di identificare la presenza di betalaine presenti nei 5 campioni, in particolar modo la presenza di betanina e isobetanina. Tramite quest analisi è stato possibile quantificare il contenuto di betanina e delle betalaine totali all interno dei diversi campioni. Nel campione 1, caratterizzato da un intenso colore viola, è stato ritrovato un quantitativo di betalaine totali pari a 1,85 g/kg. Quantità minori di betalaine totali si ritrovano negli altri campioni; in particolar modo un valore relativamente basso si ritrova nel campione 3, colorato di rosso, dove il contenuto di betalaine totali è di 0,33 g/kg. Il campione 5, di colore giallo, è totalmente privo di betalaine. Si è visto dunque che il quantitativo di betalaine totali è maggiore in frutti colorati di viola. Attraverso il metodo Folin-Ciocalteau è stato quantificato il contenuto fenolico dei 5 campioni, con valori che variano da 0,531 a 1,265 g/kg di estratto di polpa, dove il valore più basso lo si ritrova nel campione 3, mentre il valore più alto è stato ritrovato nel campione 2. L attività antiossidante, effettuata col metodo ORAC, varia tra 8000 e µmol Trolox equivalenti/kg di polpa. La migliore attività antiossidante è data dal campione 2, mentre il campione 5 è quello che ha presentato minore potere antiossidante. Questi risultati dipendono anche dal quantitativo di betalaine presenti nel campione ma non esclusivamente: infatti, il campione 5 privo di tali molecole mostra attività antiossidante inferiore rispetto agli altri campioni ma rimane comunque una attività notevole dovuta alla presenza di altre molecole, mentre il campione 2 colorato di viola presenta maggiore potere antiossidante nonostante un valore relativamente basso di betalaine totali. Da questi risultati si può dedurre che non esiste una corrispondenza diretta tra la quantità di betalaine e attività antiossidante, come evidenziato dal basso valore del coefficiente di correlazione (R 2 = 0,37) tra l attività 164

182 antiossidante e il quantitativo di betalaine totali. Esiste invece una buona correlazione (R 2 = 0,84) tra quantità di fenoli totali e attività antiossidante. I dati riportati in questo lavoro ci consentono di affermare che l assunzione dei frutti di fico d india può portare notevoli benefici alla salute, poiché grazie al loro potere antiossidante possono svolgere azioni di prevenzione verso numerose patologie gravi dovute dalla liberazione dei radicali liberi. Inoltre, questi frutti se utilizzati come fonte primaria di coloranti naturali per prodotti alimentari a livello commerciale, possono rappresentare una importante alternativa a sostanze di sintesi, potenzialmente pericolose per l uomo. Bibliografia AZEREDO H.M.C., 2006, Betalains: properties, sources, applications, and stability-a review. International Journal of Food and Technology, 44, CASTELLANOS-SANTIAGO E., YAHIA E.M., 2008; Identification and qualification of Betalains from the fruit oh 10 Mexican Prickly Pear Cultivars by High-Performance Liquid Chromatography and Electrospray Ionization Mass Spectrometry. Journal of Agricultural and Food Chemistry, 56: GASZTONYI M. N., DAOOD H., HÁJOS M.T., BIACS P., 2001, Comparison of red beet (Beta vulgaris var. conditiva) varieties on the basis of their pigment components. Journal of the Science of Food and Agriculture, 81: HINZ U.G., FIVAZ J., GIROD P.A., ZYRD J.P., The gene coding for the DOPA dioxygenase involved in betalain biosynthesis in Amanita muscaria and its regulation. Molecular Genetics and Genomics, 256: 1-6. OU B., HAMPSCH-WOODILL M., PRIOR R.L., 2001, Development and validation of an improved oxygen radical absorbance capacity assay using fluorescein as the fluorescent probe. Journal of agricultural and food chemistry, 49, STINTZING F.C., HERBACH K.M., MOSSHAMMER M.R., CARLE R., YI W., SELLAPPAN S., AKON C.C., BUNCH R., FELKER P., 2005, Color, betalain pattern, and antioxidant properties of cactus pear (Opuntia spp) clones. Journal of Agricultural and Food Chemistry, 53, XIAO-HONG H., ZHAO-JIAN G., XING-GUO X., 2009, Enzymes and genes involved in the betalain biosinthesis in higher plants. African Journal of Biotechnology, 8 (24): WOLFRAM R., BUDINSKY A., EFTHIMIOU Y., STOMATOPOULOS J., OGUOGHO A., SINZINGER H. 2003; Daily prickly pear consumption improves platelet function. Prostaglandins, Leukotrienes and Essential Fatty Acids, 69:

183 Tab. 1. Valori dei contenuti in betalaine, sostanze fenoliche e attività antiossidante relative ai cinque campioni di O. tuna e O. ficus-indica. I valori sono espressi in g per kg di polpa per le colonne relative al contenuto in betalaine ed in sostanze fenoliche totali. L attività antiossidante è espressa in µmol di trolox equivalenti per kg di polpa fresca. Tab. 1. Betalain, phenolic compounds and antioxidant activity of five samples of O. tuna and O. ficusindica. Values are reported as gram per kg of fresh weight in total phenolic and betalain columns. The antioxidant activity is reported as µmol of Trolox equivalent per kg of fresh pulp. Campione Betalaine totali (betanin, g/kg) Sostanze fenoliche totali (GAE, g/kg) Attività antiossidante (µmol Trolox equivalenti/kg) 1 1,85 ± 0,21 0,690 ± 0, ± ,56 ± 0,12 1,265 ± 0, ± ,33 ± 0,09 0,531 ± 0, ± ,54 ± 0,22 0,733 ± 0, ± ,00 ± 0,00 0,533 ± 0, ±

184 Betanina Isobetanina Fig. 1. Cromatogramma UV/vis registrato a 540 nm di O.tuna (campione 1). Fig nm UV/vis Chromatogram relative to O.tuna sample

185 2.25. INFLUENZA DI ALCUNE TECNOLOGIE ENOLOGICHE SULLA COMPONENTE VOLATILE DI VINI BIANCHI DELLA REGIONE PUGLIA INFLUENCE OF WINEMAKING TECHNIQUES ON VOLATILE COMPOUNDS OF APULIAN WHITE WINES Sandra PATI 1, Domenico LA NOTTE 1, Maria Lisa CLODOVEO 2, Mariagiovanna FRAGASSO 1, Barbara LA GATTA 1, Donato ANTONACCI 3 1 Bioagromed: Istituto per la ricerca e le applicazioni biotecnologiche per la sicurezza e la valorizzazione dei prodotti tipici e di qualità Università di Foggia, via Napoli 25, Foggia, Italia (Food Quality and Health Research Center, University of Foggia) 2 DISAAT- Dipartimento di Scienze Agro-Ambientali e Territoriali, Università degli Studi di Bari, Via Amendola 165/A, Bari, Italia (Department of Engineering and management of the agricultural, livestock and forest systems, University of Bari) 3 CRA-UTV, Unità di ricerca per l uva da tavola e la vitivinicoltura in ambiente mediterraneo (Turi BA) Via Casamassima, Turi, Italia (CRA-UTV, Research Unit for table grape and wine growing and wine producing in Mediterranean environment) Riassunto Importanti innovazioni nelle tecniche di vinificazione in bianco hanno come obiettivo la produzione di vini con esaltate caratteristiche qualitative, in particolare dai tratti aromatici più spiccati. In questa nota è stata studiata l influenza sui componenti volatili di vini da uve Falanghina, Bombino Bianco, Trebbiano e Fiano, coltivate nella Regione Puglia, prodotti mediante macerazione pre-fermentativa a freddo del pigia-diraspato, e mediante fermentazione in ambiente ridotto per aggiunta di glutatione. La macerazione pre-fermentativa a freddo ha favorito un maggior arricchimento in sostanze volatili del vino da uva Falanghina, per una maggiore presenza di alcoli e di esteri. Nella frazione volatile libera dei vini da Bombino Bianco la criomacerazione ha permesso una maggiore estrazione dei composti varietali a 6 atomi di carbonio a note erbacee (1-esanolo, cis e trans 3-esen-1-olo). Le note fruttate hanno partecipato in modo significativo al profilo aromatico dei vini Trebbiano e tale aroma è stato apportato essenzialmente dagli esteri etilici degli acidi grassi a media e corta catena e da alcuni acetati, prodotti durante la fermentazione alcolica. La criomacerazione non ha incrementato la formazione di composti volatili, mentre la vinificazione con aggiunta di glutatione ha favorito una maggiore produzione di esteri, in particolare del decanoato di etile e dell etil-idrogeno succinato. Infine, l impiego del ghiaccio secco nel Fiano ha comportato una maggiore presenza di composti volatili, in particolare terpeni, rispetto al testimone e a quello ottenuto con aggiunta di glutatione. Parole chiave: vini bianchi, tecnologie di vinificazione, composti volatili Abstract Important innovations in white winemaking are aimed to the production of wines with enhanced quality, in particular with improved aroma characteristics. The influence of cold pre-fermentative maceration and of glutathione addition on volatile compounds of Apulian Falanghina, Bombino Bianco, Trebbiano and Fiano wines was reported in this study. The use of dry ice caused an enrichment of volatile compounds in Falanghina wine, due to alcohols and esters. Moreover, the cold pre-fermentative maceration allowed an enhanced 168

