l virus H1N1 dell influenza pandemica del 2009 induce una risposta anticorpale in grado di cross reagire con il virus dell influenza Spagnola del 1918

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "l virus H1N1 dell influenza pandemica del 2009 induce una risposta anticorpale in grado di cross reagire con il virus dell influenza Spagnola del 1918"


1 l virus H1N1 dell influenza pandemica del 2009 induce una risposta anticorpale in grado di cross reagire con il virus dell influenza Spagnola del 1918 Lavoro di diploma Giorgia Pucci Scuola Superiore Medico Tecnica, Locarno Svolto presso l Istituto di Ricerca in Biomedicina a Bellinzona (IRB) Responsabili: Davide Corti (PhD), Blanca M. Fernandez Rodriguez (TAB)

2 Sommario 1. Abstract Introduzione Scopo e obiettivo del lavoro Cos è l influenza Il virus Come evolvono i virus influenzali I 3 virus influenzali del mio lavoro di diploma Vaccino Materiali e metodi Emoagglutinine influenzali Cellule e batteri HUFI6 e MUFI Sieri Altre sostanze Kit di estrazione e purificazione Apparecchiature Descrizione di alcuni strumenti usati piú frequentemente nel lavoro NanoDrop (Thermo Scientific) FACS (BD Biosciences) Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza spagnola del 1928 e dell influenza stagionale del Trasformazione di E. Coli TOP 10 con A/SC e A/NC ed esecuzione di una coltura in fase liquida Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza suina del Realizzazione dei primer specifici Ottimizzazione della PCR e amplificazione del frammento relativo all emoagglutinina di A/CA/04/ Digestione enzimatica, ligazione e dialisi del vettore phcmv1 con A/CA/04/ Trasformazione di E. Coli TOP 10 con A/CA ed esecuzione di una coltura in fase liquida Settaggio della quantità di plasmide da usare nella trasfezione Lettura al FACS dei risultati ottenuti Analisi dei sieri al FACS Risultati Prima parte del lavoro Quantificazione A/SC e A/NC

3 Settaggio della PCR per A/CA Quantificazione dei campioni successivamente a digestione enzimatica Ligasi Quantificazione A/CA Setting al FACS Seconda parte del lavoro (analisi preliminari) Seconda parte del lavoro (analisi effettiva dei campioni) Discussione Prima parte del lavoro Seconda parte del lavoro (analisi preliminari) Seconda parte del lavoro (analisi effettiva dei campioni) Conclusioni Bibliografia Ringraziamenti I. Allegati... 1 I. Plasmide phcmv1 (Genlantis, San Diego CA)... 1 II. Plasmide pcdna3.1 (Invitrogen, USA)... 3 III. Sequenze delle 3 emoagglutinine in analisi nel lavoro di diploma... 4 i. HA A/CA/04/ ii. HA A/SC/1/ iii. HA A/NC/20/ IV. Confronto tra la sequenza amminoacidica delle tre emoagglutinine in analisi... 6 V. Risultati ottenuti al FACS ed elaborato con Flowjo VI. Risultati elaborati con Flowjo e rivisti con Microsoft Office Excel Tabella A Tabella B Tabella C

4 1. Abstract 1.1. Abstract in italiano 1.2.Abstract in inglese Recenti studi eseguiti sui topi hanno dimostrato che gli anticorpi sviluppati dal nostro sistema immunitario successivamente ad immunizzazione attiva o vaccinazione possono neutralizzare uno o più virus dell influenza appartenenti allo stesso tipo, fornendo così al soggetto una cross protezione. In questo studio si è quindi proposto di testare i sieri dei pazienti vaccinati nel 2009 contro l influenza suina (pandemica) con altri due virus influenzali di tipo A: il virus dell influenza pandemica A/SC/1/18 e il virus dell influenza stagionale A/NC/20/99. Si conosce inoltre che la capacità dell anticorpo di neutralizzare il virus è dovuto al legame formato tra l anticorpo stesso e l emoagglutinina (HA) presente sull envelope del virus influenzale. Pertanto si è studiata la capacità degli anticorpi presenti nei sieri dei pazienti di cross neutralizzare unicamente le HA dei virus pandemici in quanto, evolutivamente, sono quelle che presentano maggiori siti di conservazione e sono meno soggette a glicosilazioni: cosa che invece non avviene per i virus dell influenza stagionale che sono frequentemente soggetti a cambiamenti di livello strutturale delle HA. L effetto di questi siti di glicosilazione è stato dimostrato grazie all uso di un citometro a flusso (FACS), dove si sono potute visualizzare le effettive capacità dei sieri di riconoscere unicamente i virus pandemici e non quello dell influenza stagionale. Recent studies performed on rats have shown that antibodies developed by our immune system following active immunization or vaccination can neutralize one or more influenza viruses belonging to the same type. This can give the subject a cross protection. In this study it is therefore proposed to test sera of people vaccinated in 2009 against swine influenza (pandemic) with two other influenza type A virus: the influenza pandemic/sc/1/18 and seasonal influenza virus A/CN/20/99. It is known that the ability of the virus neutralizing antibody is due to the bond formed between the antibody and a region of the hemagglutinin (HA) present on the envelope of the influenza virus. The purpose of this study was to investigate the ability of the antibodies in patient sera to cross neutralize only the HA of pandemic virus because, evolutionarily, this virus has major sites of conservation which are less prone to glycosylation: which instead is not the case for seasonal influenza viruses that are frequently subject to structural changes in the level of HA. The effect of these sites of glycosylation was demonstrated using a flow cytometer (FACS), with which it was possible to view the actual capacity of sera to neutralize the virus pandemic and not seasonal flu. 4

5 2. Introduzione 2.1. Scopo e obiettivo del lavoro Questo lavoro di diploma consiste nel testare la capacità di sieri umani ottenuti successivamente all esecuzione della vaccinazione contro l influenza suina del di riconoscere emoagglutinine di un virus pandemico risalente al Infatti, gli anticorpi prodotti dal sistema immunitario, successivamente alla vaccinazione, sono ritenuti capaci di neutralizzare anche altri virus influenzali dello stesso tipo. La capacità di cross reagire verrà testata sulle emoagglutinine virali di tre virus di tipo A: A/NC/20/99 (influenza stagionale del 1999 e usato come vaccino nel periodo tra il 2000 e il 2007), A/SC/1/18 (influenza spagnola del 1918), A/CA/04/09 (influenza suina del 2009, diventato poi il virus epidemico H1N1 utilizzato nel vaccino stagionale 2010/2011) [1]. Per la prima parte del mio lavoro ho avuto a disposizione le sequenze dell emoagglutinine di due virus influenzali pandemici (spagnola e suina) e di un virus influenzale stagionale inserite all interno di due diversi plasmidi: phcmv1 (influenza stagionale e spagnola) e il vettore pcdna3 (suina). La sequenza codificante per l emoagglutinina di A/CA/04/09 è stata trasferita dal plasmide pcdna3 a phcmv1. Successivamente a quest operazione sono stati prodotti quantitativi maggiori di plasmidi phcmv1, contenenti le tre sequenze specifiche per le emoagglutinine influenzali in analisi, tramite trasformazione batterica. Lo scopo di questo passaggio è stato quello di avere a disposizione sufficiente materiale per la seconda parte del mio lavoro che consisteva nel trasfettare, con i vettori contenenti le sequenze sopra citate, una linea cellulare chiamata 293T/17 in modo che queste cellule fossero in grado di presentare sulla loro superficie le emoagglutinine dei tre virus influenzali in questione. A questo punto è stato possibile, tramite uno staining extracellulare, visualizzare con citometria a flusso l effettiva capacità degli anticorpi presenti nei sieri di cross reagire con gli antigeni in questione. In questa seconda parte sono stati utilizzati, oltre ai sieri dei pazienti vaccinati nel 2009, anche sieri dei pazienti vaccinati nel 2008 e nel 2010; in modo da rendere maggiormente visibile la risposta di cross neutralizzazione dei sieri in analisi. L obiettivo principale di questo lavoro è stato di valutare la cross reattività nella risposta anticorpale indotta dalla vaccinazione con il virus pandemico della suina (A/CA/04/09) [2] Cos è l influenza L influenza è una patologia di tipo infettivo causata da virus a RNA della famiglia degli Orthomyxoviridae [3]. Prevalentemente viene trasmessa da persona a persona tramite aerosol provenienti dalle cavità orali (naso e gola) di una persona infettata dal virus che tossisce o starnutisce; pertanto la trasmissione aerea del virus richiede uno stretto contatto tra individuo infetto e individuo sano. I primi sintomi compaiono generalmente dopo un incubazione di circa 1 2 giorni e, in questo lasso di tempo, il virus può essere eliminato nell ambiente circostante dal soggetto infettato [5]. L esordio della malattia è spesso molto brusco ed improvviso, con picchi febbrili che possono durare dai 3 ai 4 giorni. I sintomi sono solitamente: febbre (con punte che possono giungere sino ai 39.5 C), dolori muscolari ed ossei, astenia, cefalea e sintomi respiratori quali tosse, congestione nasale e mal di gola [5] [6]. In generale, la malattia 1 I sieri mi sono forniti dall Istituto San Raffaele di Milano e in parte anche dall Istituto di Ricerca di Bellinzona.

