Come identificare i Cromosomi

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Come identificare i Cromosomi"

Transcript

1 Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi (submetacentrici, incluso il chr.x) D Grandi (acrocentrici) E Piccoli (submetacentrici) F Piccoli (metacentrici) G Piccoli (acrocentrici, incluso il chr. Y) 57

2 Bandeggio dei Cromosomi L introduzione di specifiche tecniche di colorazione (bandeggio) a permesso di Identificare i diversi cromosomi Definire più accuratamente le alterazioni cromosomiche Le tecniche di bandeggio prevedono: Denaturazione o digestione enzimatica dei cromosomi L utilizzo di coloranti che si legano in maniera specifica al DNA Il cromosoma mostra la tipica alternanza di bande chiare e scure. 58

3 International System for human Cytogenetic Nomenclature (ISCN) 59

4 Tipi di bandeggio TECNICA PROCEDURA BANDING PATTERN Bandeggio G Bandeggio R (Reverse) Bandeggio Q Bandeggio C Colorazione NOR Proteolisi limitata (trattamento con tripsina) seguita dalla colorazione Giemsa Denaturazione al calore (regioni ricche in AT) seguita dalla colorazione Giemsa Proteolisi limitata (trattamento con tripsina) seguita dalla colorazione un colorante fluorescente (Quinacrina) Denaturazione con idrossido di bario e poi colorazione con Giemsa Colorazione con Nitrato di Argento Le bande scure sono regioni ricche in AT, le bande chiare sono ricche in GC Le bande scure sono regioni ricche in GC, le bande chiare sono ricche in AT (inverso del bandeggio G) Bandeggio analogo al bandeggio G (scure ricche in AT, chiare ricche in GC). Colora selettivamente anche il braccio lungo del chr. Y Colora selettivamente le regioni ricche in eterocromatina costitutiva (centromeri e regioni pericentromeriche) Colora selettivamente i satelliti dei chr. acrocentrici 13, 14, 15, 21 e 22 ed è esclusiva di queste regioni 60

5 Bandeggio G 61

6 Confronto tra bandeggi G and R-banding results show the addition of chromosomal material in the short arm of one chromosome 9(der(9)). C-banding results show the presence of heterochromatin into the der(9). 62

7 Bandeggio C 63

8 Colorazione NOR 64

9 Risoluzione del Cariotipo tradizionale Il limite di risoluzione di un analisi del cariotipo standard è di 4-6 Mb Il potere di risoluzione delle tecniche di bandeggio può essere aumentato analizzando i cromosomi in condizioni di minore condensazione (prometafase): Bassa (400 bande) Intermedia (550 bande) Alta (850 bande) 65

10 Cromosoma 4 (G-banding)

11 Cariotipo costituzionale: da quali cellule? Il cariotipo costituzionale può essere ottenuto da qualsiasi tipo di cellula somatica nucleata E fondamentale che la cellula sia in mitosi La fonte più semplice sono le cellule nucleate del sangue E sufficiente un prelievo di sangue venoso Il linfociti hanno un elevato indice mitotico se stimolati in coltura con fitoemoagglutinina (PHA) Fonti alternative di cellule: Fibroblasti (da biopsia cutanea) Una condizione di mosaicismo Cellule del midollo osseo (biopsia midollare) Sospetta leucemia (citogenetica oncologica) Amniociti (prelivo di liquido amniotico) Analisi in epoca prenatale 67

12 Cariotipo di routine Blocca in metafase (depolimerizza i microtubuli del fuso mitotico) 68

13 Cariotipo di routine 69

14 Cariotipo di routine 70

15 Fluorescent In Situ Hybridization (FISH) dei Cromosomi L analisi dei cromosomi mediante FISH prevede l uso di sonde (molecole di DNA) di lunghezza variabile (2-500 Kb) marcate con un fluoroforo. Marcatura diretta Marcatura indiretta Nella FISH standard la sonda è omogena In alcune applicazioni è possibile utilizzare più sonde contemporaneamente e le immagini sono elaborate da sistemi di analisi computerizzati. E possibile analizzare i nuclei in interfase. Il chromosome painting è la forma più sofisticata di FISH Si utilizzano cocktail di sonde specifiche per i diversi cromosomi Le immagini rielaborate dal computer, in colori virtuali, consentono di distinguere i cromosomi e dettagliarne il bandeggio Il limite di risoluzione è di ~ 40 Kb 71