186 extraction of herbaceous C6 compounds (1-hexanol, cis and trans 3-hexen-1-ol) in Bombino Bianco wines. Fruity notes significantly contributed to the aroma profile of Trebbiano wines due to acetates and ethyl esters of medium and short chain fatty acids produced during alcoholic fermentation. The cold pre-fermentative maceration did not increase the formation of volatile compounds, whereas vinification by glutathione addition caused a major production of esters, particularly ethyl decanoate and ethyl hydrogen succinate. Finally, the use of dry ice for Fiano winemaking allowed a major presence of terpenes with respect to both the traditional and reductive vinification. Keywords: white wines, winemaking technologies, volatile compounds Introduzione L aroma dei vini mostra un profilo chimico estremamente complesso, sia dal punto di vista qualitativo che quantitativo. Diverse centinaia di composti aromatici sono stati identificati con concentrazioni che variano tra le centinaia di mg/l ai ng/l; inoltre sono coinvolte diverse classi di composti, che comprendono idrocarburi, alcoli, esteri, aldeidi, chetoni, acidi, eteri, lattoni, composti solforati e azotati. Diverse tecnologie di vinificazione, tra le quali la criomacerazione pre-fermentativa del pigiadiraspato con ghiaccio secco e la fermentazione in ambiente ridotto per aggiunta di glutatione, sono state proposte per favorire il potenziamento e la protezione della componente volatile. La macerazione a freddo delle bucce nella fase prefermentativa ottenuta mediante aggiunta di ghiaccio secco comporta infatti una maggiore estrazione di composti volatili e loro precursori, e la loro protezione per l azione inibente della bassa temperatura sulle reazioni di ossidazione dei componenti estratti (Álvarez et al., 2006). Per quanto riguarda l utilizzo di glutatione in vinificazione, i suoi effetti inibitori nei confronti del naturale decremento di alcuni composti volatili durante la conservazione del vino sono stati riportati da Papadopoulou e Roussis (2001), dimostrando la capacità del glutatione di proteggere l aroma dai processi ossidativi. Nel presente lavoro, è stata studiata la componente volatile di vini bianchi prodotti da uve di importanti cultivar, coltivate nella Regione Puglia, utilizzando tecnologie di vinificazione mediante criomacerazione pre-fermentativa e ambiente di iper-riduzione al fine di realizzare vini con miglioramenti nelle caratteristiche qualitative. Materiali e metodi Uve Falanghina, Bombino Bianco, Trebbiano e Fiano (100 Kg), dell Alto Tavoliere-FG, sono state sottoposte a vinificazione con macerazione prefermentativa a freddo, mediante ghiaccio secco, e a vinificazione in ambiente ridotto, mediante aggiunta di glutatione, in impianto pilota. Le uve controllo sono state vinificate con tecnologia di vinificazione in bianco. Dopo diraspapigiatura delle uve e sgrondatura del pigiato, il mosto è stato chiarificato a 8-10 C per 12 ore, previa addizione di 5g/hL di metabisolfito di potassio, e posto a fermentare, alla temperatura di 18 C, dopo ulteriore aggiunta di 5g/hL di metabisolfito di potassio, 15g/hL di lievito secco attivo opportunamente attivato (Saccharomices Cerevisiae), e 25 g/hl di attivatore di lievito (AEB Group SpA, Bologna). Al termine della fermentazione lenta e successivo deposito delle fecce, il vino è stato sottoposto a successivi travasi fino all illimpidimento completo, ed imbottigliato. 169

187 Per le vinificazioni con tecnologie differenti si è proceduto a modifiche rispetto al precedente protocollo, come di seguito indicato: - la macerazione prefermentativa a freddo è stata realizzata addizionando direttamente al pigiato anidride carbonica in forma solida (12 kg/q di pigiato) fino a raggiungere la temperatura di 5 C. Il pigiato è stato mantenuto a tale temperatura per circa 16 ore. - la vinificazione in ambiente ridotto è stata effettuata mediante aggiunta sul pigiato di 5g/hL di glutatione (AEB) e 20g/hL di un preparato a base di potassio pirosolfato, acido ascorbico e tannino puro (Fermoplus Energy Glu, AEB). La frazione volatile libera dei vini (3 repliche) è stata determinata mediante estrazione in fase solida e successiva analisi GC/MS (Piñeiro et al., 2004), dopo 6 mesi di conservazione. I componenti volatili sono stati identificati mediante confronto degli spettri sperimentali con quelli riportati nella libreria NIST02 e con quelli ottenuti iniettando standard puri. L analisi quantitativa dei componenti volatili è stata eseguita mediante allestimento di rette di taratura. Il range di concentrazione considerato per la retta di calibrazione di ciascuna molecola includeva i valori tipicamente riscontrati nei vini. I valori di R 2 ottenuti sono risultati superiori a I dati sperimentali sono stati sottoposti all'analisi della varianza ad una via (ANOVA, test di Duncan) attraverso il software STATISTICA 6.0, con l'obiettivo di evidenziare le differenze statisticamente significative. Risultati e discussione I componenti volatili derivanti dalla fermentazione alcolica, quali alcoli, esteri etilici, acetati e acidi grassi, costituiscono la frazione volatile principale dei vini analizzati. Le note fruttate tipiche del profilo aromatico dei vini bianchi sono essenzialmente dovute agli esteri etilici degli acidi grassi a media e corta catena e ad alcuni acetati, prodotti durante la fermentazione alcolica. La macerazione prefermentativa a freddo si è dimostrata efficace per l esaltazione della componente volatile dei vini Falanghina e Fiano, come evidenziato nel grafico 1a,c. I vini Falanghina ottenuti con questa tecnologia infatti hanno evidenziato una maggiore concentrazione di alcoli (22,8% rispetto al test) ed esteri (43,7% rispetto al test). Tra gli alcoli i principali sono stati l 1-butanolo, l 1-propanolo, gli alcoli isoamilici e il feniletilalcol, questi ultimi due largamente superiori alle proprie concentrazioni soglia; tra gli esteri, il butanoato, l esilacetato, l ottanoato e il decanoato di etile, con odori piacevoli di cera e di miele, sono risultati presenti in concentrazioni superiori alle rispettive soglie di percezione olfattiva. Tale risultato è confermato da quanto riportato da Selli et al. (2004) dove la macerazione prefermentativa a freddo ha permesso una migliore estrazione di terpeni ed esteri etilici, con conseguente aumento delle note floreali e fruttate nel corrispondente vino. Nei vini Fiano ottenuti dalla macerazione prefermentativa a freddo i risultati ottenuti hanno confermato le note potenzialità aromatiche delle uve. Infatti, oltre ad un incremento del 32,4% di esteri (esanoato, lattato, ottanoato e decanoato di etile) e del 6,7% di alcol, è stato osservato un incremento pari al 40,2 % di composti varietali, in particolare terpeni (citronellolo, linalolo, α-terpineolo, nerolo e geraniolo) ed alcoli a 6 atomi di carbonio (1-esanolo, cis e trans 3-esen-1-olo). Ciò è confermato da quanto riportato da Esti and Tamborra (2006) sull influenza di questa pratica enologica nell aumentare considerevolmente i precursori d aroma. Inoltre, si è evidenziato un incremento degli acidi grassi, i quali nonostante sia noto apportino note sgradevoli descritte come formaggio e/o rancido, sono ritenuti essere correlati positivamente alla qualità dei vini (Marais e Pool, 1980) in quanto correlati al contenuto in esteri etilici. La criomacerazione ne ha comportato un maggior contenuto, soprattutto dell acido decanoico. Per quanto riguarda i vini Bombino Bianco e Trebbiano ottenuti con 170

