l virus H1N1 dell influenza pandemica del 2009 induce una risposta anticorpale in grado di cross reagire con il virus dell influenza Spagnola del 1918

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "l virus H1N1 dell influenza pandemica del 2009 induce una risposta anticorpale in grado di cross reagire con il virus dell influenza Spagnola del 1918"

Transcript

1 l virus H1N1 dell influenza pandemica del 2009 induce una risposta anticorpale in grado di cross reagire con il virus dell influenza Spagnola del 1918 Lavoro di diploma Giorgia Pucci Scuola Superiore Medico Tecnica, Locarno Svolto presso l Istituto di Ricerca in Biomedicina a Bellinzona (IRB) Responsabili: Davide Corti (PhD), Blanca M. Fernandez Rodriguez (TAB)

2 Sommario 1. Abstract Introduzione Scopo e obiettivo del lavoro Cos è l influenza Il virus Come evolvono i virus influenzali I 3 virus influenzali del mio lavoro di diploma Vaccino Materiali e metodi Emoagglutinine influenzali Cellule e batteri HUFI6 e MUFI Sieri Altre sostanze Kit di estrazione e purificazione Apparecchiature Descrizione di alcuni strumenti usati piú frequentemente nel lavoro NanoDrop (Thermo Scientific) FACS (BD Biosciences) Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza spagnola del 1928 e dell influenza stagionale del Trasformazione di E. Coli TOP 10 con A/SC e A/NC ed esecuzione di una coltura in fase liquida Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza suina del Realizzazione dei primer specifici Ottimizzazione della PCR e amplificazione del frammento relativo all emoagglutinina di A/CA/04/ Digestione enzimatica, ligazione e dialisi del vettore phcmv1 con A/CA/04/ Trasformazione di E. Coli TOP 10 con A/CA ed esecuzione di una coltura in fase liquida Settaggio della quantità di plasmide da usare nella trasfezione Lettura al FACS dei risultati ottenuti Analisi dei sieri al FACS Risultati Prima parte del lavoro Quantificazione A/SC e A/NC

3 Settaggio della PCR per A/CA Quantificazione dei campioni successivamente a digestione enzimatica Ligasi Quantificazione A/CA Setting al FACS Seconda parte del lavoro (analisi preliminari) Seconda parte del lavoro (analisi effettiva dei campioni) Discussione Prima parte del lavoro Seconda parte del lavoro (analisi preliminari) Seconda parte del lavoro (analisi effettiva dei campioni) Conclusioni Bibliografia Ringraziamenti I. Allegati... 1 I. Plasmide phcmv1 (Genlantis, San Diego CA)... 1 II. Plasmide pcdna3.1 (Invitrogen, USA)... 3 III. Sequenze delle 3 emoagglutinine in analisi nel lavoro di diploma... 4 i. HA A/CA/04/ ii. HA A/SC/1/ iii. HA A/NC/20/ IV. Confronto tra la sequenza amminoacidica delle tre emoagglutinine in analisi... 6 V. Risultati ottenuti al FACS ed elaborato con Flowjo VI. Risultati elaborati con Flowjo e rivisti con Microsoft Office Excel Tabella A Tabella B Tabella C

4 1. Abstract 1.1. Abstract in italiano 1.2.Abstract in inglese Recenti studi eseguiti sui topi hanno dimostrato che gli anticorpi sviluppati dal nostro sistema immunitario successivamente ad immunizzazione attiva o vaccinazione possono neutralizzare uno o più virus dell influenza appartenenti allo stesso tipo, fornendo così al soggetto una cross protezione. In questo studio si è quindi proposto di testare i sieri dei pazienti vaccinati nel 2009 contro l influenza suina (pandemica) con altri due virus influenzali di tipo A: il virus dell influenza pandemica A/SC/1/18 e il virus dell influenza stagionale A/NC/20/99. Si conosce inoltre che la capacità dell anticorpo di neutralizzare il virus è dovuto al legame formato tra l anticorpo stesso e l emoagglutinina (HA) presente sull envelope del virus influenzale. Pertanto si è studiata la capacità degli anticorpi presenti nei sieri dei pazienti di cross neutralizzare unicamente le HA dei virus pandemici in quanto, evolutivamente, sono quelle che presentano maggiori siti di conservazione e sono meno soggette a glicosilazioni: cosa che invece non avviene per i virus dell influenza stagionale che sono frequentemente soggetti a cambiamenti di livello strutturale delle HA. L effetto di questi siti di glicosilazione è stato dimostrato grazie all uso di un citometro a flusso (FACS), dove si sono potute visualizzare le effettive capacità dei sieri di riconoscere unicamente i virus pandemici e non quello dell influenza stagionale. Recent studies performed on rats have shown that antibodies developed by our immune system following active immunization or vaccination can neutralize one or more influenza viruses belonging to the same type. This can give the subject a cross protection. In this study it is therefore proposed to test sera of people vaccinated in 2009 against swine influenza (pandemic) with two other influenza type A virus: the influenza pandemic/sc/1/18 and seasonal influenza virus A/CN/20/99. It is known that the ability of the virus neutralizing antibody is due to the bond formed between the antibody and a region of the hemagglutinin (HA) present on the envelope of the influenza virus. The purpose of this study was to investigate the ability of the antibodies in patient sera to cross neutralize only the HA of pandemic virus because, evolutionarily, this virus has major sites of conservation which are less prone to glycosylation: which instead is not the case for seasonal influenza viruses that are frequently subject to structural changes in the level of HA. The effect of these sites of glycosylation was demonstrated using a flow cytometer (FACS), with which it was possible to view the actual capacity of sera to neutralize the virus pandemic and not seasonal flu. 4

5 2. Introduzione 2.1. Scopo e obiettivo del lavoro Questo lavoro di diploma consiste nel testare la capacità di sieri umani ottenuti successivamente all esecuzione della vaccinazione contro l influenza suina del di riconoscere emoagglutinine di un virus pandemico risalente al Infatti, gli anticorpi prodotti dal sistema immunitario, successivamente alla vaccinazione, sono ritenuti capaci di neutralizzare anche altri virus influenzali dello stesso tipo. La capacità di cross reagire verrà testata sulle emoagglutinine virali di tre virus di tipo A: A/NC/20/99 (influenza stagionale del 1999 e usato come vaccino nel periodo tra il 2000 e il 2007), A/SC/1/18 (influenza spagnola del 1918), A/CA/04/09 (influenza suina del 2009, diventato poi il virus epidemico H1N1 utilizzato nel vaccino stagionale 2010/2011) [1]. Per la prima parte del mio lavoro ho avuto a disposizione le sequenze dell emoagglutinine di due virus influenzali pandemici (spagnola e suina) e di un virus influenzale stagionale inserite all interno di due diversi plasmidi: phcmv1 (influenza stagionale e spagnola) e il vettore pcdna3 (suina). La sequenza codificante per l emoagglutinina di A/CA/04/09 è stata trasferita dal plasmide pcdna3 a phcmv1. Successivamente a quest operazione sono stati prodotti quantitativi maggiori di plasmidi phcmv1, contenenti le tre sequenze specifiche per le emoagglutinine influenzali in analisi, tramite trasformazione batterica. Lo scopo di questo passaggio è stato quello di avere a disposizione sufficiente materiale per la seconda parte del mio lavoro che consisteva nel trasfettare, con i vettori contenenti le sequenze sopra citate, una linea cellulare chiamata 293T/17 in modo che queste cellule fossero in grado di presentare sulla loro superficie le emoagglutinine dei tre virus influenzali in questione. A questo punto è stato possibile, tramite uno staining extracellulare, visualizzare con citometria a flusso l effettiva capacità degli anticorpi presenti nei sieri di cross reagire con gli antigeni in questione. In questa seconda parte sono stati utilizzati, oltre ai sieri dei pazienti vaccinati nel 2009, anche sieri dei pazienti vaccinati nel 2008 e nel 2010; in modo da rendere maggiormente visibile la risposta di cross neutralizzazione dei sieri in analisi. L obiettivo principale di questo lavoro è stato di valutare la cross reattività nella risposta anticorpale indotta dalla vaccinazione con il virus pandemico della suina (A/CA/04/09) [2] Cos è l influenza L influenza è una patologia di tipo infettivo causata da virus a RNA della famiglia degli Orthomyxoviridae [3]. Prevalentemente viene trasmessa da persona a persona tramite aerosol provenienti dalle cavità orali (naso e gola) di una persona infettata dal virus che tossisce o starnutisce; pertanto la trasmissione aerea del virus richiede uno stretto contatto tra individuo infetto e individuo sano. I primi sintomi compaiono generalmente dopo un incubazione di circa 1 2 giorni e, in questo lasso di tempo, il virus può essere eliminato nell ambiente circostante dal soggetto infettato [5]. L esordio della malattia è spesso molto brusco ed improvviso, con picchi febbrili che possono durare dai 3 ai 4 giorni. I sintomi sono solitamente: febbre (con punte che possono giungere sino ai 39.5 C), dolori muscolari ed ossei, astenia, cefalea e sintomi respiratori quali tosse, congestione nasale e mal di gola [5] [6]. In generale, la malattia 1 I sieri mi sono forniti dall Istituto San Raffaele di Milano e in parte anche dall Istituto di Ricerca di Bellinzona.