16 Fluorescent In Situ Hybridization (FISH) dei cromosomi 72

17 Fluorescent In Situ Hybridization (FISH) dei cromosomi 73

18 74

19 Parziale trisomia del Chr 2 A. Cariotipo con tecnica classica B. M-FISH C. Rx-FISH

20 Rx-FISH (Rainbow Colors X Species) I cromosomi umani sono ibridate con sonde colorate da cromosomi di un primate (Gibbone). Il genoma di questa specie (2n=52) ha omologia del 98% con il genoma umano 76

21 Comparative Genomic Hybridization (CGH) Consente di evidenziare alterazioni quantitative (delezioni/duplicazioni) nei cromosomi metafasici. Il DNA estratto da due sorgenti cellulari diverse (Campione e Controllo) è marcato con due differenti fluorofori Entrambi i pool di sonde sono ibridati con cromosomi matafasici fissati su un vetrino I segnali di fluorescenza lungo i cromosomi sono dosati e sovrapposti (merge) evidenziando in colori virtuali il differente dosaggio Trova applicazione in citogenetica oncologica dove spesso si osservano cariotipi fortemente alterati. 77

22

23 Array-CGH E l ulteriore evoluzione del CGH su cromosomi metafasici, ma con risoluzione molto elevata che consente di evidenziare alterazioni del numero di copie (Copy Number Variation, CNV) anche di 3.5 Kb. Il DNA estratto da due sorgenti cellulari diverse (Campione e Controllo) è marcato con due differenti fluorofori Entrambi i pool di sonde sono ibridati su un vetrino (microarray) su cui sono state fissate specifiche sequenze oligonucleotidiche rappresentative dell intero genoma I segnali di fluorescenza sono dosati e sovrapposti (merge) evidenziando in colori virtuali il differente dosaggio Consente di ricondurre immediatamente l alterazione osservata ad una precisa regione/sequenza del genoma. 79

24 Array-CGH 80

25 Array-CGH 81

26 82

27 Polimorfismi cromosomici I cromosomi umani possono presentare variazioni morfologiche (polimorfismi) in diversi individui. Spesso interessano regioni costituite da DNA ripetitivo, funzionalmente inattivo e quindi non hanno alcun effetto patologico. Rientrano nella variabilità individuale che, a diversi livelli, si osserva nel nostro genoma. 83

28 Satelliti dei cromosomi acrocentrici Polimorfismi cromosomici più frequenti: Assenza dei satelliti di un cromosoma acrocentrico Espansione del DNA satellite Espansione delle regioni NOR Evidenziabili con il bandeggio C o colorazione NOR. 84

29 Variazioni dell eterocromatina pericentromerica Sono in genere espansioni, ma anche delezioni o inversioni. Tutti i cromosomi, più frequente in chr. 1, 9 e 16 L espansione dell eterocromatina pericentromerica del chr. 9 è presente nell 8% degli individui L inversione della stessa regione del chr. 9 è presente nell 1.5% degli individui Evidenziata con bandeggio C 85

30 Polimorfismi dell eucromatina Sono denominati HSR (Homogeneously Staining Regions). Bene caratterizzata la variante 9p+ (amplificazione di un segmento della banda 9p12) Altre varianti polimorfiche descritte a 15q11.2, 16p11.2 e 8p

31 Copy Number Variations (CNV) Sono una classe di varianti polimorfiche dell eucromatina normalmente presenti nella popolazione generale. Sono evidenziabili mediante array-cgh (per l elevata risoluzione della tecnica) Sono delezioni o amplificazioni di segmenti genici, in genere di piccole dimensioni ( Kb fino a 3Mb) Sono presenti in più del 1% della popolazione. 87

32 DGV 88

33 DECIPHER 89

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni L array-cgh: -riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni -ha un potere si risoluzione 100 volte superiore al cariotipo (100 Kb versus 10 Mb) Microarray-based

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

Lo studio prenatale dei cromosomi fetali:

Lo studio prenatale dei cromosomi fetali: Laboratorio di Genetica Medica Lo studio prenatale dei cromosomi fetali: esame citogenetico standard vs array Bologna, 06 Giugno 2014 Giorgio Lucci La citogenetica classica Inizio della citogenetica umana

Dettagli

CEQ in CITOGENETICA COSTITUZIONALE 2014 DIAGNOSI PRENATALE E POSTNATALE

CEQ in CITOGENETICA COSTITUZIONALE 2014 DIAGNOSI PRENATALE E POSTNATALE CEQ in CITOGENETICA COSTITUZIONALE 2014 DIAGNOSI PRENATALE E POSTNATALE Per il CEQ in citogenetica costituzionale sono state definite due categorie di performance: sufficiente e insufficiente. Per ottenere

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

ELENCO DELLE INDAGINI ESEGUIBILI

ELENCO DELLE INDAGINI ESEGUIBILI Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE n. nome TEST GENETICO metodo giorni TIPOLOGIA CAMPIONE 1 Acondroplasia

Dettagli

FINALITA : evidenziare la. cromosomiche fetali.