188 criomacerazione, i primi non hanno evidenziato variazioni significative nel profilo volatile (+6,1%), mentre i secondi hanno mostrato un leggero decremento degli stessi rispetto al test (- 14,8%). Questi ultimi due vini hanno evidenziato miglioramenti per quanto riguarda il contenuto di alcuni esteri etilici e acetati e acidi grassi quando prodotti in ambiente ridotto mediante glutatione. Tali incrementi però non hanno comportato complessivamente un aumento del contenuto totale di acidi, esteri ed alcoli (Fig. 1b, 1d) per i vini dei due vitigni. In particolare il Bombino ha evidenziato un aumento del contenuto di isoamilacetato e 2- feniletilacetato. Interessanti sono stati i dati relativi ad alcuni composti varietali dalle note erbacee, quali gli alcoli a 6 atomi di carbonio (1-esanolo, cis e trans 3-esen-1-olo), determinati in quantità di poco inferiori alle proprie soglie di percezione. Per il Trebbiano, è stato osservato un incremento degli acidi e degli esteri butanoato di etile, isoamil acetato, decanoato di etile ed etil idrogeno succinato con concentrazioni superiori alle rispettive soglie di percezione. Nel caso del Fiano e Falanghina, i vini quando prodotti in ambiente ridotto mediante glutatione non hanno evidenziato differenze significative rispetto al test, ad eccezione di un decremento degli alcoli verificato per i vini Fiano (- 12,1%). Conclusioni La criomacerazione ha favorito un maggior arricchimento in sostanze volatili nei vini Falanghina e Fiano, mentre i vini Trebbiano hanno mostrato un leggero decremento ed i vini Bombino Bianco non hanno evidenziato variazioni significative. Per quanto riguarda l effetto dell aggiunta di glutatione i vini delle quattro cultivar studiate non hanno evidenziato differenze significative nel contenuto totale di acidi, esteri ed alcoli rispetto al test, anche se è stato osservata una maggiore formazione di alcuni esteri per i vini Bombino bianco e Trebbiano. L impiego di questo antiossidante naturale dell uva, e quindi anche il suo incremento può contribuire a diminuire le dosi di antiossidanti aggiunti, come l anidride solforosa, utilizzata nella normale pratica di cantina. Ringraziamenti La ricerca è stata finanziata dal Ministero dell Economia e delle Finanze, Ministero dell Istruzione, dell Università e della Ricerca Scientifica e Tecnologica e l Assessorato Bilancio e Programmazione Regione Puglia dal programma Accordo di Programma Quadro in Materia di Ricerca Scientifica della Regione Puglia - Progetto Strategico PS 042 dal titolo Miglioramento e valorizzazione dell espressione varietale della produzione enologica della Puglia. Bibliografia ÁLVAREZ I., ALEIXANDRE J.L., GARCIA M.J., LIZAMA V., Impact of prefermentative maceration on the phenolic and volatile compounds in Monastrell red wines. Analytica Chimica Acta, 563: ESTI M., TAMBORRA P., Influence of winemaking techniques on aroma precursors. Analytica Chimica Acta, 563: PAPADOPOULOU D., ROUSSIS I.G., Inhibition of the decline of linalool and a- terpineol in Muscat wines by glutathione and N-acetyl-cysteine. Italian Journal of Food Science, 4: PIÑEIRO Z., PALMA M., BARROSO C.G., Determination of terpenoids in wines by solid phase extraction and gas chromatography. Analytica Chimica Acta, 513: SELLI S., CABAROGLU T., CANBAS A., ERTEN H., NURGEL C., LEPOUTRE J.P., 171

189 GUNATA Z Volatile composition of red wine from cv. Kalecik Karasi grown in central Anatolia. Food Chemistry, 85: a) b) Altri Acidi Esteri Alcoli test ghiaccio secco glutatione Altri Acidi Esteri Alcoli test ghiaccio secco glutatione Altri Acidi Esteri Alcoli Terpeni Altri Acidi Esteri Alcoli test ghiaccio secco glutatione test ghiaccio secco glutatione Fig. 1a-c. Composti volatili determinati nei vini Falanghina (a), Bombino Bianco (b), Fiano (c) e Trebbiano (d) ottenuti con diverse tecnologie di vinificazione. Fig. 1a-c. Volatile compounds determined in Falanghina (a), Bombino Bianco (b), Fiano (c) and Trebbiano (d) wines obtained by different winemaking technologies. 172

190 2.26. INFLUENZA DI ALCUNE TECNOLOGIE ENOLOGICHE SULLA COMPONENTE VOLATILE DI VINI ROSSI DELLA REGIONE PUGLIA INFLUENCE OF WINEMAKING TECHNIQUES ON VOLATILE COMPOUNDS OF APULIAN RED WINES Sandra PATI 1, Domenico LA NOTTE 1, Maria Lisa CLODOVEO 2, Mariagiovanna FRAGASSO 1, Barbara LA GATTA 1, Antonio COLETTA 3 1 Bioagromed: Istituto per la ricerca e le applicazioni biotecnologiche per la sicurezza e la valorizzazione dei prodotti tipici e di qualità Università di Foggia, via Napoli 25, Foggia, Italia (Food Quality and Health Research Center, University of Foggia) 2 DISAAT- Dipartimento di Scienze Agro-Ambientali e Territoriali, Università degli Studi di Bari, Via Amendola 165/A, Bari, Italia (Department of Engineering and management of the agricultural, livestock and forest systems, University of Bari) 3 CRA-UTV, Unità di ricerca per l uva da tavola e la vitivinicoltura in ambiente mediterraneo (Turi BA) Via Casamassima, Turi, Italia (CRA-UTV, Research Unit for table grape and wine growing and wine producing in Mediterranean environment) Riassunto Le tecnologie di vinificazione influenzano l estrazione e l evoluzione dei composti fenolici e volatili, incidendo di conseguenza sulle caratteristiche qualitative dei vini. È stata studiata l influenza di diverse variabili tecnologiche (macerazione pre-fermentativa a freddo del pigiadiraspato, utilizzo di coadiuvanti tannici, prolungamento dei tempi di macerazione), sulla vinificazione di uve Aglianico, Uva di Troia, e Montepulciano, coltivate nella Regione Puglia. In questa nota sono riportati i principali risultati evidenziati dallo studio dei componenti volatili rilevati nei vini prodotti con i diversi sistemi di vinificazione. Sono stati determinati numerosi composti, quali alcoli, acidi, esteri, aldeidi, chetoni, fenoli volatili che costituiscono la frazione volatile preponderante del flavour di vini giovani, svolgendo un ruolo primario nella definizione delle tipiche note fruttate. Per tutti i vini oggetto di studio, in particolare per quello ottenuto da Uva di Troia, la tecnologia di vinificazione che ha permesso di ottenere i migliori risultati sui componenti volatili è stata la macerazione pre-fermentativa a freddo, effettuata con l utilizzo di ghiaccio secco, che ha determinato un significativo aumento di alcoli ed esteri, con concentrazioni superiori alle soglie di percezione olfattiva. Parole chiave: vini rossi, tecnologie di vinificazione, composti volatili Abstract Winemaking techniques are well-known to influence extraction and evolution of phenolics and volatile compounds, affecting in turn on the wine quality. The influence of several technological variables (cold pre-fermentative maceration, addition of tannins, long maceration) on the vinification of Apulian Aglianico, Uva di Troia, and Montepulciano grapes was studied. The main results regarding volatile compounds as affected by the several vinification parameters were here reported. Numerous compounds were determined, including alcohols, acids, esters, aldehydes, ketones, volatile phenols, which constitute the main components of flavour of young wines contributing with typical fruity notes. For all wines, especially the one obtained from Uva di Troia, cold 173

191 pre-fermentative maceration with the use of dry ice was the technology which caused the most enrichment of alcohols and esters, at a concentration higher than the sensory thresholds. Keywords: red wines, winemaking technologies, volatile compounds Introduzione Le tecnologie di vinificazione, sia quelle prefermentative che quelle condotte nel corso della fermentazione e quelle nel corso dell elaborazione ed invecchiamento del vino, favorendo l estrazione dalle parti solide di molecole e/o agendo sul loro biochimismo influenzano la composizione dei diversi costituenti ed in particolare la frazione volatile del vino, responsabile di note sensoriali (Piñeiro et al., 2006). La criomacerazione in ambiente di CO 2 può facilitare l estrazione di molecole volatili e loro precursori dalle parti solide, e la loro protezione per l azione inibente della bassa temperatura sulle reazioni di ossidazione dei componenti estratti (Álvarez et al., 2006). Anche il prolungarsi della macerazione o le aggiunte di costituenti tannici, che predispongono il vino all invecchiamento, possono consentire miglioramenti nella composizione del prodotto finito (Gambacorta et al., 2011). Tali tecnologie, oltre che influenzare la frazione fenolica, possono favorire la presenza di molecole odorose o potenzialmente odorose (precursori), provenienti dall uva, oppure formate nel corso della fermentazione, o della elaborazione ed invecchiamento, e quindi possono essere responsabili di fondamentali caratteristiche chimiche e sensoriali dei vini. In questa nota sono riportati i risultati rilevati sulla componente volatile di vini rossi prodotti da uve di importanti cultivar, coltivate nella Regione Puglia, con tecnologie di vinificazione differenti, realizzate per verificare la loro influenza sulle caratteristiche qualitative del vino. Materiali e metodi Uve delle cv Aglianico (Alta Murgia-BA), Uva di Troia (Alta Murgia-BA), e Montepulciano dell Alto Tavoliere-FG sono state vinificate sperimentando la criomacerazione, l aggiunta di tannini ellagici e l utilizzo di macerazioni prolungate (10 giorni). Le uve (100 Kg) sono state vinificate, in impianto pilota, con tecnologia standard di vinificazione in rosso, secondo il seguente protocollo. Dopo pigiadiraspatura dell uva, il pigiato è stato addizionato di 10 g/hl di metabisolfito di potassio, 15 g/hl di lievito secco opportunamente attivato, (Saccharomices Cerevisiae), e 25 g/hl di attivatore di lievito (preparazione a base di fosfato di ammonio bibasico, tiamina cloridrata, pareti delle cellule di lievito e cellulosa). La macerazione/fermentazione è stata condotta a 25 C per 5 giorni effettuando 2 follature/giorno. Il mosto-vino ottenuto per sgrondatura, dopo fermentazione lenta e successivo deposito delle fecce, è stato travasato e conservato a temperatura ambiente. Dopo una serie di altri opportuni travasi per eliminare le fecce leggere, il vino è stato imbottigliato. Le vinificazioni con tecnologie differenti sono state effettuate, con modifiche rispetto al precedente protocollo come di seguito riportato: - utilizzo della criomacerazione, effettuata addizionando al pigia-diraspato CO 2 in forma solida, (circa 12 kg/q di pigiato) fino al raggiungimento della temperatura di 5 C, e mantenendo tale temperatura per circa 24 ore, in serbatoio termo-condizionato; - aggiunta di coadiuvanti tannici (tannini ellagici) al pigiato, in quantità pari a 10 g/q; - prolungamento del tempo di macerazione da 5 a 10 giorni. La valutazione dell idoneità delle diverse tecnologie enologiche applicate alle diverse cultivar è stata effettuata mediante la caratterizzazione del vino dopo 8 mesi di conservazione. 174