6 evolve in modo benigno senza complicanze e si risolve nell'arco di 3 6 giorni senza la necessità di effettuare terapie particolari. Tuttavia, nei bambini più piccoli, nelle persone con più di 65 anni, negli individui affetti da alcune patologie croniche, nei soggetti immunocompromessi ed in gravidanza, possono insorgere alcune complicanze anche severe [5] Il virus Figura 1: rappresentazione di un virus influenzale con le sue componenti principali (a sinistra) e rappresentazione schematica di un emoagglutinina con evidenziazione di alcune regioni caratteristiche (a destra) [27]. I virus influenzali appartengono al genere Orthomyxovirus della famiglia Orthomyxoviridaee [2] e vengono differenziati in virus di tipo A, tipo B e tipo C in base alle loro caratteristiche antigeniche. Da notare comunque che tutti e 3 i tipi di virus influenzale contengono al loro interno 8 frammenti di RNA a singola elica, ognuno codificante per differenti proteine del virus [5]. I virus influenzali di tipo A sono i patogeni più virulenti per l uomo e possono causare la sintomatologia più grave. Essi sono capaci di infettare anche un ampia varietà di mammiferi ed uccelli oltre all uomo: ad esempio cavalli, maiali e volatili domestici e selvatici. Molto spesso a questa tipologia di virus sono associate epidemie e pandemie [3]. A seconda delle glicoproteine di superficie che lo compongono, il virus di tipo A può essere ulteriormente suddiviso in sottotipi (o serotipi): 16 sottotipi di emoagglutinina (da H1 a H16) e 9 sottotipi di neuroaminidasi (da N1 a N9) [5]. Tutti i sottotipi sono stati rilevati nelle specie aviarie (in particolare nei volatili acquatici selvatici che sono ospiti naturali per una grande varietà di virus A), mentre l uomo e i mammiferi ospitano solo alcuni sottotipi: ciò sta molto probabilmente ad indicare che gli uccelli sono il serbatoio naturale del virus influenzale di tipo A [5] [6]. Nell uomo i due sottotipi maggiormente responsabili delle epidemie stagionali sono H1 e H3. Il virus di tipo B è quasi esclusivamente un patogeno umano, fatta eccezione per i pinnipedi (quali foche ed otarie) che sono gli unici animali vulnerabili conosciuti [4]. Generalmente è meno grave dell influenza di tipo A. Il ridotto tasso di mutazione antigenica, combinata con una scarsa gamma di ospiti 6

7 (che impedisce uno spostamento antigenico tra specie diverse) assicura l impossibilità di pandemie di influenza B [6]. L'influenza C infetta sia l'uomo che i suini e può causare gravi malattie ed epidemie locali [5]. Tuttavia, l'influenza C è meno comune rispetto agli altri tipi e normalmente sembra causare solo disturbi non troppo gravi nei bambini [6]. Nel suo complesso se consideriamo le caratteristiche comuni alle tre diverse tipologie di virus, abbiamo: la struttura virale di base, la particella di forma sferica ovoidale ed un involucro. Quest ultimo caratterizzato da due tipi di glicoproteine: l'emoagglutinina (HA) e la neuroaminidasi (N). Per glicoproteina s intende una proteina alla cui catena peptidica sono legate catene oligosaccaridiche definite glicani. Il glicano viene attaccato mediante un processo di modificazione genericamente definito come glicosilazione [8]. Quindi, come detto precedentemente, l emoagglutinina e la neuroaminidasi sono due glicoproteine presenti sull envelope virale; la prima è presente sull envelope di alcuni virus come per esempio il virus dell influenza ed è responsabile dell adesione del virus alla cellula destinata ad essere infettata (appartiene alla famiglia delle lectine e può provocare l agglutinazione degli eritrociti) [5]. La seconda invece è un enzima appartenente alla classe delle idrolasi. È una glicoproteina espressa tipicamente sulla superficie dei virus influenzali ed é necessaria per la penetrazione del patogeno nelle vie respiratorie; inoltre risulta essere indispensabile affinché il virus rilasciato dalle cellule infettate possa essere liberato ed infettare quindi altre cellule [5]. Il genoma del virus consiste in un singolo filamento di RNA segmentato in 8 frammenti (7 nel tipo C) che codificano per 10 proteine strutturali e non strutturali. La particolarità dei virus influenzali è la variabilità antigenica, cioè la loro capacità di cambiare il loro "identikit" rendendo più difficile il compito del sistema immunitario. Questo fenomeno è più frequente nei virus di tipo A rispetto a quelli di tipo B e mai registrato nel tipo C. Le continue modificazioni producono varianti virali verso le quali, nella popolazione a rischio, la resistenza è scarsa o assente. E' per questo che l'influenza continua a essere la maggiore patologia a carattere epidemico nell uomo, e che ogni anno cambiano i vaccini [9] Come evolvono i virus influenzali L influenza è causata da una moltitudine di specie virali che, ogni anno possono estinguersi, causare epidemie o rispettivamente pandemie. Tipicamente nelle due normali stagioni influenzali (una per emisfero), in un anno ci sono tra i 3 ed i 5 milioni di casi di malesseri gravi e fino a 500'000 decessi, che costituiscono una epidemia influenzale ogni anno. Ogni decennio o ventennio insorge una pandemia, che infetta una grande parte della popolazione mondiale e può uccidere decine di milioni di persone. A differenza dell epidemia, che colpisce una popolazione di individui delimitata sia nel numero che nella regione, la pandemia ha una diffusione geografica molto estesa ed interessa diverse aree del mondo presentando un elevato numero di morti e casi gravi [4]. La prima pandemia influenzale documentata è quella del 1918, o anche chiamata spagnola, causata dal ceppo virale H1N1. Storicamente si tratta della pandemia peggiore e causò attorno ai 50 milioni di morti. Nel corso degli anni sono state registrate altre pandemie che, benché presentino un numero di decessi minore della spagnola, non sono però da considerare meno importanti. Ben 39 anni dopo la pandemia del 1928 ci fu, nel 1957, la pandemia asiatica (H2N2), seguita poi nel 1968 dalla pandemia di 7

8 Hong Kong (H3N2) ed ai giorni nostri dall influenza suina (H1N1) o meglio definita con l acronimo SOIV (Swine Origin Influenza Virus) [10]. I nuovi virus influenzali sono prodotti costantemente da mutazioni o da riassortimento [5]. A questa continua evoluzione sono soprattutto interessati gli antigeni di superficie, in modo particolare l'emoagglutinina. I cambiamenti possono essere di due tipi: le variazioni antigeniche maggiori (antigenic shifts) e le variazioni antigeniche minori (antigenic drifts) [8]. Le antigenic shift si verificano ogni anni e soltanto nei virus di tipo A, le antigenic drift avvengono quasi annualmente sia nel virus di tipo B che in quelli di tipo A. Gli antigenic shift determinano la comparsa di nuovi virus, aventi caratteristiche antigeniche dell'emoagglutinina e/o della neuroaminidasi del tutto diverse, verso i quali la popolazione è priva di immunità. Quando si verifica il cambiamento simultaneo dei due antigeni di superficie la pandemia è particolarmente virulenta. Se invece lo shift coinvolge solo l'emoagglutinina il virus si diffonde ma, per la presenza nelle popolazioni di anticorpi anti neuroaminidasi efficaci, la malattia risulta meno grave [5]. Gli antigenic drifts, si verificano invece ogni 1 3 anni all interno di uno stesso sottotipo influenzale sia per l influenza A che per l influenza B. Tale fenomeno è determinato dalle successive mutazioni dei geni, che codificano per emoagglutinina e/o neuroaminidasi: ciò comporta cambiamenti nella sequenza aminoacidica dei siti antigenici delle proteine, di conseguenza gli anticorpi diffusi nella popolazione non riescono più a riconoscere il virus. Questo genere di mutazioni è dovuto principalmente ad errori di trascrizione da parte della polimerasi virale [5] [9]. Un ulteriore sistema adottato dal virus per potersi evolvere, e quindi evitare il riconoscimento delle sue strutture da parte del sistema immunitario, è rappresentato da differenti livelli di glicosilazione. Tutte le glicosilazioni a carico dell emoagglutinina prevedono la coniugazione di oligosaccaridi alla catena laterale dell aminoacido asparagina (le cosiddette N glicosilazioni) [8]. Figura 2: messa in evidenza dei cambiamenti a livello strutturale dell emoagglutinina con visualizzazione dei siti di glicosilazione (in blu e rispettivamente in rosso) che determinano un cambiamento per il riconoscimento da parte degli anticorpi di strutture comuni. La parte dell emoagglutinina mantenuta invariata viene rappresentata in verde [28]. 8