FINALITA : evidenziare la. cromosomiche fetali. Il Cariotipo Fetale Molecolare l (array-cgh) Il Cariotipo Fetale e TRADIZIONALE FINALITA : evidenziare la presenza di eventuali anomalie cromosomiche fetali. TECNICA: comporta la coltura delle cellule

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

La genetica della Sindrome di Prader-Willi

La genetica della Sindrome di Prader-Willi La genetica della Sindrome di Prader-Willi Dott.ssa Milan Gabriella Laboratorio Endocrino Metabolico DIPARTIMENTO DI SCIENZE MEDICHE E CHIRURGICHE Università degli Studi di Padova Clinica Medica 3 Prader,

Dettagli

Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE

Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE TIPOLOGIA CAMPIONE n. nome TEST GENETICO metodo giorni 1 Acondroplasia

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

CITOGENETICA e CITOGENOMICA

CITOGENETICA e CITOGENOMICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE GENETICA A.A.2015/2016 Prof Alberto Turco Ma 20.10.2015 Lezioni 13 e 14 CITOGENETICA e CITOGENOMICA Candy Chromosomes Un po di storia. 1956: IDENTIFICAZIONE

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica SEZIONE DI CITOGENETICA E GENETICA MOLECOLARE DIAGNOSI PRENATALE DIAGNOSI MOLECOLARE PRE E POSTNATALE DI MALATTIE GENETICHE DIAGNOSTICA GENETICA DELLA INFERTILITA

Dettagli

Ibridazione degli acidi nucleici

Ibridazione degli acidi nucleici Ibridazione degli acidi nucleici L ibridazione consiste nel porre a contatto acidi nucleici a singolo filamento provenienti da fonti diverse: Sonda di solito una popolazione omogenea di molecole note.

Dettagli

CURRICULUM VITAE INFORMAZIONI PERSONALI. Campus Paola Maria Data di nascita 21/01/1960

CURRICULUM VITAE INFORMAZIONI PERSONALI. Campus Paola Maria Data di nascita 21/01/1960 INFORMAZIONI PERSONALI Nome Campus Paola Maria Data di nascita 21/01/1960 Qualifica Amministrazione Incarico attuale Numero telefonico dell ufficio Dirigente Biologo AZIENDA OSPEDALIERO UNIVERSITARIA Dirigente

Dettagli

Progetto sulle esostosi multiple

Progetto sulle esostosi multiple Progetto sulle esostosi multiple PROGETTO SULLE ESOSTOSI MULTIPLE EREDITARIE Dott. Leonardo D Agruma Servizio di Genetica Medica - Dipartimento dell Età Evolutiva IRCCS Ospedale Casa Sollievo della Sofferenza

Dettagli

SUMMER SCHOOL 2013 EFFETTO DELL ACIDO RETINOICO SU CELLULE PROMIELOCITICHE UMANE

SUMMER SCHOOL 2013 EFFETTO DELL ACIDO RETINOICO SU CELLULE PROMIELOCITICHE UMANE SUMMER SCHOOL 2013 EFFETTO DELL ACIDO RETINOICO SU CELLULE PROMIELOCITICHE UMANE HANNO PARTECIPATO ALL ESPERIMENTO: M. Ascari¹; N. Bucalossi²; F. Drocco³; L. Lombardino 4 ; V. Macarelli 5 ; M. Maddii 6

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso

Dettagli

La Citogenetica nella Diagnosi Prenatale

La Citogenetica nella Diagnosi Prenatale La Citogenetica nella Diagnosi Prenatale Per diagnosi prenatale si intende l insieme delle indagini strumentali e di laboratorio finalizzate ad individuare determinate patologie su base : genetica infettiva

Dettagli

Malattie genetiche e progetto genoma: a che punto siamo arrivati?