192 La frazione volatile libera dei vini (3 repliche) è stata determinata mediante estrazione in fase solida e successiva analisi GC/MS (Piñeiro et al., 2004). I componenti volatili sono stati identificati mediante confronto degli spettri sperimentali con quelli riportati nella libreria NIST02 e con quelli ottenuti iniettando standard puri. L analisi quantitativa dei componenti volatili è stata eseguita mediante allestimento di rette di taratura. Il range di concentrazione considerato per la retta di calibrazione di ciascuna molecola includeva i valori tipicamente riscontrati nei vini. I valori di R 2 ottenuti sono risultati superiori a I dati sperimentali sono stati sottoposti all'analisi della varianza ad una via (ANOVA, test di Duncan) attraverso il software STATISTICA 6.0, con l'obiettivo di evidenziare le differenze statisticamente significative. Risultati e discussione Sono stati rilevati numerosi componenti volatili, quali alcoli alifatici e aromatici, acidi grassi, esteri etilici ed acetati, aldeidi/chetoni, fenoli, derivanti dalla fermentazione, che costituiscono comunemente la frazione volatile preponderante del flavour di vini giovani, e svolgono un ruolo fondamentale nella definizione delle tipiche note fruttate di tali vini. I vini Aglianico ottenuti mediante vinificazione tradizionale hanno mostrato un contenuto di alcoli pari all 80,3% dei componenti volatili, di esteri pari all 11,9 e di acidi pari al 7,7 % (Fig.1). Si è riscontrato un significativo ammontare di composti aromatici (feniletilalcol, butanoato, esanoato e decanoato di etile) dalle note fruttate, con concentrazioni superiori alle soglie di percezione olfattiva. Nei vini prodotti con la macerazione prefermentativa a freddo, rispetto a quelli prodotti con le altre tecnologie, si è osservato una più alta presenza di composti volatili. Rispetto al test nei vini prodotti con la criomacerazione a freddo i composti volatili sono aumentati complessivamente del 3,1%, tra i quali gli esteri hanno presentato un incremento del 4,9% per un incremento di butanoato di etile, isoamilacetato, esanoato di etile, etilacetato, lattato di etile, ottanoato di etile, ac. 3-idrossibutan-etilestere, decanoato di etile e ac. acetico-2-feniletilestere; gli alcoli del 4,4% con incremento di alcoli isoamilici, 1- pentanolo, 4-metil-1-pentanolo, esanolo, 3-esenolo(E), 2,3-butandiolo e feniletilalcol, mentre gli acidi sono diminuiti dell 1,0%. I vini da Uva di Troia ottenuti mediante vinificazione tradizionale hanno mostrato che gli alcoli sono risultati l 82,8 % dei componenti volatili, gli esteri l 11,6 % e gli acidi il 5,6 %. Anche per tali vini si è osservato una più alta presenza di composti volatili in quelli prodotti con la macerazione prefermentativa a freddo, rispetto a quelli prodotti con le altre tecnologie. Nei vini prodotti con la macerazione prefermentativa a freddo, rispetto al test si è evidenziato un incremento di alcoli del 22,4% con incremento di 1-propanolo, 2-metil-1-propanolo, alcoli isoamilici, 3-esen-1-olo(Z), 2,3-butandiolo, metionolo, benzilalcol e feniletilalcol, una maggiore formazione di esteri pari all 11,8% con incremento di lattato di etile, decanoato di etile, acido butandioico dietilestere, etil-9-decenoato ed etil-idrogeno succinato, ed una diminuzione degli acidi del 10,8%, con un incremento complessivo di composti volatili del 19,3% (Fig. 2). I vini Montepulciano ottenuti mediante vinificazione tradizionale hanno mostrato che gli alcoli sono risultati l 85,0 % dei componenti volatili, gli esteri il 7,4% e gli acidi il 7,5 %. Anche per tali vini, si è osservato una più alta presenza di composti volatili in quelli prodotti con la macerazione prefermentativa a freddo (Fig. 3). L impiego del ghiaccio secco ha comportato una maggiore formazione di composti volatili (10,2%) rispetto al test. In particolare gli alcol sono aumentati del 10,3% per incremento di 1-butanolo, alcoli isoamilici, esanolo, 3-esen-1-olo(Z), 2,3-butandiolo, metionolo, benzilalcol e feniletilalcol e gli esteri del 175

193 9,3% con incremento di lattato di etile, ottanoato di etile, ac. 3-idrossibutan-etilestere, decanoato di etile, dietilsuccinato, l ac.acetico-2-feniletilestere e il dietilmalato. Le tecnologie di vinificazione con aggiunta di tannini e macerazione prolungata hanno comportato tenori superiori in alcoli rispetto al test, ma comunque inferiori rispetto al criomacerato. In particolare per quanto riguarda gli esteri, i vini ottenuti con le diverse pratiche enologiche, eccetto la criomacerazione, hanno presentato valori inferiori al testimone. È da osservare, infine, che in nessun vino si è riscontrata la presenza di aromi primari essendo noto che le uve oggetto di studio sono a carattere neutro. Conclusioni Tra le diverse tecnologie sperimentate riguardanti la condotta della macerazione e vinificazione di uve a bacca nera Aglianico, Uva di Troia, Montepulciano si evince che la macerazione pre-fermentativa a freddo si è dimostrata quella più efficace per favorire l espressione aromatica dei vini, soprattutto nel caso dell Uva di Troia. La decomposizione delle bucce dell uva, prodotta dall impiego del ghiaccio secco, infatti, ha presumibilmente incrementato la presenza di molecole responsabili della formazione di composti volatili, e di conseguenza ha causato un significativo aumento dei composti ad impatto odoroso, in particolare di alcoli ed esteri. Ringraziamenti La ricerca è stata finanziata dal Ministero dell Economia e delle Finanze, Ministero dell Istruzione, dell Università e della Ricerca Scientifica e Tecnologica e l Assessorato Bilancio e Programmazione Regione Puglia dal programma Accordo di Programma Quadro in Materia di Ricerca Scientifica della Regione Puglia - Progetto Strategico PS 042 dal titolo Miglioramento e valorizzazione dell espressione varietale della produzione enologica della Puglia Bibliografia ÁLVAREZ I., ALEIXANDRE J.L., GARCIA M.J., LIZAMA V., Impact of prefermentative maceration on the phenolic and volatile compounds in Monastrell red wines. Analytica Chimica Acta, 563: GAMBACORTA G., ANTONACCI D., PATI S., LA GATTA M., FACCIA M., COLETTA A., LA NOTTE E Influence of winemaking technologies on phenolic composition of Italian red wines. European Food Research and Technology, 233: PIÑEIRO Z., PALMA M., BARROSO C.G., Determination of terpenoids in wines by solid phase extraction and gas chromatography. Analytica Chimica Acta, 513: PIÑEIRO Z., NATERA R., CASTRO R., PALMA M., PUERTAS B., BARROSO C.G., Characterisation of volatile fraction of monovarietal wines: Influence of winemaking practices. Analytica Chimica Acta, 563:

194 Altri Acidi Esteri Alcoli test ghiaccio secco coadiuvanti tannici mac prolungata Fig.1. Composti volatili determinati nei vini Aglianico ottenuti con le diverse tecnologie. Fig. 1. Volatile compounds determined in Aglianico wines obtained by different winemaking technologies Acidi Esteri Alcoli test ghiaccio secco coadiuvanti tannici mac prolungata Fig. 2. Composti volatili determinati nei vini Uva di Troia ottenuti con le diverse tecnologie. Fig. 2. Volatile compounds determined in Uva di Troia wines obtained by different winemaking technologies Altri Acidi Esteri Alcoli test ghiaccio secco coadiuvanti tannici mac prolungata Fig. 3. Composti volatili determinati nei vini Montepulciano ottenuti con le diverse tecnologie. Fig. 3. Volatile compounds determined in Montepulciano wines obtained by different winemaking technologies. 177


X CONVEGNO NAZIONALE SULLA BIODIVERSITA I Circolare X CONVEGNO NAZIONALE SULLA BIODIVERSITA Roma e Viterbo, 2-5 settembre 2014 Organizzazione a cura di: Centro Interuniversitario per le Ricerche, la Conservazione ed utilizzazione del Germoplasma


EXPO Milano 2015 1 Maggio 31 Ottobre Classe 2B a.s. 2013-2014

EXPO Milano 2015 1 Maggio 31 Ottobre Classe 2B a.s. 2013-2014 ESPOSIZIONE UNIVERSALE (EXPO) EXPO Milano 2015 1 Maggio 31 Ottobre Classe 2B a.s. 2013-2014 CENNI STORICI Cos è EXPO: EXPO = Esposizione Universale EXPO = esposizione a carattere INTERNAZIONALE. Ogni EXPO


Quale cibo per il futuro?