9 La glicosilazione rappresenta inoltre il motivo per cui i virus pandemici usati nel mio lavoro mostrano delle somiglianze a livello antigenico; pertanto risulta facilitato il riconoscimento di entrambi da parte degli anticorpi contenuti nei sieri dei pazienti vaccinati contro il SOIV. Altrettanto non si può dire invece per il virus dell influenza stagionale che presenta un maggior numero di siti glicosilati che pertanto compromettono il riconoscimento da parte del sistema immunitario [2]. Figura 3: emoagglutinine (HA) di tipo influenzale appartenenti al ceppo pandemico o stagionale. (A B) confronto tra HA dell influenza SC del 1918 con influenza stagionale NC del 1999 che evidenziano, tramite colorazione blu, i siti di glicosilazione. Come si può ben notare alla testa dell HA di tipo stagionale vi sono delle glicosilazioni che determinano la differenza della risposta immunitaria [28]. Ė inoltre importante segnalare che tutte le emoagglutinine virali presentano una regione comune che risulta essere molto conservata. Questa regione é il gambo o in inglese chiamato anche stem. La maggior parte degli anticorpi prodotti dal sistema immunitario sono diretti contro la testa dell emoagglutinina (globular head) che, come descritto in precedenza, rappresenta la regione maggiormente soggetta a mutazioni indotte dal meccanismo di antigenic drift ed è anche interessata da modificazioni nel numero e nella localizzazione dei residui oligosaccaridici. Tuttavia, recenti studi condotti all IRB 2, hanno dimostrato anche la presenza di anticorpi diretti contro la stem dell emoagglutinina in grado di neutralizzare il virus. Questi ultimi anticorpi sono stati dimostrati essere in grado di riconoscere e neutralizzare molteplici virus anche appartenenti a differenti sottotipi virali andando a costituire la cosiddetta risposta anticorpale di tipo eterosubtipico [11]. Questo tipo di risposta rappresenta soltanto una frazione minoritaria della risposta anticorpale diretta contro l emoagglutinina ed è caratterizzata da anticorpi in grado di neutralizzare il virus ma con scarsa potenza. Data comunque la maggior presenza di anticorpi diretti contro la globular head e la loro maggiore efficacia neutralizzante, gli anticorpi contenuti nei sieri dei pazienti non sono in grado di neutralizzare tutti e tre i virus influenzali (anche se la stem di questi tre virus è molto conservata) poiché diretti verso una regione della testa dell emoagglutinina non conservata nell influenza stagionale [2]. 2 Esempio uno studio condotto da Davide Corti e pubblicato nel 2010, intitolato: Heterosubtypic neutralizing antibodies are produced by individuals immunized with seasonal influenza vaccine. Citazione bibliografica [11]. 9

10 2.5. I 3 virus influenzali del mio lavoro di diploma Originariamente il virus pandemico dell influenza H1N1 è emerso nel 1918 dando poi luogo a periodici ceppi stagionali che hanno cominciato a diminuire in frequenza durante la fine degli anni cinquanta [2]. La pandemia del 1918, anche chiamata spagnola 3, uccise circa 50 milioni di persone per poi scomparire all incirca dopo 18 mesi dalla sua comparsa [3]. Nel 1977 si verificò una recrudescenza di virus H1N1, ridefinendo così i ceppi di H1N1 stagionali che sono attualmente in circolazione (come ad esempio A/NC/20/99) [2]. Questi ceppi stagionali, data la trasmissione unicamente da uomo a uomo, subiscono annualmente delle mutazioni antigeniche che li rendono ogni anno un virus nuovo che il nostro sistema immunitario fatica a riconoscere [12]. In contrasto con questi adattamenti all uomo da parte del virus, l'attuale pandemia d'influenza A (H1N1) del 2009 (risultante da vari riassortimenti nel corso degli anni con altri virus di tipo influenzale) rappresenta una trasmissione cross specie dato che il virus, precedentemente, era limitato alla specie dei suini [2]. Grazie al fatto che negli ultimi anni il virus ha usato come serbatoio i maiali, limitandone pertanto le mutazioni genetiche tra cui principalmente la glicosilazione, ha permesso al patogeno di mantenere una somiglianza di circa il 95% con gli antigeni di superficie della spagnola. Figura 4: genesi del virus dell influenza suina. Nel 1990 si è verificato un primo un riassortimento tra il virus classico della suina, il virus Nord Americano dell aviaria ed il virus umano dell H3N2 portando come risultato ad un triplo riassortimento H3N2 e H1N2 che successivamente ha continuato a circolare in Nord America come virus influenzale nella popolazione suina. Questo virus si è poi nuovamente riassortito con un quarto derivante dall Eurasia portando come risultato finale al virus della suina (SOIV) odierno [29]. 3 Nome dovuto al fatto che furono i giornali spagnoli i primi a darne notizia 10

11 Quindi la conservazione antigenica tra il virus della Spagnola ed il SOIV è alla base dell osservazione che le persone già entrate in contatto con il virus del 1918 sono in grado di cross reagire con il SOIV [12] [13]. Questo meccanismo può anche essere definito cross neutralizzazione: infatti gli anticorpi in questo caso riescono a riconoscere una struttura comune a due virus pandemici pur essendo diversi tra loro ed isolati in un lasso di tempo di 90 anni. Il sistema immunitario è in grado di contrastare tutte le varianti genetiche antigenicamente simili a quelle che in passato hanno infettato l'organismo grazie alla presenza di alcuni epitopi conservati all interno della struttura proteica dell emoagglutinina [14] [15] Vaccino I vaccini attualmente in commercio possono essere realizzati con virus interi inattivati, cioè uccisi, oppure con solo le parti fondamentali del virus in grado si stimolare il sistema immunitario. Questi vaccini vengono denominati split (a virus dissociati ) quando le particelle virali sono disaggregate mediante dei solventi, e vaccini a subunità quando sono presenti solo alcune proteine della superficie virale (emoagglutinine o neuroaminidasi) importanti per lo sviluppo della risposta immune. Questi vaccini subvirionici (split o subunità) danno un'ottima protezione e sono ben tollerati anche da soggetti particolarmente sensibili alle proteine esogene (ad esempio i bambini, gli asmatici, ecc.). Per aumentarne l immunogenicità sono stati recentemente introdotti sul mercato vaccini con nuove sostanze adiuvanti (microemulsione di squalene in acqua o liposomi). Il primo caso di vaccinazione in cui sono state effettivamente utilizzate le sostanze adiuvanti è proprio durante la pandemia del La produzione del virus avviene in uova di pollo per circa 9 12 giorni in aziende certificate e sotto rigoroso controllo veterinario [16]. Il vaccino, iniettato ai pazienti italiani di cui ho a disposizione il siero per eseguire il lavoro di diploma, si chiama Focetria 4. È costituito da un pool monovalente (MPH) di antigene di superficie inattivato del virus pandemico con una sospensione tamponata contenente essenzialmente le proteine purificate della membrana esterna, emoagglutinina (HA) e neuraminidasi (NA), di un ceppo di virus influenzale pandemico raccomandato dalla OMS UE per la pandemia 5. Contiene inoltre degli adiuvanti (microemulsionati di squalene) per aumentarne la patogenicità e dei conservanti per evitarne l immediato degrado [17]. I sieri forniti dall IRB invece sono di persone vaccinate con i seguenti vaccini: Nome Tipologia Dose A (H1N1) A (H3N2) B Influvac /2009 Stagionale 0.5 ml A/Brisbane/59/2007 Brisbane/10/2007 B/Florida/4/2006 Influvac 2009/2010 Stagionale 0.5 ml A/Brisbane/59/2007 A/Brisbane/10/2007 B/Brisbane/60/2008 Pandemrix 7 Pandemico 0.5 ml A/California/7/2009 Influvac 2010/2011 Stagionale 0.5 ml A/California/7/2009 A/ Perth/16/2009 B/Brisbane/60/ Focetria della ditta Novartis (Svizzera) 5 Virus usato: A/California/7/ Influvac della ditta Solvay (Svizzera) 7 Pandemrix della ditta GlaxoSmithKline (Svizzera); the vaccine contains an immunologic adjuvant AS03 which consists of DL α tocopherol (vitamin E), squalene and polysorbate 11

12 3. Materiali e metodi Idealmente il mio lavoro di diploma si può suddividere in due parti: la prima comprende la trasfezione di cellule specifiche in modo che riescano ad esprimere sulla superficie cellulare le emoagglutinine di interesse, ricavate a partire dalla sequenza specifica inserita all interno di un vettore plasmidico. A sua volta questa prima parte può essere ulteriormente suddivisa in due poiché i campioni, a dipendenza del plasmide in cui sono inserite le sequenze, verranno trattati in modo diverso con esperimenti specifici atti comunque a raggiungere lo scopo finale di espressione a livello cellulare delle emoagglutinine in analisi. La seconda parte consiste nel trasfettare le cellule 293T/17 e successivamente testare la capacità di sieri ottenuti dopo la vaccinazione con il virus SOIV nel 2009 e nella successiva stagione 2010/2011 di riconoscere le emoagglutinine presentate sulla superficie delle cellule trasfettate Emoagglutinine influenzali I campioni utilizzati per la trasfezione delle cellule mi sono stati forniti dall Istituto di Ricerca in Biomedicina di Bellinzona (IRB). Le sequenze codificanti per le emoagglutinine di interesse sono state inserite all interno di due diversi tipi di plasmide: la sequenza codificante per l emoagglutinina dell influenza spagnola del 1918 (A/SC/1/18) e quella per l emoagglutinina dell influenza stagionale del 1999 (A/NC/20/99) sono state inserite all interno di un plasmide phcmv1 mentre la sequenza dell emoagglutinina relativa all influenza suina del 2009 (A/CA/04/09) è stata inserita all interno del plasmide pcdna La conservazione dei campioni è avvenuta a 80 C Cellule e batteri I batteri utilizzati per il processo di trasformazione si chiamano One Shot TOP10 Chemically Competent E.Coli (Invitrogen, Svizzera). Hanno la caratteristica di avere un'alta efficienza di trasformazione ed inoltre mantengono un alta replica dei plasmidi. La conservazione è raccomandata a 80 C [18]. Per la seconda parte del lavoro ho usato le cellule chiamate HEK 293T/17. La sigla HEK sta per Human Embryonic Kidney, sono cellule aderenti, facili da far crescere e frequentemente usate per esperimenti di trasfezione. All IRB vengono tenute in coltura in incubatori a 37 C con il 5% di CO 2 e al 95% di umidità all interno di specifiche flask al quale viene aggiunto un terreno ideale per la crescita delle cellule senza che vi siano contaminazioni batteriche o fungine. Prima di essere messe in coltura le cellule sono conservate a 150 C in appositi congelatori. Figura 5: HEK 293T/17 [30]. 8 Per maggiori informazioni riguardante i plasmidi utilizzati vedi gli allegati 12