Malattie genetiche e progetto genoma: a che punto siamo arrivati? Malattie genetiche e progetto genoma: a che punto siamo arrivati? dott. Elena Belloni Gruppo di ricerca IEO: Meccanismi molecolari del cancro e dell invecchiamento (responsabile prof. Pier Giuseppe Pelicci)

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

La consulenza alla paziente che richiede l analisi del DNA fetale

La consulenza alla paziente che richiede l analisi del DNA fetale La consulenza alla paziente che richiede l analisi del DNA fetale Bertinoro, 19 Ottobre 2013 Eva Pompilii eva_pompilii@yahoo.it Limiti attuali del Non invasive Prenatal Testing/ Non Invasive Prenatal

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA CORSO INTEGRATO di Genetica e Biologia Molecolare GENETICA a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA Dott.ssa Elisabetta Trabetti POLIMORFISMO La presenza nella popolazione di due

Dettagli

Società Italiana di Genetica Umana (SIGU) LINEE-GUIDA PER LA DIAGNOSTICA CITOGENETICA

Società Italiana di Genetica Umana (SIGU) LINEE-GUIDA PER LA DIAGNOSTICA CITOGENETICA Società Italiana di Genetica Umana (SIGU) LINEE-GUIDA PER LA DIAGNOSTICA CITOGENETICA CONSENSUS 2007 1 INDICE PARTE I Aspetti generali 1. Premessa 2. Riferimenti normativi 3. Laboratorio di Citogenetica

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Cytologic, cytogenetic and genomic study of tumor stem cell lines from glioblastoma multiforme and evaluation of antineoplastic drugs effects

Cytologic, cytogenetic and genomic study of tumor stem cell lines from glioblastoma multiforme and evaluation of antineoplastic drugs effects Cytologic, cytogenetic and genomic study of tumor stem cell lines from glioblastoma multiforme and evaluation of antineoplastic drugs effects GLIOBLASTOMA CANCER STEM MULTIFORME CELLS (CSCs) (GBM) Tumore

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

cromosomi metafasici

cromosomi metafasici METODI DI STUDIO DELLA CITOGENETICA L analisi cromosomica viene condotta prevalentemente su cromosomi metafasici nello stadio di massima spiralizzazione Lunghezza del cromosoma 50.000:1 5 avvolgimenti

Dettagli

L'uso di SNP- array in diagnosi prenatale. Vanna Pecile IRCCS Burlo Garofolo Trieste

L'uso di SNP- array in diagnosi prenatale. Vanna Pecile IRCCS Burlo Garofolo Trieste L'uso di SNP- array in diagnosi prenatale Vanna Pecile IRCCS Burlo Garofolo Trieste Il cariotipo è in grado di evidenziare anomalie cromosomiche nel 8 35% di feti con malformazioni ecoevidenziate [Faas

Dettagli

Documenti Scientifici

Documenti Scientifici RICERCA SCIENTIFICA E APPLICAZIONI SANITARIE inserto redazionale Inserto redazionale di ANALYSIS n. 2/3.2007 - Documenti Scientifici SDS-Snabi 1/2007 - Direttore Responsabile: Giampiero Storti LINEE GUIDA

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY Laboratorio di Citogenetica Laboratorio di Biologia Molecolare LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY MODENA, 09 MARZO 2013 Dott.ssa Patrizia Caggiati

Dettagli

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI Ogni individuo possiede un proprio patrimonio genetico che lo rende unico e diverso da tutti gli altri. Il patrimonio genetico è costituito da

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS

scaricato da www.sunhope.it LA TECNOLOGIA DEI MICROARRAYS LA TECNOLOGIA DEI MICROARRAYS 1 8 anni dopo: 4162 riferimenti bibliografici sui microarrays I microarrays misurano il livello di espressione degli mrna trascritti dai geni del sistema biologico di interesse

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

CLASSIFICAZIONE DELLE MALATTIE GENETICHE

CLASSIFICAZIONE DELLE MALATTIE GENETICHE CLASSIFICAZIONE DELLE MALATTIE GENETICHE - Malattie Monogeniche (Mendeliane) A.D., A.R., X-L. - Malattie Cromosomiche (Anomalie di numero e di struttura) - Malattie Multifattoriali (o Poligeniche) - Malattie

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

Il ciclo cellulare La divisione cellulare

Il ciclo cellulare La divisione cellulare Il ciclo cellulare La divisione cellulare Il ciclo cellulare Meccanismo con cui si riproducono tutti gli organismi viventi La durata del ciclo varia moltissimo a seconda del tipo cellulare Cellule che