Quale cibo per il futuro? Quale cibo per il futuro? C. Forni Laboratorio di Botanica e Fitotecnologie Università degli Studi di Roma Tor Vergata forni@uniroma2.it Frascati Scienza 22 9 14 1 Le piante sono costituite da tante molecole



UN FUTURO DA COLTIVARE PER LE AREE METROPOLITANE ROMA UN FUTURO DA COLTIVARE PER LE AREE METROPOLITANE Relatore: Claudio Destro - Presidente Confagricoltura di Roma I nuovi orizzonti dell agricoltura multifunzionale di Roma Milano, 6 settembre 2015 Evoluzioni


Il carattere multifunzionale dell agricoltura: approcci teorici e ruolo delle family farms. Leonardo Casini

Il carattere multifunzionale dell agricoltura: approcci teorici e ruolo delle family farms. Leonardo Casini Il carattere multifunzionale dell agricoltura: approcci teorici e ruolo delle family farms Leonardo Casini Questo è probabilmente l ettaro di terra più costoso del mondo: Burgundy, Vigneto Romanée Conti:



FOOD AND WATER FOR LIFE FOOD AND WATER FOR LIFE di persone soffrono la fame, la malnutrizione e la sete Milioni di persone soffrono per malattie associate al sovraalimentazione o per nutrizione di scarsa qualità


dieta nutrienti sufficienti a soddisfare le esigenze nutrizionali della persona ricerca in campo nutrizionale componenti alimentari nuovi alimenti

dieta  nutrienti sufficienti a soddisfare le esigenze nutrizionali della persona ricerca in campo nutrizionale componenti alimentari nuovi alimenti Lo scopo primario della dieta è fornire nutrienti sufficienti a soddisfare le esigenze nutrizionali della persona. Sono sempre più numerose le prove scientifiche a sostegno dell ipotesi che alcuni alimenti


Le ricadute sull ambiente delle scelte alimentari

Le ricadute sull ambiente delle scelte alimentari Le ricadute sull ambiente delle scelte alimentari Dr. Roberta Sonnino e dr. Ana Moragues Faus, Cardiff School of Planning and Geography, Cardiff University Le scelte alimentari: il contesto Tendenza a


Regione Toscana A.R.S.I.A. Maria Grazia Mammuccini

Regione Toscana A.R.S.I.A. Maria Grazia Mammuccini Regione Toscana A.R.S.I.A. Agenzia Regionale per lo Sviluppo e l Innovazione nel Settore Agricolo e Forestale Maria Grazia Mammuccini Razze e varietà locali: esperienze dalla Toscana per considerare i


ALIMENTAZIONE SALUTE AMBIENTE in tre parole Expo2015 e prospettive future. «Agricoltura virtuosa, innovativa e multifunzionale»

ALIMENTAZIONE SALUTE AMBIENTE in tre parole Expo2015 e prospettive future. «Agricoltura virtuosa, innovativa e multifunzionale» ALIMENTAZIONE SALUTE AMBIENTE in tre parole Expo2015 e prospettive future Torino, 24 marzo 2015 Mauro D Aveni Ufficio Qualità Coldiretti Torino «Agricoltura virtuosa, innovativa e multifunzionale» L AGRICOLTURA


P.A.N. Prevenzione Alimentazione Nutrizione

P.A.N. Prevenzione Alimentazione Nutrizione P.A.N. Prevenzione Alimentazione Nutrizione II Giornata Signora Dieta Mediterranea: più di 50 anni ma non li dimostra Lunedì 14 dicembre 2009 CAMERA DEI DEPUTATI Palazzo Marini Sala delle Conferenze Via





Gli Alimenti Classificazione degli alimenti Alimenti semplici o principi alimentari o principi nutritivi o nutrienti inorganici organici

Gli Alimenti Classificazione degli alimenti Alimenti semplici o principi alimentari o principi nutritivi o nutrienti inorganici organici Prof. Carlo Carrisi Gli Alimenti Classificazione degli alimenti Alimenti semplici o principi alimentari o principi nutritivi o nutrienti: servono a nutrire l organismo, derivano dalla digestione, vengono


La Politica Agricola Comune, i Programmi di Sviluppo Rurale e la Rete Natura 2000 Stato attuale e quadro post 2013

La Politica Agricola Comune, i Programmi di Sviluppo Rurale e la Rete Natura 2000 Stato attuale e quadro post 2013 La Politica Agricola Comune, i Programmi di Sviluppo Rurale e la Rete Natura 2000 Stato attuale e quadro post 2013 Luigi Servadei Ministero Luogo e delle datapolitiche Agricole, D.G. Sviluppo Rurale Rete



COOKING MANIA. PROGRAMMA CORSI DI CUCINA Anno 2015/2016 COOKING MANIA PROGRAMMA CORSI DI CUCINA Anno 2015/2016 La Sicilia ha un patrimonio gastronomico unico al mondo e la nostra Accademia ha come obiettivo principale quello di valorizzare tutti i prodotti


Tutela delle risorse genetiche autoctone di interesse agrario e forestale

Tutela delle risorse genetiche autoctone di interesse agrario e forestale LEGGE REGIONALE 22/04/2002, N. 11 Tutela delle risorse genetiche autoctone di interesse agrario e forestale Art. 1 (Finalita ) 1. La Regione autonoma Friuli Venezia Giulia favorisce e promuove, nell ambito


Risultati della Ricerca

Risultati della Ricerca Titolo Asparago - Costituzione e diffusione dell ibrido maschile Italo Risultati della Ricerca Descrizione estesa del risultato Italo è il primo ibrido interamente maschile (le piante maschili sono notoriamente


Dieta sostenibile salute, nutrizione, protezione sociale Comune di Anco

Dieta sostenibile salute, nutrizione, protezione sociale Comune di Anco logo Dieta sostenibile salute, nutrizione, protezione sociale Comune di Anco Gianna Ferretti Facoltà di Medicina e Chirurgia Centro Interdipartimentale Educazione Sanitaria e Promozione alla salute Salute


Coniugare sostenibilità e biodiversità: un approccio agronomico

Coniugare sostenibilità e biodiversità: un approccio agronomico Coniugare sostenibilità e biodiversità: un approccio agronomico Giuseppe Garcea Ufficio Controllo e Certificazione di Prodotto CCPB srl E mail: ggarcea@ccpb.it Fiera SANA 2013 Etimologia dei termini Sostenibilità:


Sicurezza Alimentare, Qualità dell Ambiente, Garanzia per la Salute

Sicurezza Alimentare, Qualità dell Ambiente, Garanzia per la Salute Sicurezza Alimentare, Qualità dell Ambiente, Garanzia per la Salute Il Biologico nella Ristorazione Collettiva Sabato 7 novembre 2009 Sala Botticelli Palazzo dei Congressi Roma EUR IL BIOLOGICO: REALI


Alimentazione al Femminile A cura di

Alimentazione al Femminile A cura di Milano, 22 Giugno 2015 Alimentazione al Femminile A cura di SCENARIO E OBIETTIVI DELLA RICERCA PRESSO LE DONNE ITALIANE Questa ricerca ha l obiettivo di indagare a 360 gradi il tema dell alimentazione


Risk factors for deaths

Risk factors for deaths App per il consumatore: la nuova frontiera dell etichettatura Prof. Alessandro Casini Nutrizione Clinica, AOUCareggi Università di Firenze Risk factors for deaths Prevalence of overweight (BMI>25 kg/m


La politica regionale di sviluppo rurale per il periodo 2014-2020 sarà improntata a quattro parole chiave:

La politica regionale di sviluppo rurale per il periodo 2014-2020 sarà improntata a quattro parole chiave: 4 5 scheda SEZIONE C: SCHEDA La strategia di sviluppo rurale del Friuli Venezia Giulia 2014-2020 in breve La politica regionale di sviluppo rurale per il periodo 2014-2020 sarà improntata a quattro parole



NUTRIRE IL PIANETA ENERGIA PER LA VITA. D.S. Patrizia Marini 2015 NUTRIRE IL PIANETA ENERGIA PER LA VITA D.S. Patrizia Marini GLI OBIETTIVI DEL MILLENNIO Il tema Expo Milano 2015 è collegato ad alcuni degli Obiettivi del Millennio fissati dalle Nazioni Unite: Ridurre


I_I06.e Cibo: biodiversità, sostenibilità e tradizione

I_I06.e Cibo: biodiversità, sostenibilità e tradizione PoliCulturaExpoMilano2015 I_I06.e Cibo: biodiversità, sostenibilità e tradizione Versione estesa Paolo Paolini, HOC-LAB (DEIB, Politecnico di Milano, IT), da una intervista a Dott.ssa Antonia Trichopoulou


Integratori alimentari Roma 17 dicembre 2014 Bruno Scarpa

Integratori alimentari Roma 17 dicembre 2014 Bruno Scarpa Integratori alimentari Roma 17 dicembre 2014 Bruno Scarpa Ministero della Salute Direzione generale igiene e sicurezza alimenti e nutrizione Ufficio IV ex DGSAN 1 ALIMENTO Come sono definiti sul piano


Cibo e salute. Marisa Porrini DiSTAM Università degli Studi di Milano

Cibo e salute. Marisa Porrini DiSTAM Università degli Studi di Milano Cibo e salute tra innovazione e tradizione Marisa Porrini DiSTAM Università degli Studi di Milano il cibo è salute sostentamento della vita prevenzione delle malattie da carenza ottimizzazione delle funzioni


Agricoltura del futuro: quali biotecnologie usare per garantire a tutti il diritto al cibo?