13 3.3. HUFI6 e MUFI6 Anticorpi monoclonali scoperti e prodotti all IRB in grado di riconoscere e neutralizzare tutti i sottotipi di influenza A. MUFI6 possiede una regione costante derivante da anticorpo di topo, mentre HUFI6 possiede una regione costante derivante da anticorpo di origine umana Sieri Alcuni sieri contenenti gli anticorpi sviluppati successivamente a stimolazione del sistema immunitario con la vaccinazione contro l influenza suina del 2009 sono stati forniti dall Istituto San Raffaele di Milano. Questi anticorpi sono diretti contro l emoagglutinina influenzale, presumibilmente verso la testa dell emoagglutinina che risulta inoltre essere la regione maggiormente soggetta a modificazioni ti tipo strutturale. I sieri prelevati successivamente a vaccinazione del 2008, 2009 e 2010 mi sono stati forniti dall IRB. Dall iniezione del vaccino al prelievo del siero sono trascorsi giorni. Per quanto riguarda i sieri del 2009 comprendono sia vaccinazione contro l influenza stagionale che la vaccinazione contro l influenza pandemica (suina) Altre sostanze PCR Nome prodotto Ditta Particolarità Taq DNA Polymerase recombinant Invitrogen, Switzerland 10x PCR Buffer Minus Mg2+ Invitrogen, Switzerland 50mM Magnesium Chloride Invitrogen, Switzerland 10mM dntp Invitrogen, Switzerland Primer specifici Microsynth, Switzerland Design eseguito in laboratorio con programma CLC Mainworkbench e realizzati dalla Microsynth Gel Agarosio Nome prodotto Ditta Descrizione Agarose I BioConcept, Switzerland Ethidium Bromide Solution Sigma Aldrich Blue Juice Gel Loading Buffer Invitrogen, Switzerland 100bp DNA Ladder Invitrogen, Switzerland 13

14 Digestione enzimatica e ligasi Nome prodotto Ditta Descrizione BglII New England BioLabs, USA NotI New England BioLabs, USA NEBuffer3 (10x) New England BioLabs, USA BSA New England BioLabs, USA Albumina bovina, viene usata per prevenire l adesione dell enzima al tubo di reazione o alla punta della pipette T4 DNA Ligase New England BioLabs, USA 10x Ligase Reaction Buffer New England BioLabs, USA Trasformazione degli E.Coli Top10: Nome prodotto Ditta Descrizione Bacto Agar Becton Dickinson and Company, France LB Medium Bio 101, California One Shot TOP10 Chemically Invitrogen, Switzerland Competent E.Coli SOC Medium Invitrogen, Switzerland Usato nello step finale per ottenere massima efficienza di trasformazione Kanamycin Invitrogen (GIBCO), Switzerland Trasfezione 293T/17: Nome prodotto Ditta Descrizione DMEM Invitrogen (GIBCO), Switzerland HyClone Bovine Calf Serum Thermo Scientific, USA Contiene proteine utili per le colture cellulari Trypan Blue Solution (0.4%) Sigma Aldrich, Switzerland PS (Penicillin Streptomycin) Invitrogen (GIBCO), Switzerland Fugene HD Roche, Switzerland Sostanza capace di formare dei liposomi con al loro interno il materiale genetico da introdurre all interno della cellula di interesse Tripsina Invitrogen (GIBCO), Switzerland 14

15 Analisi al FACS Nome prodotto Ditta Descrizione EDTA Invitrogen (GIBCO), Switzerland HyClone Bovine Calf Serum Thermo Scientific, USA PBS Invitrogen (GIBCO), Switzerland DyLight 649 Conjugated Affini Pure F(ab ) 2 Fragment Goat Anti Human IgG, Fc, Fragment Specific Jackson Immuno Research, Inc. Anticorpo secondario, si lega alla regione Fc dell anticorpo primario. Dotato di fluoroforo. ELISA Nome del prodotto Ditta Descrizione BSA New England BioLabs, USA PBS Invitrogen (GIBCO), Switzerland Goat Anti Human IgG AP Jackson Immuno Research, Inc 4 Nitrophenyl phosphate Sigma Aldrich, Switzerland Substrato disodium salt hexaydrate Bicarbonate Buffer Realizzato in Istituto 3.6. Kit di estrazione e purificazione Nucleo Spin Plasmid (Macherey Nagel, Switzerland) GFX PCR DNA and Gel Purification kit (GE Healthcare, Switzerland) 3.7. Apparecchiature T3000 Thermocycler (Biolabo Scientific Instruments, Switzerland) Camera elettroforetica (Witec Ag, Switzerland) PCR Cabinet (Witec Ag, Switzerland) Fluorescent Tables (Techne, Switzerland) Nanodrop Spectrophotometer ND 1000 (Thermo Scientific, USA) FACS Calibur e FACS Canto Centrifuge 5415 D e 5810 R (Eppendorf, Switzerland) Thermomixer compact (Eppendorf, Switzerland) Vortex Genie 2 (Scientific Industries Inc., USA) Forma Series II Water Jacketed CO 2 Incubator (Thermo Scientific, USA) Agitatore e piastra riscaldante (IG Instrumenten Gesellschaft AG, Switzerland) Bunsen Fireboy Plus (IBS Integra Biosciences, Switzerland) 15

16 3.8. Descrizione di alcuni strumenti usati piú frequentemente nel lavoro NanoDrop (Thermo Scientific) Il NanoDrop, della ditta Thermo Scientific, è uno spettrofotometro ( nm) capace di analizzare dei volumi molto piccoli di campioni da quantificare (fino a 0.5 μl) mantenendo un elevata accuratezza e riproducibilità [19]. Questa apparecchiatura utilizza una tecnologia brevettata, basata sulla tensione superficiale che piccoli volumi di liquidi esercitano quando si trovano collocati tra due superfici vicine. In poche parole la goccia di campione posizionata nell apposita piastra di lettura crea una colonna di liquido a diretto contatto con due fibre ottiche, e può essere analizzata in modo semplice e veloce. Questo elimina la necessità di cuvette ed altri dispositivi di contenimento del campione e permette di pulire in pochi secondi le due superfici entrate in contatto con il campione. Inoltre, il NanoDrop ha la capacità di misurare i campioni ad alta concentrazione, senza diluizione (50x concentrazione superiore a quello campioni misurati con uno spettrofotometro cuvetta standard) [19] [20]. La visualizzazione dei risultati può essere effettuata al computer tramite dei grafici e dei rapporti che mi permettono di determinare il grado di purezza del campione oltre alla sua quantificazione [20]. Figura 6: visualizzazione di come si vedono le immagini allo schermo del computer [31]. Nel mio caso ciò che interessa maggiormente è la possibilità di quantificare gli acidi nucleici successivamente all esecuzione di una PCR o di una purificazione, determinandone anche il grado di purezza e verificando pertanto la presenza o l assenza di contaminazioni proteiche (rapporto A 260/280 maggiore o uguale a ) [20]. 16

17 FACS (BD Biosciences) Il FACS, o anche denominato citometro a flusso, è un apparecchio che unisce le caratteristiche di uno strumento contaglobuli a quello di un microscopio a fluorescenza [21]. Le cellule da contare vengono marcate con appositi fluorocromi che, una volta colpiti dal raggio laser presente nella camera di conta, vengono eccitati emettendo una ben determinata fluorescenza rilevabile con appositi detettori posizionati all interno dello strumento. La camera di conta può essere definita come un blocco di quarzo scavato all interno per formare un capillare in cui le cellule, immerse nel liquido di trascinamento, passano singolarmente per poi essere colpite dal fascio laser. La capacità del fluido di separarle è definita focalizzazione idrodinamica [22]. A B Figura 7: (A) foto dell'imbuto che grazie alla focalizzazione idrodinamica indirizza le cellule nel capillare che a sua volta entra all'interno della camera di conta dove i fluorocromi verranno eccitati. (B) fascio laser indirizzato dai vari prismi verso il punto di incontro delle particelle [32]. In generale il primo laser, che colpisce le cellule nella camera di conta, ha una lunghezza d onda di 488 nm (colore blu). Per colpire le cellule deve passare attraverso una serie di prismi e lenti che lo indirizzano verso il punto esatto d incontro delle particelle; a sua volta la luce diffusa dalle particelle viene convogliata, attraverso un sistema di fibre ottiche, in un sistema di filtri capace di separare le varie lunghezze d onda generate dai fluorocromi utilizzati. I filtri in questione sono specifici unicamente per determinate lunghezze d onda infatti se non corrisponde quest ultima viene riflessa. Ci sono i filtri "Long Pass (LP)" che si lasciano attraversare solo da lunghezze d'onda superiori a quella fissata e riflettono tutto ciò che possiede una lunghezza d'onda inferiore; i filtri "Band Pass (BP)" che si lasciano attraversare solamente da lunghezze d'onda comprese tra due valori fissati, ed i filtri "Short Pass (SP)" che si lasciano attraversare da lunghezze d'onda inferiori a quella fissata e riflettono tutto ciò che possiede una lunghezza d'onda superiore [23]. Pertanto la scelta dei fluorocromi da utilizzare per detettare le varie particelle viene applicata seguendo la configurazione dello strumento e quindi in base al sistema di laser e di filtri di cui è composto [21]. 17