6 evolve in modo benigno senza complicanze e si risolve nell'arco di 3 6 giorni senza la necessità di effettuare terapie particolari. Tuttavia, nei bambini più piccoli, nelle persone con più di 65 anni, negli individui affetti da alcune patologie croniche, nei soggetti immunocompromessi ed in gravidanza, possono insorgere alcune complicanze anche severe [5] Il virus Figura 1: rappresentazione di un virus influenzale con le sue componenti principali (a sinistra) e rappresentazione schematica di un emoagglutinina con evidenziazione di alcune regioni caratteristiche (a destra) [27]. I virus influenzali appartengono al genere Orthomyxovirus della famiglia Orthomyxoviridaee [2] e vengono differenziati in virus di tipo A, tipo B e tipo C in base alle loro caratteristiche antigeniche. Da notare comunque che tutti e 3 i tipi di virus influenzale contengono al loro interno 8 frammenti di RNA a singola elica, ognuno codificante per differenti proteine del virus [5]. I virus influenzali di tipo A sono i patogeni più virulenti per l uomo e possono causare la sintomatologia più grave. Essi sono capaci di infettare anche un ampia varietà di mammiferi ed uccelli oltre all uomo: ad esempio cavalli, maiali e volatili domestici e selvatici. Molto spesso a questa tipologia di virus sono associate epidemie e pandemie [3]. A seconda delle glicoproteine di superficie che lo compongono, il virus di tipo A può essere ulteriormente suddiviso in sottotipi (o serotipi): 16 sottotipi di emoagglutinina (da H1 a H16) e 9 sottotipi di neuroaminidasi (da N1 a N9) [5]. Tutti i sottotipi sono stati rilevati nelle specie aviarie (in particolare nei volatili acquatici selvatici che sono ospiti naturali per una grande varietà di virus A), mentre l uomo e i mammiferi ospitano solo alcuni sottotipi: ciò sta molto probabilmente ad indicare che gli uccelli sono il serbatoio naturale del virus influenzale di tipo A [5] [6]. Nell uomo i due sottotipi maggiormente responsabili delle epidemie stagionali sono H1 e H3. Il virus di tipo B è quasi esclusivamente un patogeno umano, fatta eccezione per i pinnipedi (quali foche ed otarie) che sono gli unici animali vulnerabili conosciuti [4]. Generalmente è meno grave dell influenza di tipo A. Il ridotto tasso di mutazione antigenica, combinata con una scarsa gamma di ospiti 6

7 (che impedisce uno spostamento antigenico tra specie diverse) assicura l impossibilità di pandemie di influenza B [6]. L'influenza C infetta sia l'uomo che i suini e può causare gravi malattie ed epidemie locali [5]. Tuttavia, l'influenza C è meno comune rispetto agli altri tipi e normalmente sembra causare solo disturbi non troppo gravi nei bambini [6]. Nel suo complesso se consideriamo le caratteristiche comuni alle tre diverse tipologie di virus, abbiamo: la struttura virale di base, la particella di forma sferica ovoidale ed un involucro. Quest ultimo caratterizzato da due tipi di glicoproteine: l'emoagglutinina (HA) e la neuroaminidasi (N). Per glicoproteina s intende una proteina alla cui catena peptidica sono legate catene oligosaccaridiche definite glicani. Il glicano viene attaccato mediante un processo di modificazione genericamente definito come glicosilazione [8]. Quindi, come detto precedentemente, l emoagglutinina e la neuroaminidasi sono due glicoproteine presenti sull envelope virale; la prima è presente sull envelope di alcuni virus come per esempio il virus dell influenza ed è responsabile dell adesione del virus alla cellula destinata ad essere infettata (appartiene alla famiglia delle lectine e può provocare l agglutinazione degli eritrociti) [5]. La seconda invece è un enzima appartenente alla classe delle idrolasi. È una glicoproteina espressa tipicamente sulla superficie dei virus influenzali ed é necessaria per la penetrazione del patogeno nelle vie respiratorie; inoltre risulta essere indispensabile affinché il virus rilasciato dalle cellule infettate possa essere liberato ed infettare quindi altre cellule [5]. Il genoma del virus consiste in un singolo filamento di RNA segmentato in 8 frammenti (7 nel tipo C) che codificano per 10 proteine strutturali e non strutturali. La particolarità dei virus influenzali è la variabilità antigenica, cioè la loro capacità di cambiare il loro "identikit" rendendo più difficile il compito del sistema immunitario. Questo fenomeno è più frequente nei virus di tipo A rispetto a quelli di tipo B e mai registrato nel tipo C. Le continue modificazioni producono varianti virali verso le quali, nella popolazione a rischio, la resistenza è scarsa o assente. E' per questo che l'influenza continua a essere la maggiore patologia a carattere epidemico nell uomo, e che ogni anno cambiano i vaccini [9] Come evolvono i virus influenzali L influenza è causata da una moltitudine di specie virali che, ogni anno possono estinguersi, causare epidemie o rispettivamente pandemie. Tipicamente nelle due normali stagioni influenzali (una per emisfero), in un anno ci sono tra i 3 ed i 5 milioni di casi di malesseri gravi e fino a 500'000 decessi, che costituiscono una epidemia influenzale ogni anno. Ogni decennio o ventennio insorge una pandemia, che infetta una grande parte della popolazione mondiale e può uccidere decine di milioni di persone. A differenza dell epidemia, che colpisce una popolazione di individui delimitata sia nel numero che nella regione, la pandemia ha una diffusione geografica molto estesa ed interessa diverse aree del mondo presentando un elevato numero di morti e casi gravi [4]. La prima pandemia influenzale documentata è quella del 1918, o anche chiamata spagnola, causata dal ceppo virale H1N1. Storicamente si tratta della pandemia peggiore e causò attorno ai 50 milioni di morti. Nel corso degli anni sono state registrate altre pandemie che, benché presentino un numero di decessi minore della spagnola, non sono però da considerare meno importanti. Ben 39 anni dopo la pandemia del 1928 ci fu, nel 1957, la pandemia asiatica (H2N2), seguita poi nel 1968 dalla pandemia di 7

8 Hong Kong (H3N2) ed ai giorni nostri dall influenza suina (H1N1) o meglio definita con l acronimo SOIV (Swine Origin Influenza Virus) [10]. I nuovi virus influenzali sono prodotti costantemente da mutazioni o da riassortimento [5]. A questa continua evoluzione sono soprattutto interessati gli antigeni di superficie, in modo particolare l'emoagglutinina. I cambiamenti possono essere di due tipi: le variazioni antigeniche maggiori (antigenic shifts) e le variazioni antigeniche minori (antigenic drifts) [8]. Le antigenic shift si verificano ogni anni e soltanto nei virus di tipo A, le antigenic drift avvengono quasi annualmente sia nel virus di tipo B che in quelli di tipo A. Gli antigenic shift determinano la comparsa di nuovi virus, aventi caratteristiche antigeniche dell'emoagglutinina e/o della neuroaminidasi del tutto diverse, verso i quali la popolazione è priva di immunità. Quando si verifica il cambiamento simultaneo dei due antigeni di superficie la pandemia è particolarmente virulenta. Se invece lo shift coinvolge solo l'emoagglutinina il virus si diffonde ma, per la presenza nelle popolazioni di anticorpi anti neuroaminidasi efficaci, la malattia risulta meno grave [5]. Gli antigenic drifts, si verificano invece ogni 1 3 anni all interno di uno stesso sottotipo influenzale sia per l influenza A che per l influenza B. Tale fenomeno è determinato dalle successive mutazioni dei geni, che codificano per emoagglutinina e/o neuroaminidasi: ciò comporta cambiamenti nella sequenza aminoacidica dei siti antigenici delle proteine, di conseguenza gli anticorpi diffusi nella popolazione non riescono più a riconoscere il virus. Questo genere di mutazioni è dovuto principalmente ad errori di trascrizione da parte della polimerasi virale [5] [9]. Un ulteriore sistema adottato dal virus per potersi evolvere, e quindi evitare il riconoscimento delle sue strutture da parte del sistema immunitario, è rappresentato da differenti livelli di glicosilazione. Tutte le glicosilazioni a carico dell emoagglutinina prevedono la coniugazione di oligosaccaridi alla catena laterale dell aminoacido asparagina (le cosiddette N glicosilazioni) [8]. Figura 2: messa in evidenza dei cambiamenti a livello strutturale dell emoagglutinina con visualizzazione dei siti di glicosilazione (in blu e rispettivamente in rosso) che determinano un cambiamento per il riconoscimento da parte degli anticorpi di strutture comuni. La parte dell emoagglutinina mantenuta invariata viene rappresentata in verde [28]. 8