Agricoltura del futuro: quali biotecnologie usare per garantire a tutti il diritto al cibo? Agricoltura del futuro: quali biotecnologie usare per garantire a tutti il diritto al cibo? SOSTENIBILITA Nel 'genome editing' la risposta alla sfida per l'agricoltura del futuro Roma, 24 set. (AdnKronos)


Dopo EXPO, il futuro dell educazione alimentare nella scuola. Dott.ssa Evelina Flachi Presidente Food Education Italy

Dopo EXPO, il futuro dell educazione alimentare nella scuola. Dott.ssa Evelina Flachi Presidente Food Education Italy Dopo EXPO, il futuro dell educazione alimentare nella scuola Dott.ssa Evelina Flachi Presidente Food Education Italy Nel passato sono stati molti e forse troppi i soggetti che hanno promosso un educazione



LAUREA SPECIALISTICA IN SCIENZE, TECNOLOGIE E GESTIONE DEL SISTEMA AGRO-ALIMENTARE LAUREA SPECIALISTICA IN SCIENZE, TECNOLOGIE E GESTIONE DEL SISTEMA AGRO-ALIMENTARE Classe 78/S - Scienze e Tecnologie agroalimentari Coordinatore: prof. Marco Gobbetti Tel. 0805442949; e-mail: gobbetti@ateneo.uniba.it


Da dove derivano i nostri cibi preferiti? Gli alimenti derivano in gran parte dall agricoltura e dall allevamento degli animali domestici

Da dove derivano i nostri cibi preferiti? Gli alimenti derivano in gran parte dall agricoltura e dall allevamento degli animali domestici Da dove derivano i nostri cibi preferiti? Gli alimenti derivano in gran parte dall agricoltura e dall allevamento degli animali domestici L AGRICOLTURA L'agricoltura è l'attività economica che consiste


Risultati della Ricerca

Risultati della Ricerca Risultati della Ricerca Titolo Linee guida per il trasporto e la vendita di prodotti alimentari deperibili a basso impatto ambientale Descrizione estesa del risultato La progettazione, realizzazione e


La politica di sviluppo rurale e il PSR 2007-2013 della Lombardia

La politica di sviluppo rurale e il PSR 2007-2013 della Lombardia La politica di sviluppo rurale e il PSR 2007-2013 della Lombardia Roberto Pretolani Dipartimento di Economia e Politica Agraria, Agro-alimentare e Ambientale Università degli Studi di Milano La politica



Proposta di istituzione della SCUOLA DI DOTTORATO IN SCIENZE E TECNOLOGIE AGRARIE E FORESTALI PRIMA STESURA Proposta di istituzione della SCUOLA DI DOTTORATO IN SCIENZE E TECNOLOGIE AGRARIE E FORESTALI Approvato con Decreto Commissariale n. 127/C del 20.07.2011 INDICE 1. Finalità ed obiettivi 2.


La politica regionale di sviluppo rurale per il periodo 2014-2020 sarà improntata a quattro parole chiave:

La politica regionale di sviluppo rurale per il periodo 2014-2020 sarà improntata a quattro parole chiave: 2 3 scheda SEZIONE C: SCHEDA La strategia di sviluppo rurale del Friuli Venezia Giulia 2014-2020 in breve La politica regionale di sviluppo rurale per il periodo 2014-2020 sarà improntata a quattro parole





Incontro La Biodiversità vegetale della Campania La biodiversità nella programmazione PSR 2014-2020

Incontro La Biodiversità vegetale della Campania La biodiversità nella programmazione PSR 2014-2020 IX Edizione Frutta dell Autunno XXVII Mostra Pomologica Incontro La Biodiversità vegetale della Campania La biodiversità nella programmazione PSR 2014-2020 Caserta, 10 ottobre 2014 CRA- Unità di Ricerca


Alimentazione Salute Ambiente: la composizione degli alimenti e le scelte del consumatore. La ristorazione a scuola ed a casa

Alimentazione Salute Ambiente: la composizione degli alimenti e le scelte del consumatore. La ristorazione a scuola ed a casa Alimentazione Salute Ambiente: la composizione degli alimenti e le scelte del consumatore. La ristorazione a scuola ed a casa Relatore: Prof. Vincenzo Gerbi UNIVERSITÀ DEGLI STUDI DI TORINO Di.S.A.F.A.


Giovanni Peira. Università degli studi di Torino

Giovanni Peira. Università degli studi di Torino Giovanni Peira Università degli studi di Torino L agricoltura dalla parte del consumatore Domanda e offerta di prodotti agroalimentari: il punto di vista del consumatore. 2 dicembre 2008, Torino 1 Evoluzione


PSR 2014-2020: le prospettive provinciali Incontro con il partenariato

PSR 2014-2020: le prospettive provinciali Incontro con il partenariato PSR 2014-2020: le prospettive provinciali Incontro con il partenariato Costruiamo la strategia: dall analisi di contesto ai fabbisogni Luca Cesaro INEA Trentino Alto Adige Trento, 6 marzo 2014 Fasi di


Tutela delle risorse genetiche autoctone di interesse agrario e forestale. Art. 1. (Finalità)

Tutela delle risorse genetiche autoctone di interesse agrario e forestale. Art. 1. (Finalità) Legge regionale 22 aprile 2002, n. 11 Tutela delle risorse genetiche autoctone di interesse agrario e forestale Art. 1 (Finalità) 1. La Regione autonoma Friuli Venezia Giulia favorisce e promuove, nell'ambito



PER SOSTENERE IL FUTURO, COME RIDURRE GLI SPRECHI ALIMENTARI OTALL Il salone della Ricerca, Innovazione e Sicurezza alimentare Cosa abbiamo nel piatto: Tecnologie, Ambiente, Educazione, Sicurezza PER SOSTENERE IL FUTURO, COME RIDURRE GLI SPRECHI ALIMENTARI Claudia









E NATALE FATE UN REGALO AL PIANETA!! LEZIONE 3 Rivolta a tutti i ragazzi delle scuole dell infanzia, primaria e secondaria di primo grado. Per i docenti: sviluppate la traccia della tematica sotto presentata, adattandola con parole e iniziative,


Il futuro della PAC quali prospettive per le assicurazioni e fondi di mutualizzazione? Pasquale DI RUBBO Policy Advisor Trento 1 Aprile 2011

Il futuro della PAC quali prospettive per le assicurazioni e fondi di mutualizzazione? Pasquale DI RUBBO Policy Advisor Trento 1 Aprile 2011 Il futuro della PAC quali prospettive per le assicurazioni e fondi di mutualizzazione? Pasquale DI RUBBO Policy Advisor Trento 1 Aprile 2011 Che cosa sono il Copa e la Cogeca? Il Copa Gli agricoltori europei


Alimentazione naturale

Alimentazione naturale B Alimentazione naturale Secondo i dati dell ISMEA (Osservatorio del mercato dei prodotti biologici), in un anno di crisi come il 2010 i consumi di prodotti ortofrutticoli biologici hanno avuto un andamento


L utilizzazione dell art. 68 e la gestione del rischio nella nuova Pac

L utilizzazione dell art. 68 e la gestione del rischio nella nuova Pac Workshop Gli strumenti per l assicurazione del rischio di impresa nello scenario della nuova Pac L utilizzazione dell art. 68 e la gestione del rischio nella nuova Pac Roma, 3 marzo 2009 Angelo Frascarelli


Salute delle persone e sostenibilità ambientale: La Doppia Piramide BCFN. Milano 9 ottobre 2014

Salute delle persone e sostenibilità ambientale: La Doppia Piramide BCFN. Milano 9 ottobre 2014 Salute delle persone e sostenibilità ambientale: La Doppia Piramide BCFN Milano 9 ottobre 2014 Indice 1. Introduzione, motivazione e obiettivi del lavoro 2. Il framework teorico: la Doppia Piramide Alimentare


Il consumo socialmente responsabile nei paesi sviluppati

Il consumo socialmente responsabile nei paesi sviluppati Sviluppo agricolo e povertà rurale nell era della globalizzazione: il contributo della Facoltà di Agraria Portici, 27 marzo 2006 Il consumo socialmente responsabile nei paesi sviluppati Ornella Wanda Maietta


PSR 2014-2020 Ruolo, organizzazione e obiettivi dell agroalimentare pugliese SEMINARIO

PSR 2014-2020 Ruolo, organizzazione e obiettivi dell agroalimentare pugliese SEMINARIO Accademia dei Georgofili Sezione Sud Est SEMINARIO PSR 2014-2020 Ruolo, organizzazione e obiettivi dell agroalimentare pugliese Venerdì 29 gennaio 2016 - ore 14,30 Hotel Hilton Garden Inn Lecce, Via Cosimo


Frutta e verdura, i freschi colori dell estate.