18 3.9. Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza spagnola del 1928 e dell influenza stagionale del Trasformazione di E. Coli TOP 10 con A/SC e A/NC ed esecuzione di una coltura in fase liquida Prima di iniziare l esperimento l IRB mi ha fornito i plasmidi contenenti le sequenze per le due emoagglutinine in analisi che successivamente sono stati quantificati con l apparecchio Nanodrop. Questa misura mi ha permesso di determinare il corretto volume di soluzione contenente plasmide da utilizzare per la trasformazione degli E. Coli Top10; infatti secondo il protocollo fornito dalla ditta Invitrogen il quantitativo massimo di DNA consigliato è 100 ng. Come primi campioni mi sono stati forniti: la sequenza dell emoagglutinina della spagnola A/SC/1/18 e quella dell influenza stagionale A/NC/20/99; tutte inserite correttamente all interno del vettore phcmv1. Seguendo il protocollo fornito dalla ditta Invitrogen ho trasformato i batteri allo scopo di poter realizzare una prima coltura su piastra dei due campioni. Questo mi ha permesso di amplificare il numero di plasmidi contenenti l inserto di interesse. Per trasformare i batteri ho utilizzato lo shock termico: in poche parole si tratta di portare i batteri da 4 C circa a 42 C in qualche secondo. Questo permette alla parete batterica di diventare permeabile formando delle specie di pori che consentono l entrata del DNA plasmidico all interno del battere. Successivamente per permettere la chiusura dei pori bisogna riposizionare la Eppendorf in ghiaccio per alcuni minuti. Alla fine i batteri vengono incubati per circa 1h a 37 C in modo che possano attivare il loro metabolismo iniziando a riprodursi. Dopo questo lasso di tempo si può inoculare una ben determinata quantità di batteri in piastre selettive contenenti l antibiotico specifico (nel mio caso il plasmide phcmv1 contiene il gene di resistenza alla kanamicina) e lasciarle incubare overnight (circa 12 ore) a 37 C in modo che le colonie possano crescere. Il giorno successivo saranno cresciuti unicamente i batteri che si sono trasformati, e cioè quei batteri che hanno inglobato al loro interno il plasmide avente la resistenza alla kanamicina. Questo purtroppo non vuol dire però che il plasmide debba contenere per forza l inserto codificante per la mia emoagglutinina di interesse; infatti può capitare che durante la ligasi il plasmide si sia richiuso su se stesso non formando quindi un legame con la sequenza dell emoagglutinina. Successivamente si è deciso di proseguire con una coltura in fase liquida di medie dimensioni (160 ml) in modo da amplificare maggiormente la quantità di plasmide a disposizione. Questa coltura è rimasta in incubazione nella camera tutta la notte su un apposito agitatore regolato a 225 rpm. Il giorno successivo con l ausilio del kit Nucleo Spin Plasmid (Macherey Nagel, Svizzera) si è eseguito l estrazione del materiale plasmidico dal battere. Il protocollo utilizzato e quello specifico per le colture in fase liquida di medie dimensioni Xtra Midi (colture comprese tra i 40 e i 400 ml). Successivamente a questo passaggio si è quantificato il materiale genetico estratto con l ausilio del Nanodrop. I campioni sono stati stoccati in apposite Eppendorf (DNA RNA Free) da 1.5 ml e messi in congelatore a 80 C per conservarli fino al prossimo utilizzo. 18

19 3.10. Metodi per la produzione di cellule che esprimono sulla loro superficie le emoagglutinine dell influenza suina del Realizzazione dei primer specifici La sequenza per l HA relativa all influenza suina é stata inserita all interno di un plasmide chiamato pcdna3.1. Per evitare l aggiunta di variabili all esperimento si é deciso di cambiare il plasmide di inserzione e utilizzare phcmv1 come per i campioni precedenti. Per fare ciò sono stati realizzati dei primer su misura contenenti la sequenza di taglio per un enzima di restrizione specifico presente anche all interno del plasmide phcmv1, proprietà che verrà sfruttata negli esperimenti successivi. Questi primer sono in grado di legarsi in parte alla sequenza della mia emoagglutinina ed in parte invece, a partire dal sito di taglio per l enzima di restrizione non sono complementari e pertanto sono liberi. Le sequenze dei primer sono quindi (design realizzato all IRB con software CLC Mainworkbench mentre la sintesi é stata eseguita dalla ditta Microsynth): FW primer con sequenza di taglio per BglII 5 TCGTGAGATCTATGAAGGCAATACTAGTAGTTCTGCTATATA 3 RV primer con sequenza di taglio per NotI 5 GGGTCTCTACAGTGTAGAATATGTATTGCGGCCGCTCATAC 3 Per quanto riguarda la sequenza dei primer In grassetto sono segnalate delle sequenze che non si appaiano né al plasmide né all emoagglutinina In giallo sono evidenziate le sequenze di taglio per gli enzimi di restrizione, mentre in verde é segnalata l inizio della sequenza codificante per gli amminoacidi che compongono l emoagglutinina di interesse Ottimizzazione della PCR e amplificazione del frammento relativo all emoagglutinina di A/CA/04/09 Il setting della PCR é stato eseguito provando diverse temperature di anneal dei primer e diverse concentrazioni di DNA. La temperatura migliore per l anneal é risultata essere 60 C mentre la concentrazione di DNA ideale è di 150 ng. Si è quindi proseguito con l amplificazione e l estrazione del frammento di interesse da pcdna3.1. Successivamente é stato realizzato un gel di agarosio all 1% per poter visualizzare e tagliare la banda relativa alla sequenza amplificata grazie al confronto della taglia con un Marker di 100bp. Con l uso degli UV e di un bisturi é stata selezionata la banda di interesse per poi essere successivamente purificata dal gel con apposito kit chiamato GFX PCR DNA and Gel Purification kit (GE Healthcare, Svizzera). A questo punto é stato quantificato con Nanodrop il campione ottenuto Digestione enzimatica, ligazione e dialisi del vettore phcmv1 con A/CA/04/09 La digestione enzimatica é stata eseguita in contemporanea sia sulla sequenza codificante per l emoagglutinina del virus A/CA/04/09 selezionata e purificata nell esperimento precedente, sia sul plasmide phcmv1 senza inserto in modo da creare le zone di coesione utili nella reazione di ligasi. 19

20 L incubazione avviene per 1 ora a 37 C e successivamente gli enzimi vengono inattivati per 20 minuti a 65 C. Una volta eseguita questa reazione bisogna procedere con una purificazione del prodotto da tutti i reagenti che possono interferire con la ligazione successiva. Questo avviene grazie all uso del kit GFX PCR DNA and Gel Purification kit (GE Healthcare, Svizzera). Successivamente bisogna eseguire una quantificazione del prodotto con Nanodrop; utile per la determinazione del quantitativo di campione da pipettare nella provetta di reazione. Per la determinazione della concentrazione ideale di plasmide e inserto da utilizzare ho usufruito di tre modi diversi di calcolo. Il primo proviene dal sito internet della New England Bio Labs (USA) mentre il secondo e il terzo sono delle formule che mi sono stati forniti in laboratorio ed in cui l unica differenza consiste in un fattore numerico. Così sono state realizzate tre diverse provette di reazione con le tre diverse concentrazioni di inserto e vettore calcolate con i tre metodi; in questo modo è stato possibile determinare la tecnica migliore. Sono poi stati aggiunti i rispettivi reagenti, tra cui l enzima T4 DNA ligase, ed il tutto é rimasto in incubazione per 1 ora a temperatura ambiente. Per poter selezionare i plasmidi aventi l inserto è stata eseguita una PCR successivamente all esecuzione di una trasformazione batterica e una coltura su piastre selettive. I primer utilizzati per questa PCR sono gli stessi realizzati per l estrazione della sequenza codificante per l emoagglutinina di A/CA/04/09 dal vettore plasmidico pcdna3. Le condizioni di PCR sono invariate rispetto a quelle prestabilite durante l ottimizzazione eseguita nel capitolo Trascorsa l ora di incubazione é stata eseguita una dialisi, con membrana da 0.05 µm (Millipore, Svizzera), di 30 minuti per eliminare tutti i reagenti ed i sali utilizzati nella ligasi e che potrebbero disturbare nella prossima reazione; che sarebbe la trasformazione batterica Trasformazione di E. Coli TOP 10 con A/CA ed esecuzione di una coltura in fase liquida Lo scopo ed i procedimenti di questo esperimento sono gli stessi che per A/SC e A/NC; infatti anche in questo caso si inizia con una trasformazione batterica e successivamente una coltura su piastra contenente l antibiotico kanamicina per selezionare tutti quei batteri che sono stati trasformati correttamente e contengono al loro interno phcmv1 con la resistenza specifica. L unica differenza consiste nello step successivo: dopo aver messo in coltura i batteri si preleva un determinato quantitativo dalla colonie cresciute e si esegue una PCR. Questo ci permette di discriminare le colonie che contengono unicamente il plasmide da quelle che contengono il plasmide con l inserto. Una volta selezionate le colonie di interesse si preparano delle colture in fase liquida (nelle beute) di medie dimensioni in modo da amplificare maggiormente la quantità di plasmide avente l inserto. Questa coltura è rimasta in incubazione nella camera tutta la notte su un apposito agitatore regolato a 225 rpm. Con il resto della colonia è stato preparato uno stock in glicerolo che poi, una volta messo in azoto liquido, è stato immediatamente stoccato a 80 C. Il giorno successivo si è proseguito con l estrazione del materiale plasmidico dai batteri posti nella coltura di medie dimensioni grazie all uso del kit Nucleo Spin Plasmid (Macherey Nagel, Svizzera) ed alla fine si é quantificato il prodotto ottenuto dall estrazione con l uso del Nanodrop. I campioni sono stati stoccati in apposite Eppendorf da 1.5 ml e messi in congelatore a 80 C per conservarli fino all uso. 20