9 La glicosilazione rappresenta inoltre il motivo per cui i virus pandemici usati nel mio lavoro mostrano delle somiglianze a livello antigenico; pertanto risulta facilitato il riconoscimento di entrambi da parte degli anticorpi contenuti nei sieri dei pazienti vaccinati contro il SOIV. Altrettanto non si può dire invece per il virus dell influenza stagionale che presenta un maggior numero di siti glicosilati che pertanto compromettono il riconoscimento da parte del sistema immunitario [2]. Figura 3: emoagglutinine (HA) di tipo influenzale appartenenti al ceppo pandemico o stagionale. (A B) confronto tra HA dell influenza SC del 1918 con influenza stagionale NC del 1999 che evidenziano, tramite colorazione blu, i siti di glicosilazione. Come si può ben notare alla testa dell HA di tipo stagionale vi sono delle glicosilazioni che determinano la differenza della risposta immunitaria [28]. Ė inoltre importante segnalare che tutte le emoagglutinine virali presentano una regione comune che risulta essere molto conservata. Questa regione é il gambo o in inglese chiamato anche stem. La maggior parte degli anticorpi prodotti dal sistema immunitario sono diretti contro la testa dell emoagglutinina (globular head) che, come descritto in precedenza, rappresenta la regione maggiormente soggetta a mutazioni indotte dal meccanismo di antigenic drift ed è anche interessata da modificazioni nel numero e nella localizzazione dei residui oligosaccaridici. Tuttavia, recenti studi condotti all IRB 2, hanno dimostrato anche la presenza di anticorpi diretti contro la stem dell emoagglutinina in grado di neutralizzare il virus. Questi ultimi anticorpi sono stati dimostrati essere in grado di riconoscere e neutralizzare molteplici virus anche appartenenti a differenti sottotipi virali andando a costituire la cosiddetta risposta anticorpale di tipo eterosubtipico [11]. Questo tipo di risposta rappresenta soltanto una frazione minoritaria della risposta anticorpale diretta contro l emoagglutinina ed è caratterizzata da anticorpi in grado di neutralizzare il virus ma con scarsa potenza. Data comunque la maggior presenza di anticorpi diretti contro la globular head e la loro maggiore efficacia neutralizzante, gli anticorpi contenuti nei sieri dei pazienti non sono in grado di neutralizzare tutti e tre i virus influenzali (anche se la stem di questi tre virus è molto conservata) poiché diretti verso una regione della testa dell emoagglutinina non conservata nell influenza stagionale [2]. 2 Esempio uno studio condotto da Davide Corti e pubblicato nel 2010, intitolato: Heterosubtypic neutralizing antibodies are produced by individuals immunized with seasonal influenza vaccine. Citazione bibliografica [11]. 9

10 2.5. I 3 virus influenzali del mio lavoro di diploma Originariamente il virus pandemico dell influenza H1N1 è emerso nel 1918 dando poi luogo a periodici ceppi stagionali che hanno cominciato a diminuire in frequenza durante la fine degli anni cinquanta [2]. La pandemia del 1918, anche chiamata spagnola 3, uccise circa 50 milioni di persone per poi scomparire all incirca dopo 18 mesi dalla sua comparsa [3]. Nel 1977 si verificò una recrudescenza di virus H1N1, ridefinendo così i ceppi di H1N1 stagionali che sono attualmente in circolazione (come ad esempio A/NC/20/99) [2]. Questi ceppi stagionali, data la trasmissione unicamente da uomo a uomo, subiscono annualmente delle mutazioni antigeniche che li rendono ogni anno un virus nuovo che il nostro sistema immunitario fatica a riconoscere [12]. In contrasto con questi adattamenti all uomo da parte del virus, l'attuale pandemia d'influenza A (H1N1) del 2009 (risultante da vari riassortimenti nel corso degli anni con altri virus di tipo influenzale) rappresenta una trasmissione cross specie dato che il virus, precedentemente, era limitato alla specie dei suini [2]. Grazie al fatto che negli ultimi anni il virus ha usato come serbatoio i maiali, limitandone pertanto le mutazioni genetiche tra cui principalmente la glicosilazione, ha permesso al patogeno di mantenere una somiglianza di circa il 95% con gli antigeni di superficie della spagnola. Figura 4: genesi del virus dell influenza suina. Nel 1990 si è verificato un primo un riassortimento tra il virus classico della suina, il virus Nord Americano dell aviaria ed il virus umano dell H3N2 portando come risultato ad un triplo riassortimento H3N2 e H1N2 che successivamente ha continuato a circolare in Nord America come virus influenzale nella popolazione suina. Questo virus si è poi nuovamente riassortito con un quarto derivante dall Eurasia portando come risultato finale al virus della suina (SOIV) odierno [29]. 3 Nome dovuto al fatto che furono i giornali spagnoli i primi a darne notizia 10

11 Quindi la conservazione antigenica tra il virus della Spagnola ed il SOIV è alla base dell osservazione che le persone già entrate in contatto con il virus del 1918 sono in grado di cross reagire con il SOIV [12] [13]. Questo meccanismo può anche essere definito cross neutralizzazione: infatti gli anticorpi in questo caso riescono a riconoscere una struttura comune a due virus pandemici pur essendo diversi tra loro ed isolati in un lasso di tempo di 90 anni. Il sistema immunitario è in grado di contrastare tutte le varianti genetiche antigenicamente simili a quelle che in passato hanno infettato l'organismo grazie alla presenza di alcuni epitopi conservati all interno della struttura proteica dell emoagglutinina [14] [15] Vaccino I vaccini attualmente in commercio possono essere realizzati con virus interi inattivati, cioè uccisi, oppure con solo le parti fondamentali del virus in grado si stimolare il sistema immunitario. Questi vaccini vengono denominati split (a virus dissociati ) quando le particelle virali sono disaggregate mediante dei solventi, e vaccini a subunità quando sono presenti solo alcune proteine della superficie virale (emoagglutinine o neuroaminidasi) importanti per lo sviluppo della risposta immune. Questi vaccini subvirionici (split o subunità) danno un'ottima protezione e sono ben tollerati anche da soggetti particolarmente sensibili alle proteine esogene (ad esempio i bambini, gli asmatici, ecc.). Per aumentarne l immunogenicità sono stati recentemente introdotti sul mercato vaccini con nuove sostanze adiuvanti (microemulsione di squalene in acqua o liposomi). Il primo caso di vaccinazione in cui sono state effettivamente utilizzate le sostanze adiuvanti è proprio durante la pandemia del La produzione del virus avviene in uova di pollo per circa 9 12 giorni in aziende certificate e sotto rigoroso controllo veterinario [16]. Il vaccino, iniettato ai pazienti italiani di cui ho a disposizione il siero per eseguire il lavoro di diploma, si chiama Focetria 4. È costituito da un pool monovalente (MPH) di antigene di superficie inattivato del virus pandemico con una sospensione tamponata contenente essenzialmente le proteine purificate della membrana esterna, emoagglutinina (HA) e neuraminidasi (NA), di un ceppo di virus influenzale pandemico raccomandato dalla OMS UE per la pandemia 5. Contiene inoltre degli adiuvanti (microemulsionati di squalene) per aumentarne la patogenicità e dei conservanti per evitarne l immediato degrado [17]. I sieri forniti dall IRB invece sono di persone vaccinate con i seguenti vaccini: Nome Tipologia Dose A (H1N1) A (H3N2) B Influvac /2009 Stagionale 0.5 ml A/Brisbane/59/2007 Brisbane/10/2007 B/Florida/4/2006 Influvac 2009/2010 Stagionale 0.5 ml A/Brisbane/59/2007 A/Brisbane/10/2007 B/Brisbane/60/2008 Pandemrix 7 Pandemico 0.5 ml A/California/7/2009 Influvac 2010/2011 Stagionale 0.5 ml A/California/7/2009 A/ Perth/16/2009 B/Brisbane/60/ Focetria della ditta Novartis (Svizzera) 5 Virus usato: A/California/7/ Influvac della ditta Solvay (Svizzera) 7 Pandemrix della ditta GlaxoSmithKline (Svizzera); the vaccine contains an immunologic adjuvant AS03 which consists of DL α tocopherol (vitamin E), squalene and polysorbate 11