Frutta e verdura, i freschi colori dell estate. Frutta e verdura, i freschi colori dell estate. www.politicheagricole.it più colore alla tua vita www.inran.it Indagini recenti ci confermano un dato purtroppo costante negli ultimi anni: il calo nei consumi


Alimenti. Gruppi Alimentari

Alimenti. Gruppi Alimentari Alimenti Gli alimenti sono tutto ciò che viene utilizzato come cibo dalla specie umana. Un dato alimento non contiene tutti i nutrienti necessari per il mantenimento di un corretto stato fisiologico La


Dieta Mediterranea, Patrimonio dell'unesco

Dieta Mediterranea, Patrimonio dell'unesco Dieta Mediterranea, Patrimonio dell'unesco CuDriEc 10 giugno, 2015 La Dieta Mediterranea è Patrimonio dell Unesco, annoverata nel 2010 tra i beni immateriali dell Umanità; un meraviglioso ed equilibrato


Mediterranean diet and patient with heart failure Dieta mediterranea e paziente con scompenso cardiaco

Mediterranean diet and patient with heart failure Dieta mediterranea e paziente con scompenso cardiaco Mediterranean diet and patient with heart failure Dieta mediterranea e paziente con scompenso cardiaco Paola Antonini MD, PhD Sr VP Scientific Affairs (King of Prussia, PA, USA) October 13, 2014 Page 2


MANIFESTO della green economy per l'agroalimentare

MANIFESTO della green economy per l'agroalimentare MANIFESTO della green economy per l'agroalimentare Del Consiglio Nazionale della green economy Roma, 30 giugno 2015 In occasione di Expo 2015 Consiglio nazionale della green economy, formato da 66 organizzazioni



LA STRUTTURA OPERATIVA DEL PROGETTO IL PROGETTO DI RICERCA IL PROGETTO DI RICERCA Il progetto Applicazione di biotecnologie molecolari e microrganismi protecnologici per la caratterizzazione e valorizzazione delle filiere lattiero-casearia e prodotti da forno


Dieta sana = dieta costosa? No Consigli utili per mangiare sano senza spendere tanto

Dieta sana = dieta costosa? No Consigli utili per mangiare sano senza spendere tanto Dieta sana = dieta costosa? No Consigli utili per mangiare sano senza spendere tanto A CURA DEL MINISTERO DELLA SALUTE DIREZIONE GENERALE DELLA COMUNICAZIONE E DEI RAPPORTI EUROPEI E INTERNAZIONALI, UFFICIO


I TUMORI prevenire circa un terzo dei casi di tumore

I TUMORI prevenire circa un terzo dei casi di tumore I TUMORI Il Rapporto Mondiale dell Agenzia Internazionale per la Ricerca sul Cancro, dell Organizzazione Mondiale della Sanità, evidenzia come il cancro sia divenuto uno dei maggiori problemi per la sanità


Lo scopo dell IFAD. Dove lavoriamo 1. Come lavoriamo

Lo scopo dell IFAD. Dove lavoriamo 1. Come lavoriamo L IFAD in breve Lo scopo dell IFAD La finalità del Fondo Internazionale per lo Sviluppo Agricolo (IFAD) è mettere le popolazioni rurali povere in condizione di raggiungere una maggiore sicurezza alimentare,


Alimentazione, consumatori, territori transfrontalieri. Programma ALCOTRA 2007-2013, progetto n. 121 Le buone pratiche di ristorazione collettiva

Alimentazione, consumatori, territori transfrontalieri. Programma ALCOTRA 2007-2013, progetto n. 121 Le buone pratiche di ristorazione collettiva Alimentazione, consumatori, territori transfrontalieri. Programma ALCOTRA 2007-2013, progetto n. 121 Le buone pratiche di ristorazione collettiva Menù partecipato Il progetto il menù l ho fatto io Un modello



PRESENTAZIONE ISTITUZIONALE. www.istvap.it PRESENTAZIONE ISTITUZIONALE www.istvap.it 1 ISTVAP ha quattro anni di vita ISTVAP sta per compiere quattro anni di vita. Anni di attività che hanno portato alla scoperta dell importanza del concetto di


La ricerca nel settore agro-alimentare in Italia e in Puglia. Valenzano, 27 febbraio 2006 Massimiliano Schiralli

La ricerca nel settore agro-alimentare in Italia e in Puglia. Valenzano, 27 febbraio 2006 Massimiliano Schiralli La ricerca nel settore agro-alimentare in Italia e in Puglia Valenzano, 27 febbraio 2006 Massimiliano Schiralli Competitività e conoscenza Una delle priorità dell Unione Europea, sancita durante il Consiglio


Ruolo della formazione nella sicurezza degli alimenti Alessandro Mangia

Ruolo della formazione nella sicurezza degli alimenti Alessandro Mangia Università degli Studi di Parma Ruolo della formazione nella sicurezza degli alimenti Alessandro Mangia La Sicurezza degli alimenti tema prioritario per l opinione pubblica e nell agenda dei governi mondiali


- Incontro tra il Ministro Corrado Passera e le Associazioni dei Giovani Imprenditori - PROPOSTA Associazione Giovani Imprenditori Agricoli

- Incontro tra il Ministro Corrado Passera e le Associazioni dei Giovani Imprenditori - PROPOSTA Associazione Giovani Imprenditori Agricoli - Incontro tra il Ministro Corrado Passera e le Associazioni dei Giovani Imprenditori - PROPOSTA Associazione Giovani Imprenditori Agricoli Roma 04 Dicembre 2012 1 Signor Ministro Passera, a nome mio e





Risultati della Ricerca

Risultati della Ricerca Risultati della Ricerca Titolo Negozio mobile con banchi di vendita refrigerati da energia rinnovabile Descrizione estesa del risultato Sicurezza e qualità alimentare sono i concetti che hanno suggerito


Special project Newsletter 1

Special project Newsletter 1 PO F.S.E. Regione Abruzzo 2007-23, Obiettivo C.R.O. - Asse V Piano Operativo 2007-2008; Codice Identificativo (CIG) n. 64280FF5 L incremento dei fabbisogni di assistenza per non i autosufficienti ed il

Dettagli Ricorso a servizi di consulenza da parte degli imprenditori agricoli e forestali Ricorso a servizi di consulenza da parte degli imprenditori agricoli e forestali Ricorso a servizi di consulenza da parte degli imprenditori agricoli e forestali 1. Denominazione della Misura: Ricorso a servizi di consulenza da parte degli imprenditori agricoli e forestali


A cosa serve lo iodio?

A cosa serve lo iodio? Iodio e Salute Che cos è lo iodio? Lo iodio, dal greco iodes (violetto), è un elemento (come l ossigeno, l idrogeno, il calcio ecc) diffuso nell ambiente in diverse forme chimiche. Lo iodio presente nelle


Risultati della Ricerca

Risultati della Ricerca Titolo Linee guida per la trasformazione casearia su piccola scala Risultati della Ricerca Descrizione estesa del risultato Il documento è stato redatto come frutto della ricerca sviluppata dalla UO CRA-FLC


La Carta di Ottawa per la Promozione della Salute

La Carta di Ottawa per la Promozione della Salute La Carta di Ottawa per la Promozione della Salute The Ottawa Charter for Health Promotion 1 Conferenza Internazionale sulla promozione della salute 17-21 novembre 1986 Ottawa, Ontario, Canada La 1 Conferenza



CURRICOLO DI EDUCAZIONE ALIMENTARE CURRICOLO DI EDUCAZIONE ALIMENTARE Premessa Dalle rilevazioni effettuate negli ultimi anni sulla popolazione giovanile è emerso un aumento di problemi legati alle cattive abitudini alimentari e alla pratica



CIBO, ALIMENTAZIONE E BIODIVERSITA CIBO, ALIMENTAZIONE E BIODIVERSITA VILLA PAOLINA ASTI 8 settembre 2015 La popolazione mondiale è cresciuta di 250 milioni di persone in 1600 anni 9 miliardi mentre ora cresce drasticamente. dal 1950