4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio?

4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio? Dipartimento federale dell'interno DFI Ufficio federale della sanità pubblica UFSP Malattie trasmissibili Stato al 05.10.2010 FAQ Influenza stagionale 1. Cos è l influenza? 2. Come si trasmette l influenza?

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

INFLUENZA. Che cos è

INFLUENZA. Che cos è INFLUENZA Che cos è L influenza è una malattia infettiva provocata da virus del genere Othomixovirus che colpiscono le vie aeree come naso, gola e polmoni. I soggetti colpiti nel nostro Paese vanno dai

Dettagli

Con la vaccinazione l influenza si allontana. La prevenzione dell influenza

Con la vaccinazione l influenza si allontana. La prevenzione dell influenza Con la vaccinazione l influenza si allontana La prevenzione dell influenza La vaccinazione antinfluenzale è il mezzo più efficace di protezione dalla malattia e di riduzione delle sue complicanze per le

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria?

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria? DOMANDE E RISPOSTE 1. Che cos è un vaccino? Un vaccino è un prodotto la cui somministrazione è in grado di indurre una risposta immunitaria specifica contro un determinato microrganismo (virus, batterio

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Guida per l uso corretto di mascherine chirurgiche e respiratori per ridurre la trasmissione del nuovo virus influenzale AH1N1v

Guida per l uso corretto di mascherine chirurgiche e respiratori per ridurre la trasmissione del nuovo virus influenzale AH1N1v Guida per l uso corretto di mascherine chirurgiche e respiratori per ridurre la trasmissione del nuovo virus influenzale AH1N1v Agg Agosto 2009 Questo documento si propone di fornire indicazioni sull uso

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Antibiotici. quandosì quandono. Lavarsi le mani

Antibiotici. quandosì quandono. Lavarsi le mani Antibiotici quandosì quandono Lavarsi le mani semplice ma efficace Lavarsi le mani è il modo migliore per arrestare la diffusione delle infezioni respiratorie. L 80% delle più comuni infezioni si diffonde

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Conoscere per non avere paura. Capire che si può fare molto, ma non tutto. Accudire con attenzione e rispetto.

Conoscere per non avere paura. Capire che si può fare molto, ma non tutto. Accudire con attenzione e rispetto. Conoscere per non avere paura. Capire che si può fare molto, ma non tutto. Accudire con attenzione e rispetto. Gentili congiunti, Questa piccola guida è stata creata per voi con l obiettivo di aiutarvi

Dettagli

Guida all applicazione (spruzzatura ad aria nebulizzata)

Guida all applicazione (spruzzatura ad aria nebulizzata) Guida all applicazione (spruzzatura ad aria nebulizzata) 1 Spruzzo convenzionale (aria nebulizzata) Una pistola a spruzzo convenzionale è uno strumento che utilizza aria compressa per atomizzare ( nebulizzare

Dettagli

L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere ossidante.

L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere ossidante. Ozono (O 3 ) Che cos è Danni causati Evoluzione Metodo di misura Che cos è L Ozono è un gas altamente reattivo, di odore pungente e ad elevate concentrazioni di colore blu, dotato di un elevato potere

Dettagli

Aptima HIV-1 Quant Dx Assay

Aptima HIV-1 Quant Dx Assay Aptima Aptima HIV-1 Quant Dx Assay Per uso diagnostico in vitro. Solo per l esportazione dagli USA. Informazioni generali................................................ 2 Utilizzo previsto................................................................

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Protezione da Ebola. Cos è, come si previene il contagio, quale barriera scegliere

Protezione da Ebola. Cos è, come si previene il contagio, quale barriera scegliere Protezione da Ebola Cos è, come si previene il contagio, quale barriera scegliere Ed.Ottobre 2014 Il virus Ebola: la sua natura, come si diffonde, quanto è pericoloso L ebola è un virus appartenente alla

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza?

Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Anche tu utilizzi lastre (X-Ray Film) in Chemiluminescenza? Con ALLIANCE Uvitec di Eppendorf Italia risparmi tempo e materiale di consumo, ottieni immagini quantificabili e ci guadagni anche in salute.

Dettagli

Diabete e nefropatia cronica (o malattia renale cronica)

Diabete e nefropatia cronica (o malattia renale cronica) Diabete e nefropatia cronica (o malattia renale cronica) Cos è il diabete? Il diabete mellito, meglio noto come diabete, è una malattia che compare quando l organismo non produce insulina a sufficienza

Dettagli

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott.

OSTEOPOROSI. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI. *Come prevenirla* *Come curarla* *Consigli pratici* Resp. Dott. C. I. D. I. M. U. CENTRO PREVENZIONE DIAGNOSI e TERAPIA DELL OSTEOPOROSI Resp. Dott. Antonio Vercelli OSTEOPOROSI *Come prevenirla* *Come curarla* *Consigli pratici* *Cos è l osteoporosi?* L osteoporosi

Dettagli

BORTEZOMIB (Velcade)

BORTEZOMIB (Velcade) BORTEZOMIB (Velcade) POTENZIALI EFFETTI COLLATERALI Le informazioni contenute in questo modello sono fornite in collaborazione con la Associazione Italiana Malati di Cancro, parenti ed amici ; per maggiori

Dettagli

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009

RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 RENATO TOZZOLI, GRAZIANO KODERMAZ SERVIZIO DI MEDICINA DI LABORATORIO OSPEDALE CIVILE, LATISANA (UD) SPOLETO, 08 MAGGIO 2009 Cisteina di 3 gruppo (176) Unità ripetute ricche di leucina Cisteine di 2 gruppo

Dettagli

L antibiogramm Inutile,necessar ed indispensabile

L antibiogramm Inutile,necessar ed indispensabile Per la terapia DOSSIER MASTITI di una mastite in atto il ricorso a tale test L antibiogramm Inutile,necessar ed indispensabile riveste scarsa importanza. Ma fornisce preziosissime informazioni per le cure

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

Informazioni per i pazienti e le famiglie

Informazioni per i pazienti e le famiglie Che cos è l MRSA? (What is MRSA? Italian) Reparto Prevenzione e controllo delle infezioni UHN Informazioni per i pazienti e le famiglie Patient Education Improving Health Through Education L MRSA è un

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

COS E LA BRONCOSCOPIA

COS E LA BRONCOSCOPIA COS E LA BRONCOSCOPIA COS E LA BRONCOSCOPIA La broncoscopia è un esame con cui è possibile osservare direttamente le vie aeree, cioè laringe, trachea e bronchi, attraverso uno strumento, detto fibrobroncoscopio,

Dettagli

Altre novità della nostra ampia gamma di strumenti!

Altre novità della nostra ampia gamma di strumenti! L innovazione ad un prezzo interessante Altre novità della nostra ampia gamma di strumenti! Exacta+Optech Labcenter SpA Via Bosco n.21 41030 San Prospero (MO) Italia Tel: 059-808101 Fax: 059-908556 Mail:

Dettagli

1,25 (OH) 2 Vitamina D ELISA kit

1,25 (OH) 2 Vitamina D ELISA kit 1,25 (OH) 2 Vitamina D ELISA kit Per la determinazione in vitro della 1,25 (OH) 2 Vitamina D in plasma e siero Gültig ab/valid from 17.03.2008 +8 C IMM-K 2112 +2 C 48 1. APPLICAZIONE Il kit ELISA (Enzyme-Linked-Immuno-Sorbent-Assay)

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

Differenziamento = Creazione cellule specializzate. Il tuo corpo ha bisogno delle cellule staminali

Differenziamento = Creazione cellule specializzate. Il tuo corpo ha bisogno delle cellule staminali Differenziamento = Creazione cellule specializzate Cos è una cellula staminale? Cosa mostra la foto Un pezzo di metallo e molti diversi tipi di viti. Dare origine a diversi tipi di cellule è un processo

Dettagli

DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA

DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA Premesso che nell ambito del progetto Castagna di Montella:

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

PROGRAMMAZIONE. Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA

PROGRAMMAZIONE. Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA PROGRAMMAZIONE Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA Classe: 4^ LTS/A - SALUTE Insegnante: Claudio Furioso Ore preventivo: 132 SCANSIONE MODULI N TITOLO MODULO set ott nov dic gen feb

Dettagli

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua.