12 3. Materiali e metodi Idealmente il mio lavoro di diploma si può suddividere in due parti: la prima comprende la trasfezione di cellule specifiche in modo che riescano ad esprimere sulla superficie cellulare le emoagglutinine di interesse, ricavate a partire dalla sequenza specifica inserita all interno di un vettore plasmidico. A sua volta questa prima parte può essere ulteriormente suddivisa in due poiché i campioni, a dipendenza del plasmide in cui sono inserite le sequenze, verranno trattati in modo diverso con esperimenti specifici atti comunque a raggiungere lo scopo finale di espressione a livello cellulare delle emoagglutinine in analisi. La seconda parte consiste nel trasfettare le cellule 293T/17 e successivamente testare la capacità di sieri ottenuti dopo la vaccinazione con il virus SOIV nel 2009 e nella successiva stagione 2010/2011 di riconoscere le emoagglutinine presentate sulla superficie delle cellule trasfettate Emoagglutinine influenzali I campioni utilizzati per la trasfezione delle cellule mi sono stati forniti dall Istituto di Ricerca in Biomedicina di Bellinzona (IRB). Le sequenze codificanti per le emoagglutinine di interesse sono state inserite all interno di due diversi tipi di plasmide: la sequenza codificante per l emoagglutinina dell influenza spagnola del 1918 (A/SC/1/18) e quella per l emoagglutinina dell influenza stagionale del 1999 (A/NC/20/99) sono state inserite all interno di un plasmide phcmv1 mentre la sequenza dell emoagglutinina relativa all influenza suina del 2009 (A/CA/04/09) è stata inserita all interno del plasmide pcdna La conservazione dei campioni è avvenuta a 80 C Cellule e batteri I batteri utilizzati per il processo di trasformazione si chiamano One Shot TOP10 Chemically Competent E.Coli (Invitrogen, Svizzera). Hanno la caratteristica di avere un'alta efficienza di trasformazione ed inoltre mantengono un alta replica dei plasmidi. La conservazione è raccomandata a 80 C [18]. Per la seconda parte del lavoro ho usato le cellule chiamate HEK 293T/17. La sigla HEK sta per Human Embryonic Kidney, sono cellule aderenti, facili da far crescere e frequentemente usate per esperimenti di trasfezione. All IRB vengono tenute in coltura in incubatori a 37 C con il 5% di CO 2 e al 95% di umidità all interno di specifiche flask al quale viene aggiunto un terreno ideale per la crescita delle cellule senza che vi siano contaminazioni batteriche o fungine. Prima di essere messe in coltura le cellule sono conservate a 150 C in appositi congelatori. Figura 5: HEK 293T/17 [30]. 8 Per maggiori informazioni riguardante i plasmidi utilizzati vedi gli allegati 12

13 3.3. HUFI6 e MUFI6 Anticorpi monoclonali scoperti e prodotti all IRB in grado di riconoscere e neutralizzare tutti i sottotipi di influenza A. MUFI6 possiede una regione costante derivante da anticorpo di topo, mentre HUFI6 possiede una regione costante derivante da anticorpo di origine umana Sieri Alcuni sieri contenenti gli anticorpi sviluppati successivamente a stimolazione del sistema immunitario con la vaccinazione contro l influenza suina del 2009 sono stati forniti dall Istituto San Raffaele di Milano. Questi anticorpi sono diretti contro l emoagglutinina influenzale, presumibilmente verso la testa dell emoagglutinina che risulta inoltre essere la regione maggiormente soggetta a modificazioni ti tipo strutturale. I sieri prelevati successivamente a vaccinazione del 2008, 2009 e 2010 mi sono stati forniti dall IRB. Dall iniezione del vaccino al prelievo del siero sono trascorsi giorni. Per quanto riguarda i sieri del 2009 comprendono sia vaccinazione contro l influenza stagionale che la vaccinazione contro l influenza pandemica (suina) Altre sostanze PCR Nome prodotto Ditta Particolarità Taq DNA Polymerase recombinant Invitrogen, Switzerland 10x PCR Buffer Minus Mg2+ Invitrogen, Switzerland 50mM Magnesium Chloride Invitrogen, Switzerland 10mM dntp Invitrogen, Switzerland Primer specifici Microsynth, Switzerland Design eseguito in laboratorio con programma CLC Mainworkbench e realizzati dalla Microsynth Gel Agarosio Nome prodotto Ditta Descrizione Agarose I BioConcept, Switzerland Ethidium Bromide Solution Sigma Aldrich Blue Juice Gel Loading Buffer Invitrogen, Switzerland 100bp DNA Ladder Invitrogen, Switzerland 13

14 Digestione enzimatica e ligasi Nome prodotto Ditta Descrizione BglII New England BioLabs, USA NotI New England BioLabs, USA NEBuffer3 (10x) New England BioLabs, USA BSA New England BioLabs, USA Albumina bovina, viene usata per prevenire l adesione dell enzima al tubo di reazione o alla punta della pipette T4 DNA Ligase New England BioLabs, USA 10x Ligase Reaction Buffer New England BioLabs, USA Trasformazione degli E.Coli Top10: Nome prodotto Ditta Descrizione Bacto Agar Becton Dickinson and Company, France LB Medium Bio 101, California One Shot TOP10 Chemically Invitrogen, Switzerland Competent E.Coli SOC Medium Invitrogen, Switzerland Usato nello step finale per ottenere massima efficienza di trasformazione Kanamycin Invitrogen (GIBCO), Switzerland Trasfezione 293T/17: Nome prodotto Ditta Descrizione DMEM Invitrogen (GIBCO), Switzerland HyClone Bovine Calf Serum Thermo Scientific, USA Contiene proteine utili per le colture cellulari Trypan Blue Solution (0.4%) Sigma Aldrich, Switzerland PS (Penicillin Streptomycin) Invitrogen (GIBCO), Switzerland Fugene HD Roche, Switzerland Sostanza capace di formare dei liposomi con al loro interno il materiale genetico da introdurre all interno della cellula di interesse Tripsina Invitrogen (GIBCO), Switzerland 14

15 Analisi al FACS Nome prodotto Ditta Descrizione EDTA Invitrogen (GIBCO), Switzerland HyClone Bovine Calf Serum Thermo Scientific, USA PBS Invitrogen (GIBCO), Switzerland DyLight 649 Conjugated Affini Pure F(ab ) 2 Fragment Goat Anti Human IgG, Fc, Fragment Specific Jackson Immuno Research, Inc. Anticorpo secondario, si lega alla regione Fc dell anticorpo primario. Dotato di fluoroforo. ELISA Nome del prodotto Ditta Descrizione BSA New England BioLabs, USA PBS Invitrogen (GIBCO), Switzerland Goat Anti Human IgG AP Jackson Immuno Research, Inc 4 Nitrophenyl phosphate Sigma Aldrich, Switzerland Substrato disodium salt hexaydrate Bicarbonate Buffer Realizzato in Istituto 3.6. Kit di estrazione e purificazione Nucleo Spin Plasmid (Macherey Nagel, Switzerland) GFX PCR DNA and Gel Purification kit (GE Healthcare, Switzerland) 3.7. Apparecchiature T3000 Thermocycler (Biolabo Scientific Instruments, Switzerland) Camera elettroforetica (Witec Ag, Switzerland) PCR Cabinet (Witec Ag, Switzerland) Fluorescent Tables (Techne, Switzerland) Nanodrop Spectrophotometer ND 1000 (Thermo Scientific, USA) FACS Calibur e FACS Canto Centrifuge 5415 D e 5810 R (Eppendorf, Switzerland) Thermomixer compact (Eppendorf, Switzerland) Vortex Genie 2 (Scientific Industries Inc., USA) Forma Series II Water Jacketed CO 2 Incubator (Thermo Scientific, USA) Agitatore e piastra riscaldante (IG Instrumenten Gesellschaft AG, Switzerland) Bunsen Fireboy Plus (IBS Integra Biosciences, Switzerland) 15