Quale futuro per i servizi di consulenza a supporto delle aziende agricole

Quale futuro per i servizi di consulenza a supporto delle aziende agricole Quale futuro per i servizi di consulenza a supporto delle aziende agricole Consiglio dell'ordine Nazionale dei Dottori Agronomi e Dottori Forestali Alberto Giuliani Coordinatore dipartimento Sviluppo Rurale


Scopo del lavoro è. Studio dell Istituto zooprofilattico di Brescia Rapporto tra acidi grassi saturi e insaturi nel latte bovino

Scopo del lavoro è. Studio dell Istituto zooprofilattico di Brescia Rapporto tra acidi grassi saturi e insaturi nel latte bovino Un valore che influenza la qualità nutrizionale, tecnologica e soprattutto organolettica dei prodotti finiti di Giuseppe Delle Donne, Antonio Marcolini, Giorgio Zanardi, Giuseppe Bolzoni Studio dell Istituto


Stato dell arte e motivazione del progetto

Stato dell arte e motivazione del progetto Stato dell arte e motivazione del progetto La cultura di un popolo, di una società, di un territorio, si esprime in vari modi, tra questi è di assoluto rilievo l aspetto legato all alimentazione. Se è



ELIMINARE LA FAME E LA POVERTÀ Secondo le Nazioni Unite, circa 25 mila persone muoiono di fame tutti i giorni, soprattutto bambini e anziani. Per ELIMINARE LA FAME E LA POVERTÀ, è prioritario affrontare la questione della terra, del





Progetto STABULUM e le filiere corte agroenergetiche nello sviluppo rurale 2014-2020

Progetto STABULUM e le filiere corte agroenergetiche nello sviluppo rurale 2014-2020 Progetto STABULUM e le filiere corte agroenergetiche nello sviluppo rurale 2014-2020 Obiettivi della Misura 124 (1) La Misura ha sostenuto progetti di cooperazione per lo sviluppo e la sperimentazione


Sintesi ragionata del Documento AIRTUM 2009 (I nuovi dati di incidenza e mortalità Periodo 2003-2005)

Sintesi ragionata del Documento AIRTUM 2009 (I nuovi dati di incidenza e mortalità Periodo 2003-2005) Sintesi ragionata del Documento AIRTUM 2009 (I nuovi dati di incidenza e mortalità Periodo 2003-2005) Documento a cura della Dr. Maria Vincenza Liguori Settore Epidemiologia Ambientale Direttore Dr. Laura


3. Consigli e strategie

3. Consigli e strategie Dipartimento delle Professioni Sanitarie Guida al percorso di assistenza nutrizionale in riabilitazione cardiologica Servizio Dietetico Responsabile: Dr.ssa Maria Luisa Masini 3. Consigli e strategie Raccomandazioni





I beni culturali come volano della crescita economica e sociale. del territorio. 4. I beni culturali come volano della crescita economica e sociale

I beni culturali come volano della crescita economica e sociale. del territorio. 4. I beni culturali come volano della crescita economica e sociale I beni culturali Il problema I beni culturali un elemento di estremo rilievo per la crescita della cultura e della qualità della vita dei cittadini - possono favorire lo sviluppo di alcune iniziative economiche


La scienza in campo. Marisa Porrini Facoltà di Agraria

La scienza in campo. Marisa Porrini Facoltà di Agraria La scienza in campo Marisa Porrini Facoltà di Agraria Il sistema agricolo non opera più secondo un modello prettamente produttivo, ma si sta orientando verso la salvaguardia delle risorse naturali, della


Alimenti Funzionali. Convegno Associazione Dossetti I Valori - 23/05/08

Alimenti Funzionali. Convegno Associazione Dossetti I Valori - 23/05/08 Alimenti Funzionali Convegno Associazione Dossetti I Valori - 23/05/08 Background All interno delle società avanzate, siamo giunti ad una nuova frontiera della scienza nutrizionale; Da CONCETTO DI NUTRIZIONE


L.R. 06 Novembre 2006, n. 15 Disposizioni urgenti in materia di organismi geneticamente modificati (1) SOMMARIO

L.R. 06 Novembre 2006, n. 15 Disposizioni urgenti in materia di organismi geneticamente modificati (1) SOMMARIO L.R. 06 Novembre 2006, n. 15 Disposizioni urgenti in materia di organismi geneticamente modificati (1) SOMMARIO Art. 1 Oggetto e finalità Art. 2 Divieti di coltivazione e di allevamento di OGM. Disposizioni



PROGETTAZIONE/DOCUMENTAZIONE UNITA DIDATTICA di AREA SCIENTIFICA a.s.2011-12 Istituto Sperimentale Rinascita - A. Livi - Milano Scuola statale secondaria di primo grado ad indirizzo musicale PROGETTAZIONE/DOCUMENTAZIONE UNITA DIDATTICA di AREA SCIENTIFICA a.s.2011-12 TITOLO UNITA


"L impatto dell Information Technology sulle aziende del terziario in Italia"

L impatto dell Information Technology sulle aziende del terziario in Italia "L impatto dell Information Technology sulle aziende del terziario in Italia" Sintesi per la stampa Ricerca promossa da Microsoft e Confcommercio realizzata da NetConsulting Roma, 18 Marzo 2003 Aziende





Corso P1 - Operatore della Ristorazione N. RIF. 2010-358/RA

Corso P1 - Operatore della Ristorazione N. RIF. 2010-358/RA Corso P1 - Operatore della Ristorazione N. RIF. 2010-358/RA Docente: Dr. Luca La Fauci Biologo Nutrizionista & Tecnologo Alimentare Lezione 2 Principi nutritivi, tabelle nutrizionali e corretto regime


Proposta per una strategia di promozione dei prodotti agricoli lucani

Proposta per una strategia di promozione dei prodotti agricoli lucani DIPARTIMENTO POLITICHE AGRICOLE E FORESTALI Viale Vincenzo Verrastro, 10-85100 Potenza ass_agricoltura@regione.basilicata.it tel. 0971668710 fax 0971668731 L ASSESSORE Potenza lì 05/05/2014 MATERA 2019


Società agraria di Lombardia. Contributo al tema dell Expo. Contributo n 116

Società agraria di Lombardia. Contributo al tema dell Expo. Contributo n 116 Società agraria di Lombardia Contributo al tema dell Expo Contributo n 116 COMUNICATO Contributo al tema dell EXPO Il Consiglio Direttivo della Società Agraria di Lombardia, congiuntamente ad un gruppo



SISTEMI NORMATIVI E ISTITUZIONALI NAZIONALI E DELL UNIONE EUROPEA NEL SETTORE TURISTICO E DEI BENI CULTURALI L Agenda 21 per il turismo europeo Nella comunicazione del novembre 2003, Orientamenti di base per la sostenibilità del turismo europeo 20, la Commissione europea preannunciava «una serie di provvedimenti


Scenari futuri per le produzioni animali e per la relativa ricerca

Scenari futuri per le produzioni animali e per la relativa ricerca Scenari futuri per le produzioni animali e per la relativa ricerca Andrea Rosati European Ambiente Socio Economico La popolazione mondiale raggiungerà 9,2 miliardi nel 2050 La produzione di cibo dovrà


Expo, il contributo del Crea alla Carta di Milano

Expo, il contributo del Crea alla Carta di Milano Expo, il contributo del Crea alla Carta di Milano E' tempo di bilancio per l'esposizione universale. Nei sei mesi della kermesse milanese tanti eventi e attività organizzati dall'ente per la ricerca agroalimentare


Legge di stabilità: 21 milioni di finanziamento al CREA

Legge di stabilità: 21 milioni di finanziamento al CREA Legge di stabilità: 21 milioni di finanziamento al CREA A CURA DELL UFFICIO STAMPA 1 MIPAAF: 21 milioni di euro per le biotecnologie sostenibili Si tratta di un piano articolato su tre anni gestito dal


I prodotti biologici e la filiera corta

I prodotti biologici e la filiera corta Regione Siciliana Assessorato regionale delle risorse agricole e alimentari Dipartimento regionale degli interventi infrastrutturali per l agricoltura Istituto Nazionale di Economia Agraria I prodotti


EMAS ed Ecolabel Integrazione tra i due schemi dott.ssa Giulia Maggiorelli, ing. Marina Masone

EMAS ed Ecolabel Integrazione tra i due schemi dott.ssa Giulia Maggiorelli, ing. Marina Masone EMAS ed Ecolabel Integrazione tra i due schemi dott.ssa Giulia Maggiorelli, ing. Marina Masone Introduzione La politica integrata dei prodotti (IPP), secondo quanto riportato nel Libro Verde della Commissione


QUOTE LATTE ADDIO: QUALE FUTURO PER IL SETTORE BOVINO? Real Orto botanico, Napoli 13 maggio 2015

QUOTE LATTE ADDIO: QUALE FUTURO PER IL SETTORE BOVINO? Real Orto botanico, Napoli 13 maggio 2015 Università degli studi di Napoli Federico II Dipartimento di Medicina Veterinaria e Produzioni Animali QUOTE LATTE ADDIO: QUALE FUTURO PER IL SETTORE BOVINO? Real Orto botanico, Napoli 13 maggio 2015 "I