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua. La DIGESTIONE Perché è necessario nutrirsi? Il corpo umano consuma energia per muoversi, pensare, mantenere la temperatura costante, ma anche solo per riposarsi. Il consumo minimo di energia è detto metabolismo

Dettagli

TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA

TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA TECNICHE DI BASE PER LA SEPARAZIONE DEI COMPONENTI DI UNA MISCELA CENTRIFUGAZIONE La centrifugazione è un processo che permette di separare una fase solida immiscibile da una fase liquida o due liquidi

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

Corso di Impianti Tecnici per l'edilizia - E. Moretti. Condizionamento CLASSIFICAZIONE DEGLI IMPIANTI DI CONDIZIONAMENTO

Corso di Impianti Tecnici per l'edilizia - E. Moretti. Condizionamento CLASSIFICAZIONE DEGLI IMPIANTI DI CONDIZIONAMENTO 1 Impianti di Climatizzazione e Condizionamento CLASSIFICAZIONE DEGLI IMPIANTI DI CONDIZIONAMENTO Premessa Gli impianti sono realizzati con lo scopo di mantenere all interno degli ambienti confinati condizioni

Dettagli

Prevenzione dell allergia ad inalanti

Prevenzione dell allergia ad inalanti Prevenzione dell allergia ad inalanti La patologia allergica respiratoria è molto frequente nella popolazione generale: la sua prevalenza si aggira in media intorno al 10-15%. Inoltre, negli ultimi 20

Dettagli

SeroCP Quant IgA. Applicazioni. Introduzione - 2 -

SeroCP Quant IgA. Applicazioni. Introduzione - 2 - SeroCP Quant IgA I Applicazioni SeroCP Quant IgA è un Enzyme Linked Immunosorbent Assay (ELISA) per la determinazione semiquantitativa di anticorpi IgA specie specifici anti Chlamydia pneumoniae nel siero

Dettagli

Sei vaccinato? Chi ha il morbillo deve restare a casa. www.stopmorbillo.ch

Sei vaccinato? Chi ha il morbillo deve restare a casa. www.stopmorbillo.ch Sei vaccinato? Chi ha il morbillo deve restare a casa. www.stopmorbillo.ch 0844 448 448 Chi ha il morbillo deve restare a casa. www.stopmorbillo.ch L eliminazione del morbillo un obiettivo internazionale

Dettagli

Università di Roma Tor Vergata

Università di Roma Tor Vergata Università di Roma Tor Vergata Facoltà di Ingegneria Dipartimento di Ingegneria Industriale Corso di: TERMOTECNICA 1 IMPIANTI DI CLIMATIZZAZIONE Ing. G. Bovesecchi gianluigi.bovesecchi@gmail.com 06-7259-7127

Dettagli

Istituto Superiore Vincenzo Cardarelli Istituto Tecnico per Geometri Liceo Artistico A.S. 2014 2015

Istituto Superiore Vincenzo Cardarelli Istituto Tecnico per Geometri Liceo Artistico A.S. 2014 2015 Istituto Superiore Vincenzo Cardarelli Istituto Tecnico per Geometri Liceo Artistico A.S. 2014 2015 Piano di lavoro annuale Materia : Fisica Classi Quinte Blocchi tematici Competenze Traguardi formativi

Dettagli

GUIDA ALLE SOLUZIONI

GUIDA ALLE SOLUZIONI La caratteristica delle trasmissioni digitali è " tutto o niente ": o il segnale è sufficiente, e quindi si riceve l'immagine, oppure è insufficiente, e allora l'immagine non c'è affatto. Non c'è quel

Dettagli

PREVENZIONE E SALUTE GLOBALE

PREVENZIONE E SALUTE GLOBALE PREVENZIONE E SALUTE GLOBALE SI PARTE DALLA VITAMINA D Relatore dr Donata Soppelsa Medico di medicina generale Associato alla Società Italiana di Nutriceutica Quali domande? E sufficiente l integrazione

Dettagli

Il fabbisogno alimentare e il ruolo dei nutrienti

Il fabbisogno alimentare e il ruolo dei nutrienti Il fabbisogno alimentare e il ruolo dei nutrienti Le necessità del nostro corpo Cibo e bevande sono i mezzi con cui il nostro organismo si procura le sostanze di cui ha bisogno per le sue attività vitali.

Dettagli

1 LEZIONE CHE COS E L ALLENAMENTO

1 LEZIONE CHE COS E L ALLENAMENTO 1 LEZIONE CHE COS E L ALLENAMENTO Sono molte le definizioni di allenamento: Definizione generale: E un processo che produce nell organismo un cambiamento di stato che può essere fisico, motorio, psicologico.

Dettagli

Numero 7. L allergia alle muffe L esperto informa che

Numero 7. L allergia alle muffe L esperto informa che Numero 7. L allergia alle muffe L esperto informa che Le muffe fanno parte, insieme ai lieviti e ai funghi a cappello sia mangerecci sia velenosi, di un vastissimo quanto eterogeneo gruppo di organismi,

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA. pertinenza dermatologica. e nei confronti di loro conviventi o contatti

MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA. pertinenza dermatologica. e nei confronti di loro conviventi o contatti MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA Fonte: Ministero della Salute Circolare n 4 del 13 marzo 1998 del MINISTERO DELLA SALUTE Provvedimenti da adottare nei confronti di

Dettagli

CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE

CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE ASO S. Croce e Carle di Cuneo C.I.O. COMITATO INFEZIONI OSPEDALIERE DOCUMENTO DESCRITTIVO TITOLO CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE Data di emissione: 20 aprile 2004 revisione n

Dettagli

STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI:

STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI: STUDI PRELIMINARI COMPARATIVI SULLA BIODISPONIBILITA E CAPACITA DI PERMEARE LA PELLE DI: - RETINOLO PURO - RETINOLO IN LIPOSOMI - RETINOLO IN LIPOSYSTEM COMPLEX - RETINOLO IN CYCLOSYSTEM COMPLEX - VITAMINA

Dettagli

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA Che cos è la degenerazione maculare? La degenerazione maculare è una malattia che interessa la regione centrale della retina (macula), deputata alla visione distinta necessaria per la lettura, la guida

Dettagli

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO Pag. 1/7 SOMMARIO 1. SCOPO E CAMPO DI APPLICAZIONE...2 2. RIFERIMENTI BIBLIOGRAFICI...2 3. MATERIALE NECESSARIO...3 4. MODALITA OPERATIVE...4 5. REGISTRAZIONE E ARCHIVIAZIONE...7 6. RESPONSABILITA...7

Dettagli

Apparato scheletrico. Le funzioni dello scheletro

Apparato scheletrico. Le funzioni dello scheletro Apparato scheletrico Le funzioni dello scheletro Lo scheletro ha la funzione molto importante di sostenere l organismo e di dargli una forma; con l aiuto dei muscoli, a cui offre un attacco, permette al

Dettagli

VAD O VED POTENZIALI EFFETTI COLLATERALI

VAD O VED POTENZIALI EFFETTI COLLATERALI VAD O VED POTENZIALI EFFETTI COLLATERALI 1 Questo schema di cura impiega i seguenti farmaci: vincristina, doxorubicina (adriamicina) o epidoxorubicina, cortisone. Le informazioni contenute in questo modello

Dettagli

Lo schema a blocchi di uno spettrofotometro

Lo schema a blocchi di uno spettrofotometro Prof.ssa Grazia Maria La Torre è il seguente: Lo schema a blocchi di uno spettrofotometro SORGENTE SISTEMA DISPERSIVO CELLA PORTACAMPIONI RIVELATORE REGISTRATORE LA SORGENTE delle radiazioni elettromagnetiche

Dettagli

Prevenzione e controllo dell influenza. Campagna di vaccinazione antinfluenzale per la stagione 2014-15

Prevenzione e controllo dell influenza. Campagna di vaccinazione antinfluenzale per la stagione 2014-15 PROTOCOLLO VACCINAZIONE ANTI-INFLUENZALE Prevenzione e controllo dell influenza. Campagna di vaccinazione antinfluenzale per la stagione 2014-15 Il presente documento contiene: Protocollo operativo Allegato

Dettagli

Istruzioni rapide per l esercizio di pompe idrauliche tipo LP azionate con aria compressa secondo D 7280 e D 7280 H

Istruzioni rapide per l esercizio di pompe idrauliche tipo LP azionate con aria compressa secondo D 7280 e D 7280 H Istruzioni rapide per l esercizio di pompe idrauliche tipo LP azionate con aria compressa secondo D 7280 e D 7280 H 1. Aria compressa e attacco idraulico Fluido in pressione Azionamento Aria compressa,