16 3.8. Descrizione di alcuni strumenti usati piú frequentemente nel lavoro NanoDrop (Thermo Scientific) Il NanoDrop, della ditta Thermo Scientific, è uno spettrofotometro ( nm) capace di analizzare dei volumi molto piccoli di campioni da quantificare (fino a 0.5 μl) mantenendo un elevata accuratezza e riproducibilità [19]. Questa apparecchiatura utilizza una tecnologia brevettata, basata sulla tensione superficiale che piccoli volumi di liquidi esercitano quando si trovano collocati tra due superfici vicine. In poche parole la goccia di campione posizionata nell apposita piastra di lettura crea una colonna di liquido a diretto contatto con due fibre ottiche, e può essere analizzata in modo semplice e veloce. Questo elimina la necessità di cuvette ed altri dispositivi di contenimento del campione e permette di pulire in pochi secondi le due superfici entrate in contatto con il campione. Inoltre, il NanoDrop ha la capacità di misurare i campioni ad alta concentrazione, senza diluizione (50x concentrazione superiore a quello campioni misurati con uno spettrofotometro cuvetta standard) [19] [20]. La visualizzazione dei risultati può essere effettuata al computer tramite dei grafici e dei rapporti che mi permettono di determinare il grado di purezza del campione oltre alla sua quantificazione [20]. Figura 6: visualizzazione di come si vedono le immagini allo schermo del computer [31]. Nel mio caso ciò che interessa maggiormente è la possibilità di quantificare gli acidi nucleici successivamente all esecuzione di una PCR o di una purificazione, determinandone anche il grado di purezza e verificando pertanto la presenza o l assenza di contaminazioni proteiche (rapporto A 260/280 maggiore o uguale a ) [20]. 16

17 FACS (BD Biosciences) Il FACS, o anche denominato citometro a flusso, è un apparecchio che unisce le caratteristiche di uno strumento contaglobuli a quello di un microscopio a fluorescenza [21]. Le cellule da contare vengono marcate con appositi fluorocromi che, una volta colpiti dal raggio laser presente nella camera di conta, vengono eccitati emettendo una ben determinata fluorescenza rilevabile con appositi detettori posizionati all interno dello strumento. La camera di conta può essere definita come un blocco di quarzo scavato all interno per formare un capillare in cui le cellule, immerse nel liquido di trascinamento, passano singolarmente per poi essere colpite dal fascio laser. La capacità del fluido di separarle è definita focalizzazione idrodinamica [22]. A B Figura 7: (A) foto dell'imbuto che grazie alla focalizzazione idrodinamica indirizza le cellule nel capillare che a sua volta entra all'interno della camera di conta dove i fluorocromi verranno eccitati. (B) fascio laser indirizzato dai vari prismi verso il punto di incontro delle particelle [32]. In generale il primo laser, che colpisce le cellule nella camera di conta, ha una lunghezza d onda di 488 nm (colore blu). Per colpire le cellule deve passare attraverso una serie di prismi e lenti che lo indirizzano verso il punto esatto d incontro delle particelle; a sua volta la luce diffusa dalle particelle viene convogliata, attraverso un sistema di fibre ottiche, in un sistema di filtri capace di separare le varie lunghezze d onda generate dai fluorocromi utilizzati. I filtri in questione sono specifici unicamente per determinate lunghezze d onda infatti se non corrisponde quest ultima viene riflessa. Ci sono i filtri "Long Pass (LP)" che si lasciano attraversare solo da lunghezze d'onda superiori a quella fissata e riflettono tutto ciò che possiede una lunghezza d'onda inferiore; i filtri "Band Pass (BP)" che si lasciano attraversare solamente da lunghezze d'onda comprese tra due valori fissati, ed i filtri "Short Pass (SP)" che si lasciano attraversare da lunghezze d'onda inferiori a quella fissata e riflettono tutto ciò che possiede una lunghezza d'onda superiore [23]. Pertanto la scelta dei fluorocromi da utilizzare per detettare le varie particelle viene applicata seguendo la configurazione dello strumento e quindi in base al sistema di laser e di filtri di cui è composto [21]. 17

18 3.9. Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza spagnola del 1928 e dell influenza stagionale del Trasformazione di E. Coli TOP 10 con A/SC e A/NC ed esecuzione di una coltura in fase liquida Prima di iniziare l esperimento l IRB mi ha fornito i plasmidi contenenti le sequenze per le due emoagglutinine in analisi che successivamente sono stati quantificati con l apparecchio Nanodrop. Questa misura mi ha permesso di determinare il corretto volume di soluzione contenente plasmide da utilizzare per la trasformazione degli E. Coli Top10; infatti secondo il protocollo fornito dalla ditta Invitrogen il quantitativo massimo di DNA consigliato è 100 ng. Come primi campioni mi sono stati forniti: la sequenza dell emoagglutinina della spagnola A/SC/1/18 e quella dell influenza stagionale A/NC/20/99; tutte inserite correttamente all interno del vettore phcmv1. Seguendo il protocollo fornito dalla ditta Invitrogen ho trasformato i batteri allo scopo di poter realizzare una prima coltura su piastra dei due campioni. Questo mi ha permesso di amplificare il numero di plasmidi contenenti l inserto di interesse. Per trasformare i batteri ho utilizzato lo shock termico: in poche parole si tratta di portare i batteri da 4 C circa a 42 C in qualche secondo. Questo permette alla parete batterica di diventare permeabile formando delle specie di pori che consentono l entrata del DNA plasmidico all interno del battere. Successivamente per permettere la chiusura dei pori bisogna riposizionare la Eppendorf in ghiaccio per alcuni minuti. Alla fine i batteri vengono incubati per circa 1h a 37 C in modo che possano attivare il loro metabolismo iniziando a riprodursi. Dopo questo lasso di tempo si può inoculare una ben determinata quantità di batteri in piastre selettive contenenti l antibiotico specifico (nel mio caso il plasmide phcmv1 contiene il gene di resistenza alla kanamicina) e lasciarle incubare overnight (circa 12 ore) a 37 C in modo che le colonie possano crescere. Il giorno successivo saranno cresciuti unicamente i batteri che si sono trasformati, e cioè quei batteri che hanno inglobato al loro interno il plasmide avente la resistenza alla kanamicina. Questo purtroppo non vuol dire però che il plasmide debba contenere per forza l inserto codificante per la mia emoagglutinina di interesse; infatti può capitare che durante la ligasi il plasmide si sia richiuso su se stesso non formando quindi un legame con la sequenza dell emoagglutinina. Successivamente si è deciso di proseguire con una coltura in fase liquida di medie dimensioni (160 ml) in modo da amplificare maggiormente la quantità di plasmide a disposizione. Questa coltura è rimasta in incubazione nella camera tutta la notte su un apposito agitatore regolato a 225 rpm. Il giorno successivo con l ausilio del kit Nucleo Spin Plasmid (Macherey Nagel, Svizzera) si è eseguito l estrazione del materiale plasmidico dal battere. Il protocollo utilizzato e quello specifico per le colture in fase liquida di medie dimensioni Xtra Midi (colture comprese tra i 40 e i 400 ml). Successivamente a questo passaggio si è quantificato il materiale genetico estratto con l ausilio del Nanodrop. I campioni sono stati stoccati in apposite Eppendorf (DNA RNA Free) da 1.5 ml e messi in congelatore a 80 C per conservarli fino al prossimo utilizzo. 18