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIFETTI CONGENITI Le anomalie congenite sono condizioni che si instaurano tra il momento del concepimento e la nascita. LA DIAGNOSI PRENATALE insieme di tecniche

Dettagli

ZytoLight SPEC HER2/CEN 17 Dual Color Probe

ZytoLight SPEC HER2/CEN 17 Dual Color Probe ZytoLight SPEC HER2/CEN 17 Dual Color Probe Z-2015-200 Z-2015-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del gene umano HER2 e degli alfa-satelliti del cromosoma 17 mediante ibridazione in situ fluorescente

Dettagli

Il rischio cancerogeno e mutageno

Il rischio cancerogeno e mutageno Il rischio cancerogeno e mutageno Le sostanze cancerogene Un cancerogeno è un agente capace di provocare l insorgenza del cancro o di aumentarne la frequenza in una popolazione esposta. Il cancro è caratterizzato

Dettagli

DIAGNOSTICA FISH SU SEZIONI DI TESSUTO IN PARAFFINA: DALLA METODICA ALLA LETTURA DEI RISULTATI

DIAGNOSTICA FISH SU SEZIONI DI TESSUTO IN PARAFFINA: DALLA METODICA ALLA LETTURA DEI RISULTATI DIAGNOSTICA FISH SU SEZIONI DI TESSUTO IN PARAFFINA: DALLA METODICA ALLA LETTURA DEI RISULTATI C. BOTTA L. VERDUN di CANTOGNO Dipartimento di Scienze Biomediche ed Oncologia Umana, sezione di Anatomia

Dettagli

ZytoLight SPEC ALK/EML4 TriCheck Probe

ZytoLight SPEC ALK/EML4 TriCheck Probe ZytoLight SPEC ALK/EML4 TriCheck Probe Z-2117-200 Z-2117-50 20 (0.2 ml) 5 (0.05 ml) Per la rilevazione del riarrangiamento dei geni ALK- EML4 mediante ibridazione in situ fluorescente (FISH).... Dispositivo

Dettagli

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA

INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA INTOLLERANZA AL LATTOSIO: ESEMPIO DI BIODIVERSITA GENETICA I.P.S.I.A. Bettino Padovano Senigallia INDIRIZZO CHIMICO BIOLOGICO 2009/10 ALUNNO:MATTEO BARBARINI CLASSE: 5 TECNICO CHIMICO-BIOLOGICO DOCENTE:PROF.SSA

Dettagli

Da Gennaio 2001 ad oggi. Biogenet srl via Kennedy, 59 Rende (CS) Laboratorio specialistico di Genetica Medica

Da Gennaio 2001 ad oggi. Biogenet srl via Kennedy, 59 Rende (CS) Laboratorio specialistico di Genetica Medica C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome ALESSIA BAULEO Indirizzo VIA SANSEVERINO, 1-87040 CASTROLIBERO (CS) Telefono 0984 852680 3396970461 Fax 0984846425 E-mail bauleo@biogenet.it Nazionalità

Dettagli

APEX-array. Tecnologia di microarray basata sulla reazione APEX (Arrayed Primer Extension)

APEX-array. Tecnologia di microarray basata sulla reazione APEX (Arrayed Primer Extension) APEX-array Tecnologia di microarray basata sulla reazione APEX (Arrayed Primer Extension) APEX-array Preparazione del campione Le regioni genomiche di interesse vengono amplificate per PCR Nella mix di

Dettagli

Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015

Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 Progetto scuola-lavoro Consiglio Nazionale delle Ricerche Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 1 Vaccini a Dna Sono costituiti da un plasmide, cioè un anello di dna, di origine

Dettagli

1. Capacità di autorinnovamento illimitato

1. Capacità di autorinnovamento illimitato 1. Capacità di autorinnovamento illimitato 2. Capacità di dare origine in risposta a stimoli adeguati e specifici a cellule progenitrici di transito dalle quali discendono popolazioni di cellule altamente

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16

Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 L'immunoistochimica e' una tecnica ampiamente utilizzata per l'identificazione e la localizzazione di costituenti cellulari

Dettagli

Elenco degli esami molecolari prescrivibili e a carico del SSN

Elenco degli esami molecolari prescrivibili e a carico del SSN Fondazione IRCCS Istituto Nazionale dei Tumori 02 20133 milano - via venezian, 1 - tel. 02 23901 - telex 333290 tumist I - codice fiscale 80018230153 - partita i.v.a. 04376350155 Dipartimento di Patologia