19 3.10. Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza suina del Realizzazione dei primer specifici La sequenza per l HA relativa all influenza suina é stata inserita all interno di un plasmide chiamato pcdna3.1. Per evitare l aggiunta di variabili all esperimento si é deciso di cambiare il plasmide di inserzione e utilizzare phcmv1 come per i campioni precedenti. Per fare ciò sono stati realizzati dei primer su misura contenenti la sequenza di taglio per un enzima di restrizione specifico presente anche all interno del plasmide phcmv1, proprietà che verrà sfruttata negli esperimenti successivi. Questi primer sono in grado di legarsi in parte alla sequenza della mia emoagglutinina ed in parte invece, a partire dal sito di taglio per l enzima di restrizione non sono complementari e pertanto sono liberi. Le sequenze dei primer sono quindi (design realizzato all IRB con software CLC Mainworkbench mentre la sintesi é stata eseguita dalla ditta Microsynth): FW primer con sequenza di taglio per BglII 5 TCGTGAGATCTATGAAGGCAATACTAGTAGTTCTGCTATATA 3 RV primer con sequenza di taglio per NotI 5 GGGTCTCTACAGTGTAGAATATGTATTGCGGCCGCTCATAC 3 Per quanto riguarda la sequenza dei primer In grassetto sono segnalate delle sequenze che non si appaiano né al plasmide né all emoagglutinina In giallo sono evidenziate le sequenze di taglio per gli enzimi di restrizione, mentre in verde é segnalata l inizio della sequenza codificante per gli amminoacidi che compongono l emoagglutinina di interesse Ottimizzazione della PCR e amplificazione del frammento relativo all emoagglutinina di A/CA/04/09 Il setting della PCR é stato eseguito provando diverse temperature di anneal dei primer e diverse concentrazioni di DNA. La temperatura migliore per l anneal é risultata essere 60 C mentre la concentrazione di DNA ideale è di 150 ng. Si è quindi proseguito con l amplificazione e l estrazione del frammento di interesse da pcdna3.1. Successivamente é stato realizzato un gel di agarosio all 1% per poter visualizzare e tagliare la banda relativa alla sequenza amplificata grazie al confronto della taglia con un Marker di 100bp. Con l uso degli UV e di un bisturi é stata selezionata la banda di interesse per poi essere successivamente purificata dal gel con apposito kit chiamato GFX PCR DNA and Gel Purification kit (GE Healthcare, Svizzera). A questo punto é stato quantificato con Nanodrop il campione ottenuto Digestione enzimatica, ligazione e dialisi del vettore phcmv1 con A/CA/04/09 La digestione enzimatica é stata eseguita in contemporanea sia sulla sequenza codificante per l emoagglutinina del virus A/CA/04/09 selezionata e purificata nell esperimento precedente, sia sul plasmide phcmv1 senza inserto in modo da creare le zone di coesione utili nella reazione di ligasi. 19

20 L incubazione avviene per 1 ora a 37 C e successivamente gli enzimi vengono inattivati per 20 minuti a 65 C. Una volta eseguita questa reazione bisogna procedere con una purificazione del prodotto da tutti i reagenti che possono interferire con la ligazione successiva. Questo avviene grazie all uso del kit GFX PCR DNA and Gel Purification kit (GE Healthcare, Svizzera). Successivamente bisogna eseguire una quantificazione del prodotto con Nanodrop; utile per la determinazione del quantitativo di campione da pipettare nella provetta di reazione. Per la determinazione della concentrazione ideale di plasmide e inserto da utilizzare ho usufruito di tre modi diversi di calcolo. Il primo proviene dal sito internet della New England Bio Labs (USA) mentre il secondo e il terzo sono delle formule che mi sono stati forniti in laboratorio ed in cui l unica differenza consiste in un fattore numerico. Così sono state realizzate tre diverse provette di reazione con le tre diverse concentrazioni di inserto e vettore calcolate con i tre metodi; in questo modo è stato possibile determinare la tecnica migliore. Sono poi stati aggiunti i rispettivi reagenti, tra cui l enzima T4 DNA ligase, ed il tutto é rimasto in incubazione per 1 ora a temperatura ambiente. Per poter selezionare i plasmidi aventi l inserto è stata eseguita una PCR successivamente all esecuzione di una trasformazione batterica e una coltura su piastre selettive. I primer utilizzati per questa PCR sono gli stessi realizzati per l estrazione della sequenza codificante per l emoagglutinina di A/CA/04/09 dal vettore plasmidico pcdna3. Le condizioni di PCR sono invariate rispetto a quelle prestabilite durante l ottimizzazione eseguita nel capitolo Trascorsa l ora di incubazione é stata eseguita una dialisi, con membrana da 0.05 µm (Millipore, Svizzera), di 30 minuti per eliminare tutti i reagenti ed i sali utilizzati nella ligasi e che potrebbero disturbare nella prossima reazione; che sarebbe la trasformazione batterica Trasformazione di E. Coli TOP 10 con A/CA ed esecuzione di una coltura in fase liquida Lo scopo ed i procedimenti di questo esperimento sono gli stessi che per A/SC e A/NC; infatti anche in questo caso si inizia con una trasformazione batterica e successivamente una coltura su piastra contenente l antibiotico kanamicina per selezionare tutti quei batteri che sono stati trasformati correttamente e contengono al loro interno phcmv1 con la resistenza specifica. L unica differenza consiste nello step successivo: dopo aver messo in coltura i batteri si preleva un determinato quantitativo dalla colonie cresciute e si esegue una PCR. Questo ci permette di discriminare le colonie che contengono unicamente il plasmide da quelle che contengono il plasmide con l inserto. Una volta selezionate le colonie di interesse si preparano delle colture in fase liquida (nelle beute) di medie dimensioni in modo da amplificare maggiormente la quantità di plasmide avente l inserto. Questa coltura è rimasta in incubazione nella camera tutta la notte su un apposito agitatore regolato a 225 rpm. Con il resto della colonia è stato preparato uno stock in glicerolo che poi, una volta messo in azoto liquido, è stato immediatamente stoccato a 80 C. Il giorno successivo si è proseguito con l estrazione del materiale plasmidico dai batteri posti nella coltura di medie dimensioni grazie all uso del kit Nucleo Spin Plasmid (Macherey Nagel, Svizzera) ed alla fine si é quantificato il prodotto ottenuto dall estrazione con l uso del Nanodrop. I campioni sono stati stoccati in apposite Eppendorf da 1.5 ml e messi in congelatore a 80 C per conservarli fino all uso. 20

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica



PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi


A cura del dr. Giovanni Piu

A cura del dr. Giovanni Piu A cura del dr. Giovanni Piu INFLUENZA Parola derivata dalla lingua Italiana, perché si supponeva che la malattia fosse dovuta all influenza climatica svolta da una sfavorevole congiunzione astrale. E una


Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio


Malattie infettive a trasmissione aerea

Malattie infettive a trasmissione aerea Ogni anno, immancabilmente, si ripete un incontro puntuale quanto indesiderato... quello fra l uomo ed i virus influenzali Malattie infettive a trasmissione aerea Ambiente: densità della popolazione occasioni


Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione





Influenza Suina - definizione. Influenza suina. Caratteristiche del Virus. Nomenclatura

Influenza Suina - definizione. Influenza suina. Caratteristiche del Virus. Nomenclatura Influenza Suina - definizione Influenza suina Malattia infettiva, contagiosa, ad andamento acuto Caratterizzata da sintomi respiratori Eziologia virale Orthomyxoviridae Influenza virus tipo A I nfluenzavirus


Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!


Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana


Esperienza 14: il test ELISA

Esperienza 14: il test ELISA Esperienza 14: il test ELISA La tecnica di dosaggio immuno-assorbente legato a un enzima (in inglese Enzyme-Linked Immuno Assay) o ELISA è principalmente utilizzato in immunologia al fine di rilevare e/o


Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16

Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 Laboratorio di Tecniche Microscopiche AA 2007-2008 Lezione 12 Marzo 2008 Ore 15-16 L'immunoistochimica e' una tecnica ampiamente utilizzata per l'identificazione e la localizzazione di costituenti cellulari


Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi


PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in


Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale



SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo


Orthomyxovirus. G. Di Bonaventura Università di Chieti-Pescara

Orthomyxovirus. G. Di Bonaventura Università di Chieti-Pescara G. Di Bonaventura Università di Chieti-Pescara Caratteri generali I virus dell influenza A, B, C sono gli unici membri della Famiglia Orthomyxoviridae Tutti patogeni per l uomo (A anche per animali) Virione


Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).


INFLUENZA E VACCINAZIONE ANTINFLUENZALE (Campagna vaccinale antinfluenzale 2015-2016)

INFLUENZA E VACCINAZIONE ANTINFLUENZALE (Campagna vaccinale antinfluenzale 2015-2016) INFLUENZA E VACCINAZIONE ANTINFLUENZALE (Campagna vaccinale antinfluenzale 2015-2016) L influenza è un infezione respiratoria provocata da un virus. È molto contagiosa, perché si trasmette facilmente attraverso


TOSSICOLOGIA. TOSSICO Ogni sostanza capace di provocare in un organismo modificazioni funzionali DANNOSE mediante una azione fisica o chimica.

TOSSICOLOGIA. TOSSICO Ogni sostanza capace di provocare in un organismo modificazioni funzionali DANNOSE mediante una azione fisica o chimica. TOSSICOLOGIA COS E UN FARMACO? - ogni sostanza capace di provocare in un organismo modificazioni funzionali mediante un azione fisica o chimica. - Per l OMS è farmaco una sostanza o un prodotto utilizzato


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando


Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA



ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo INTRODUZIONE Acidi nucleici Gli acidi nucleici sono una famiglia eterogenea di macromolecole distribuite all interno di tutte le cellule


Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015

Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 Progetto scuola-lavoro Consiglio Nazionale delle Ricerche Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 1 Vaccini a Dna Sono costituiti da un plasmide, cioè un anello di dna, di origine


Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)


Febbre del Nilo occidentale (West Nile Virus - WNV)

Febbre del Nilo occidentale (West Nile Virus - WNV) FSME (Frühsommermeningoenzephalitis) Febbre del Nilo occidentale (West Nile Virus - WNV) 95 West Nile Virus Foto: CNN Febbre del Nilo occidentale (West Nile Virus - WNV) DEFINIZIONE La febbre del Nilo


Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona


ITIS Marconi - Padova Esame di Stato 2011/2012. Tesina sperimentale NEURAMINIDASI E FARMACI ANTI-INFLUENZALI

ITIS Marconi - Padova Esame di Stato 2011/2012. Tesina sperimentale NEURAMINIDASI E FARMACI ANTI-INFLUENZALI ITIS Marconi - Padova Esame di Stato 2011/2012 Tesina sperimentale NEURAMINIDASI E FARMAI ANTI-INFLUENZALI andidato: Marcello Dolano 5 I Relatore: prof. Mauro Tonellato NEURAMINIDASI E FARMAI ANTI-INFLUENZALI


4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio?

4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio? Dipartimento federale dell'interno DFI Ufficio federale della sanità pubblica UFSP Malattie trasmissibili Stato al 05.10.2010 FAQ Influenza stagionale 1. Cos è l influenza? 2. Come si trasmette l influenza?



TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi


WITNESS DIROFILARIA. Dirofilaria immitis.

WITNESS DIROFILARIA. Dirofilaria immitis. WITNESS DIROFILARIA WITNESS DIROFILARIA INFORMAZIONI GENERALI La dirofilariosi cardiaca del cane è una malattia a diffusione mondiale ed è causata da un nematode filariforme denominato Dirofilaria immitis.



RISCHI DA AGENTI BIOLOGICI RISCHI DA AGENTI BIOLOGICI definizione Rischio da agenti biologici Si sviluppa in seguito all esposizione a microorganismi: BATTERI VIRUS PARASSITI .Le malattie infettive Il rapporto che l agente infettivo


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti



PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per


L influenza. stagionale

L influenza. stagionale Questo opuscolo vuole fornire alcune informazioni pratiche per avere una visione corretta ed equilibrata di un fenomeno, quello dell influenza aviaria, che al momento attuale sta determinando un inutile


PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA



INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT INFEZIONE DA HIV ED AIDS HIV 1 ed HIV 2 appartengono alla famiglia dei Retroviridae, genere lentovirus. L infezione da HIV provoca nell ospite una progressiva compromissione delle difese immunitarie, soprattutto


PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you


Influenza suina A/H1N1v Raccomandazioni alle persone con fibrosi cistica

Influenza suina A/H1N1v Raccomandazioni alle persone con fibrosi cistica Influenza suina A/H1N1v Raccomandazioni alle persone con fibrosi cistica Informazioni generali La nuova influenza A(H1N1) è un infezione virale acuta dell'apparato respiratorio con sintomi fondamentalmente


DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza


Servizio colture primarie. Istruzioni per l uso di cellule epiteliali bronchiali umane

Servizio colture primarie. Istruzioni per l uso di cellule epiteliali bronchiali umane Servizio colture primarie Istruzioni per l uso di cellule epiteliali bronchiali umane Riassunto del procedimento Il metodo di coltura è basato su due fasi distinte: 1) Espansione del numero di cellule:


Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari


Misura della concentrazione intracellulare di ioni calcio con tecniche di video-imaging

Misura della concentrazione intracellulare di ioni calcio con tecniche di video-imaging Misura della concentrazione intracellulare di ioni calcio con tecniche di video-imaging Lo ione Calcio è il catione più abbondante nel corpo umano La concentrazione intracellulare di Calcio è bassa (100


Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione

Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione Protocollo di laboratorio per la purificazione manuale del DNA a partire da 0,5 ml di campione Per la purificazione del DNA genomico proveniente dai kit di prelievo Oragene e ORAcollect. Per le istruzioni


FAQ Influenza stagionale

FAQ Influenza stagionale Dipartimento federale dell'interno DFI Ufficio federale della sanità pubblica UFSP Malattie trasmissibili Stato al 17.09.2013 FAQ Influenza stagionale 1. Cos è l influenza? 2. Come si trasmette l influenza?





Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS


A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.)

A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.) A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.) Si espongono, per opportuna conoscenza, gli ultimi aggiornamenti disponibili al 12/10/2014


Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare


III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA


Donatella Nava Istituto Zooprofilattico Sperimentale del Mezzogiorno

Donatella Nava Istituto Zooprofilattico Sperimentale del Mezzogiorno Donatella Nava Istituto Zooprofilattico Sperimentale del Mezzogiorno Definizione La citrometria a flusso è un metodo di conteggio, ed eventualmente di selezione e isolamento, di elementi corpuscolati (cellule)


Per la conservazione viene aggiunta sodio azide a una concentrazione finale inferiore allo 0,1 %.

Per la conservazione viene aggiunta sodio azide a una concentrazione finale inferiore allo 0,1 %. Scheda Tecnica 0123 Technical File No.: 46 Prodotto: Categoria di prodotto secondo la classificazione CE: Anti-Xga coombsreactive Policlonale, umano IgG Allegato III Autocertificazione del produttore Struttura


Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale


Estrazione del DNA. 1. Introduzione

Estrazione del DNA. 1. Introduzione Estrazione del DNA 1. Introduzione L obiettivo di questa esperienza è quello di osservare la molecola degli acidi nucleici, una volta separata dall involucro cellulare in cui è contenuta all interno della


Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio


- Polimeri biodegradabili

- Polimeri biodegradabili POSSIBILI PRODOTTI - Anticorpi - Proteine di interesse farmaceutico - Vaccini edibili - Metaboliti secondari - Polimeri biodegradabili Produzione di Anticorpi SISTEMI DI ESPRESSIONE - Cellule di mammifero


Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è


Bollettino Epidemiologico n. 78. L Influenza Aviaria e il timore di una pandemia

Bollettino Epidemiologico n. 78. L Influenza Aviaria e il timore di una pandemia Dipartimento di Prevenzione E & P ASL - Benevento Bollettino Epidemiologico n. 78 Servizio Epidemiologia e Prevenzione - Tel. 0824-322240 - Fax 0824-23154 - e-mail sep@aslbenevento.it L Influenza Aviaria



ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni


Tecniche di studio in Biologia Cellulare. - Colture cellulari. - Gi an-corpi: policlonali e monoclonali

Tecniche di studio in Biologia Cellulare. - Colture cellulari. - Gi an-corpi: policlonali e monoclonali - Colture cellulari - Gi an-corpi: policlonali e monoclonali - Tecniche morfologiche: la microscopia - Colorazioni e immunocitochimica - Microscopia o?ca: a campo chiaro, a fluorescenza (confocale) - Microscopia


04/05/2009 DEFINIZIONE DIFFUSIONE E TRATTAMENTO. Corso di laurea in Biologia Indirizzo Biologia Sanitaria Corso di Igiene.