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

CITOGENETICA CITOGENOMICA

CITOGENETICA CITOGENOMICA Corso TANDEM 2015 Genetica Umana e Medica Lezione 2 - Ven 30 gennaio 2015 Alberto Turco CITOGENETICA CITOGENOMICA 1953 La Doppia Elica! (J.Watson, F.Crick, M.Wilkins, Nobel 1962) Citogenetica: un po di

Dettagli

Domande relative alla specializzazione in: Biochimica clinica

Domande relative alla specializzazione in: Biochimica clinica Domande relative alla specializzazione in: Biochimica clinica Domanda #1 (codice domanda: n.403) : Nell'ibridazione fluorescente in situ (Fluorescent in situ hybridization "FISH"), che tipo di sonde fluorescenti

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

Esploriamo i cromosomi

Esploriamo i cromosomi Esploriamo i cromosomi Un percorso didattico per le Scuole Secondarie di Secondo Grado 1 INDICE 1. La doppia elica p. 1 2. Replicazione del DNA p. 2 3. Com è impacchettato il DNA? p. 4 4. Caratteristiche

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

ZytoLight SPEC ERG Dual Color Break Apart Probe

ZytoLight SPEC ERG Dual Color Break Apart Probe ZytoLight SPEC ERG Dual Color Break Apart Probe IVD Dispositivo medico-diagnostico in vitro Produttore: ZytoVision GmbH Codice: Z-2138-200 (0.2ml).. Per l identificazione della traslocazione che coinvolge

Dettagli

La Diagnosi Genetica Preimpianto

La Diagnosi Genetica Preimpianto CRA Centro Riproduzione Assistita - Catania www.cragroup.it 19-20-21 Giugno 2012 La Diagnosi Genetica Preimpianto Dott.ssa Raffaella Cavallaro Cos è la PGD? È una procedura ormai collaudata utilizzata

Dettagli

L ORIGINE DEI TESSUTI

L ORIGINE DEI TESSUTI L ORIGINE DEI TESSUTI Tutte le cellule dell organismo derivano dallo zigote Embrioni di topo a diversi stadi di sviluppo: A, stadio a 2 pronuclei; E, stadio a circa 16 cellule B, stadio a 2 blastomeri;

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

Che cos e la citogenetica?

Che cos e la citogenetica? Che cos e la citogenetica? Lo studio della: Struttura, funzione ed evoluzione dei cromosomi Comportamento dei cromosomi durante la divisione somatica e germinale La citogenetica nasce nel 1956 quando Tjio

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Normale controllo della crescita cellulare

Normale controllo della crescita cellulare Normale controllo della crescita cellulare STOP STOP Cellula normale STOP Alterato controllo della crescita cellulare X STOP STOP Cellula tumorale STOP X Le cellule tumorali presentano alterazioni cromosomiche

Dettagli

CORSO INTEGRATO DI GENETICA AA 2011/12. Prof Alberto Turco. Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO

CORSO INTEGRATO DI GENETICA AA 2011/12. Prof Alberto Turco. Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO CORSO INTEGRATO DI GENETICA AA 2011/12 Prof Alberto Turco Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO Definizione DPN Peculiarità - Non è richiesta dall interessato - Non correlazione

Dettagli

2. ANALISI dei CROMOSOMI

2. ANALISI dei CROMOSOMI 2. ANALISI dei CROMOSOMI Citogenetica classica - il cariotipo - allestimento di un preparato tessuti analizzabili principali patologie di numero e struttura Citogenetica molecolare tecniche di ibridazione

Dettagli

Lezione successiva in auletta 3º piano... staremo stretti! No lezione 10 gennaio 2018

Lezione successiva in auletta 3º piano... staremo stretti! No lezione 10 gennaio 2018 Lezione successiva in auletta 3º piano... staremo stretti! No lezione 10 gennaio 2018 Esercitazione di citogenetica: few notes Storia della citogenetica 1888 Waldeyer: termine cromosoma 1889 W.Fleming:

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Macromolecole Biologiche. I domini (III)

Macromolecole Biologiche. I domini (III) I domini (III) Domini α/β La cross over connection è l unità costitutiva su cui si basa la topologia di 3 tipi di domini α/β osservati nelle proteine: - α/β barrel - motivi ricchi di Leu (fold a ferro

Dettagli