04/05/2009 DEFINIZIONE DIFFUSIONE E TRATTAMENTO. Corso di laurea in Biologia Indirizzo Biologia Sanitaria Corso di Igiene. UNIVERSITÀ DEGLI STUDI DI SALERNO Corso di laurea in Biologia Indirizzo Biologia Sanitaria Corso di Igiene L influenza Prof. P. Cavallo 1 DEFINIZIONE Malattia prevalente dell apparato respiratorio (naso,


Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni


ALLERGENI: Metodi & Analisi

ALLERGENI: Metodi & Analisi ALLERGENI: Metodi & Analisi 1 PARLEREMO DI Allergeni (definizioni e classificazioni) Normativa e limiti di legge R&C Lab e gli allergeni Metodi e tecniche analitiche applicate 2 Allergeni (definizioni



LE PIANTE COME BIOREATTORI LE PIANTE COME BIOREATTORI POSSIBILI PRODOTTI - Anticorpi - Proteine di interesse farmaceutico - Vaccini edibili - Metaboliti secondari - Polimeri biodegradabili Produzione di Anticorpi SISTEMI DI ESPRESSIONE


3 anni di garanzia (estesi a 5 con registrazione via web) F1 a volume variabile - singolo canale

3 anni di garanzia (estesi a 5 con registrazione via web) F1 a volume variabile - singolo canale Finnpipette F1 & F2 Facili da usare ed estremamente leggere. In più con 5 anni di garanzia. Performance d eccellenza, altissima ripetibilità. Puntali VWR Collection Compatti, tracciabili ed ecologici Le


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione


Effetti di correnti ad alta frequenza e bassa intensità: biostimolazione e rigenerazione cellulare

Effetti di correnti ad alta frequenza e bassa intensità: biostimolazione e rigenerazione cellulare UNIVERSITA DEGLI STUDI DI PADOVA Dipartimento di Anatomia e Fisiologia Umana Department of Human Anatomy and Physiology Effetti di correnti ad alta frequenza e bassa intensità: biostimolazione e rigenerazione


Progetto della classe II C

Progetto della classe II C Progetto della classe II C Preparazione allo svolgimento dell esperienza La II C è preparata all esperienza presso il centro di ricerca E.B.R.I. iniziando un intenso lavoro di approfondimento sulla genetica


Prevenzione e controllo dell influenza, raccomandazioni per la stagione 2012-2013. Fonte: Ministero della salute

Prevenzione e controllo dell influenza, raccomandazioni per la stagione 2012-2013. Fonte: Ministero della salute Prevenzione e controllo dell influenza, raccomandazioni per la stagione 2012-2013 Fonte: Ministero della salute Vaccinazione influenzale al via da metà ottobre, con l obiettivo di vaccinare il 95 per cento


U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario


13. Life Sciences Sommario

13. Life Sciences Sommario GENERAL CATALOGUE EDITION 8. Life Sciences Sommario Genomica 6 PCR 6 DNA-Elettroforesi 9 Gel-Documentation Filtrazione, Concentrazione 8 Proteomica ELISA Proteine-Elettroforesi 60 Blotting 6 Purificazione



SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:





CERCASI ENZIMA. I.T.S.E. Cecilia DEGANUTTI ALUNNI: Bogojevic Lidija De Stefano Davide Gabara Mihai Andrei Stoian Ioana Versolatto Sara

CERCASI ENZIMA. I.T.S.E. Cecilia DEGANUTTI ALUNNI: Bogojevic Lidija De Stefano Davide Gabara Mihai Andrei Stoian Ioana Versolatto Sara I.T.S.E. Cecilia DEGANUTTI CERCASI ENZIMA ALUNNI: Bogojevic Lidija De Stefano Davide Gabara Mihai Andrei Stoian Ioana Versolatto Sara INSEGNANTE: Prof.ssa Cinello Eugenia TECNICO LABORATORIO: Finiello


UNIVERSITÀ - OSPEDALE di PADOVA MEDICINA NUCLEARE 1. Medicina Nucleare in Vitro o metodiche radionuclidiche non imaging.

UNIVERSITÀ - OSPEDALE di PADOVA MEDICINA NUCLEARE 1. Medicina Nucleare in Vitro o metodiche radionuclidiche non imaging. UNIVERSITÀ - OSPEDALE di PADOVA MEDICINA NUCLEARE 1 Medicina Nucleare in Vitro o metodiche radionuclidiche non imaging Lezione 7: Generalità à sul RIA D. Cecchin, F. Bui Diverse tipologie di RIA? 1) DOSAGGIO


Azienda Ospedaliero Universitaria Cagliari Servizio Provveditorato ed Economato. Via Ospedale, 54 09124 Cagliari Tel. 070/6092130 - Fax 070/6092288

Azienda Ospedaliero Universitaria Cagliari Servizio Provveditorato ed Economato. Via Ospedale, 54 09124 Cagliari Tel. 070/6092130 - Fax 070/6092288 Capitolato Tecnico Caratteristiche generali valide per fornitura in oggetto: Offerta tecnica 1.strumentazione la Ditta dovrà indicare la strumentazione che intende proporre che deve essere nuova di ultima


ALLEGATO A CAPITOLATO TECNICO. Art. n. 1 Oggetto e quantità della fornitura



La malattia di Aujeszky: aspetti diagnostici

La malattia di Aujeszky: aspetti diagnostici La malattia di Aujeszky: aspetti diagnostici Stefano Nardelli Istituto Zooprofilattico Sperimentale delle Venezie Isola della Scala (VR) 10.05.2011 STORIA (1813) (1902) (1934) prima descrizione USA prurito


Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente


ZytoLight SPEC ERG Dual Color Break Apart Probe

ZytoLight SPEC ERG Dual Color Break Apart Probe ZytoLight SPEC ERG Dual Color Break Apart Probe IVD Dispositivo medico-diagnostico in vitro Produttore: ZytoVision GmbH Codice: Z-2138-200 (0.2ml).. Per l identificazione della traslocazione che coinvolge


Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita.

Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. Elettroforesi Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. A qualunque ph diverso dal pi le proteine hanno una carica netta quindi,


Avvio della Campagna di Vaccinazione antinfluenzale 2015-16, a Trieste

Avvio della Campagna di Vaccinazione antinfluenzale 2015-16, a Trieste Avvio della Campagna di Vaccinazione antinfluenzale 2015-16, a Trieste dott.fulvio Zorzut Direttore S.C. Igiene Sanità Pubblica Prevenzione Ambientale Dipartimento di Prevenzione di Trieste La Campagna





Microscopio convenzionale

Microscopio convenzionale Microscopio convenzionale 160 mm 195 mm 45 mm Midollo osseo normale Anti-kappa vs. Anti-lambda DEFINIZIONI Citometria a flusso Metodologia per misurare le proprietà di cellule in flusso Cell Sorting Separazione


R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale


Io mi proteggo dall influenza. Vaccinazione anti-influenzale: cosa è necessario conoscere.

Io mi proteggo dall influenza. Vaccinazione anti-influenzale: cosa è necessario conoscere. Io mi proteggo dall influenza Vaccinazione anti-influenzale: cosa è necessario conoscere. Anche quest anno, con l approssimarsi della stagione fredda, è arrivato il momento di vaccinarsi contro l influenza.


La determinazione quantitativa in microbiologia

La determinazione quantitativa in microbiologia La determinazione quantitativa in microbiologia La determinazione quantitativa è una tecnica microbiologica che permette di verificare il numero di microrganismi presenti in un campione, per unità di peso


ADHD, DAT ed autoimmunità: un possibile marker diagnostico e un innovativo target per il trattamento. Relatore Prof.

ADHD, DAT ed autoimmunità: un possibile marker diagnostico e un innovativo target per il trattamento. Relatore Prof. UNIVERSITA DEGLI STUDI DI ROMA TOR VERGATA Facoltà di Medicina e Chirurgia Scuola di Specializzazione in Neuropsichiatria Infantile Direttore Prof. Paolo Curatolo ADHD, DAT ed autoimmunità: un possibile



PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi


Introduzione. Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito

Introduzione. Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito Colture Cellulari Introduzione Colture cellulari in vitro: cellule isolate dal loro ambiente e messe in condizioni di vivere all'interno di un sistema definito strumento fondamentale per studi biochimici,


Regione cerniera monomero regione cerniera

Regione cerniera monomero regione cerniera Regione cerniera Tutte le Ig, sia quelle secrete che quelle presenti sulla membrana plasmatica dei linfociti B, sono costituite da quattro catene proteiche, due pesanti (H, da heavy, in rosso nel disegno)


Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II


Test Monofase di Ovulazione Strisce (Urina) - Autodiagnosi

Test Monofase di Ovulazione Strisce (Urina) - Autodiagnosi Test Monofase di Ovulazione Strisce (Urina) - Autodiagnosi MANUALE D USO ATTENZIONE: Gli operatori devono leggere e capire completamente questo manuale prima di utilizzare il prodotto. 0197 ITALIANO 2


Il DNA: la molecola della vita

Il DNA: la molecola della vita Il DNA: la molecola della vita Gli acidi nucleici comprendono il DNA (acido desossiribonucleico) e l RNA (acido ribonucleico). Sono costituiti da molecole molto grandi, formate da unità dette nucleotidi,



RISOLUZIONE ENO 24/2004 RICERCA DI SOSTANZE PROTEICHE DI ORIGINE VEGETALE NEI VINI E NEI MOSTI L'ASSEMBLEA GENERALE, Visto l'articolo 2 paragrafo 2 iv dell'accordo del 3 aprile 2001 che istituisce l'organizzazione internazionale