Dettagli

ESAME DI STATO DI LICEO SCIENTIFICO 2006 Indirizzo Scientifico Tecnologico Progetto Brocca

ESAME DI STATO DI LICEO SCIENTIFICO 2006 Indirizzo Scientifico Tecnologico Progetto Brocca ESAME DI STATO DI LICEO SCIENTIFICO 2006 Indirizzo Scientifico Tecnologico Progetto Brocca Trascrizione del testo e redazione delle soluzioni di Paolo Cavallo. La prova Il candidato svolga una relazione

Dettagli

VARIABILI E DISTRIBUZIONI DI FREQUENZA A.A. 2010/2011

VARIABILI E DISTRIBUZIONI DI FREQUENZA A.A. 2010/2011 VARIABILI E DISTRIBUZIONI DI FREQUENZA A.A. 2010/2011 1 RAPPRESENTARE I DATI: TABELLE E GRAFICI Un insieme di misure è detto serie statistica o serie dei dati 1) Una sua prima elementare elaborazione può

Dettagli

VACCINAZIONI E VACCINI DECALOGO PER LE FAMIGLIE

VACCINAZIONI E VACCINI DECALOGO PER LE FAMIGLIE VACCINAZIONI E VACCINI DECALOGO PER LE FAMIGLIE In un qualsiasi anno prima dell'uso esteso dei vaccini in Italia si registravano circa 3.000 casi di poliomielite, circa 12.000 di difterite, circa 700 casi

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Centrifughe da routine Thermo Scientific SL. Più campioni in meno tempo Risposte più veloci

Centrifughe da routine Thermo Scientific SL. Più campioni in meno tempo Risposte più veloci Centrifughe da routine Thermo Scientific SL Più campioni in meno tempo Risposte più veloci Risposte più veloci con le centrifughe da routine Thermo Scientific SL General Purpose La centrifuga è uno strumento

Dettagli

Salute intestinale in avicoltura Il mondo interiore

Salute intestinale in avicoltura Il mondo interiore Agosto 2013 Salute intestinale in avicoltura Il mondo interiore Dr. Richard A. Bailey, Poultry Health Scientist Sommario Introduzione Flora Intestinale Mantenere in equilibrio la salute intestinale Conclusioni

Dettagli

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica).

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica). 3.4. I LIVELLI I livelli sono strumenti a cannocchiale orizzontale, con i quali si realizza una linea di mira orizzontale. Vengono utilizzati per misurare dislivelli con la tecnica di livellazione geometrica

Dettagli

M A G N E T I C I G E N E R A L I T A'

M A G N E T I C I G E N E R A L I T A' S C H E R M I M A G N E T I C I G E N E R A L I T A' Gli schermi magnetici hanno la funzione di proteggere oggetti sensibili dall'aggressione magnetica esterna. Questi schermi possono essere suddivisi

Dettagli

Effetti dell incendio sull uomo

Effetti dell incendio sull uomo Effetti dell incendio sull uomo ANOSSIA (a causa della riduzione del tasso di ossigeno nell aria) AZIONE TOSSICA DEI FUMI RIDUZIONE DELLA VISIBILITÀ AZIONE TERMICA Essi sono determinati dai prodotti della

Dettagli

Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete?

Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete? Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete? Tratto da Vitamin requirements: is there basis for re-evaluating dietary specifications? S. LEESON 1 Tradotto, adattato

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? 2. Come nasce la sperimentazione clinica e che tipi di studi esistono?

STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? 2. Come nasce la sperimentazione clinica e che tipi di studi esistono? STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? Si definisce sperimentazione clinica, o studio clinico controllato, (in inglese: clinical trial), un esperimento scientifico che genera dati

Dettagli

Altre informazioni sul virus HPV: informazioni approfondite per le utenti

Altre informazioni sul virus HPV: informazioni approfondite per le utenti Altre informazioni sul virus HPV: informazioni approfondite per le utenti Questo è un documento di approfondimento sull HPV. Prima di leggerlo consultate il documento Alcune informazioni sul virus HPV

Dettagli

Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic.

Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic. Astra Formedic S.r.l. - Via Piero Portaluppi, 15 20138 Milano Tel. 02.580011 Email: info.astraformedic@ademorigroup.it web : www.astraformedic.it è un sistema integrato completo di tutti i moduli per eseguire

Dettagli

25/01/2014. Perché filtrare la luce? Filtri e lenti per patologie oculari. Cosa conoscere? Spettro elettromagnetico. Radiazione elettromagnetica

25/01/2014. Perché filtrare la luce? Filtri e lenti per patologie oculari. Cosa conoscere? Spettro elettromagnetico. Radiazione elettromagnetica Filtri e lenti per patologie oculari FIRENZE 19 GENNAIO 2014 Silvano Abati silvanoabati@tiscali.it Dr. Scuola Internazionale di Ottica Optometria Firenze Stazione di Santa Maria Novella Binario 1 A Perché

Dettagli

«DOVE SI TROVANO I BATTERI?»

«DOVE SI TROVANO I BATTERI?» 1 a STRATEGIA EVITARE LA CONTAMINAZIONE conoscere «DOVE SI TROVANO I BATTERI?» I batteri si trovano ovunque nell ambiente (aria, acqua, suolo ed esseri viventi): Sono presenti sulle materie prime, ad es.

Dettagli

Cos'è esattamente la gelatina

Cos'è esattamente la gelatina Cos'è esattamente la gelatina LA GELATINA È PURA E NATURALE La gelatina attualmente in commercio viene prodotta in moderni stabilimenti operanti in conformità ai più rigorosi standard di igiene e sicurezza.

Dettagli

Gli organismi viventi

Gli organismi viventi Gli organismi viventi Gli organismi viventi Quali caratteristiche contraddistinguono i viventi? È facile distinguere un organismo vivente da un oggetto non vivente? Gli organismi viventi Tutti gli organismi

Dettagli

Conduzione di uno studio epidemiologico (osservazionale)

Conduzione di uno studio epidemiologico (osservazionale) Conduzione di uno studio epidemiologico (osservazionale) 1. Definisco l obiettivo e la relazione epidemiologica che voglio studiare 2. Definisco la base dello studio in modo che vi sia massimo contrasto

Dettagli

Cattedra e Divisione di Oncologia Medica. Università degli Studi di Modena e Reggio Emilia. Il Port

Cattedra e Divisione di Oncologia Medica. Università degli Studi di Modena e Reggio Emilia. Il Port Cattedra e Divisione di Oncologia Medica Università degli Studi di Modena e Reggio Emilia Il Port Dott. Roberto Sabbatini Dipartimento Misto di Oncologia ed Ematologia Università degli Studi di Modena

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Sopra ogni aspettativa

Sopra ogni aspettativa Sopra ogni aspettativa Pipette elettroniche Eppendorf Xplorer e Eppendorf Xplorer plus »Un modo intuitivo di lavorare.«chi dà il massimo ogni giorno, merita anche il massimo in termini di strumenti ed

Dettagli

Università di Foggia Dipartimento di Scienze Agrarie, degli Alimenti e dell Ambiente

Università di Foggia Dipartimento di Scienze Agrarie, degli Alimenti e dell Ambiente Università di Foggia Dipartimento di Scienze Agrarie, degli Alimenti e dell Ambiente Produzione di formaggio di bufala a pasta semidura: studio della proteolisi Barbara La Gatta, Giusy Rusco, Aldo Di Luccia

Dettagli

PCB NEI MOLLUSCHI BIVALVI

PCB NEI MOLLUSCHI BIVALVI PCB NEI MOLLUSCHI BIVALVI I. SCARONI, G. CASTELLARI, D. PANNIELLO, A. SANTOLINI, D. FOSCOLI, E. RONCARATI, P. CASALI ARPA EMILIA-ROMAGNA SEZ. RAVENNA Il destino e gli effetti dei PCB nell ambiente sono

Dettagli

2. FONDAMENTI DELLA TECNOLOGIA

2. FONDAMENTI DELLA TECNOLOGIA 2. FONDAMENTI DELLA TECNOLOGIA 2.1 Principio del processo La saldatura a resistenza a pressione si fonda sulla produzione di una giunzione intima, per effetto dell energia termica e meccanica. L energia

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

www.zampadicane.it Guida alle Vaccinazioni

www.zampadicane.it Guida alle Vaccinazioni VACCINAZIONI Le vaccinazioni da fare al proprio cane sono parecchie, alcune sono obbligatorie ed alcune facoltative e possono essere consigliate dal veterinario in casi specifici. Vediamo nel dettaglio

Dettagli

LA DONAZIONE DI SANGUE

LA DONAZIONE DI SANGUE CHE COSA è La donazione di sangue consiste nel prelievo di un determinato volume di sangue da un soggetto sano, chiamato donatore, al fine di trasfonderlo in un soggetto che ha bisogno di sangue o di uno

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione PROTOCOLLO DI BIOSICUREZZA Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione Disinfezione Il ricorso a disinfettanti e disinfestanti, se unito ad altre misure tese a minimizzare

Dettagli

Tecnica ed esperienza per prestazioni elevate.

Tecnica ed esperienza per prestazioni elevate. Tecnica ed esperienza per prestazioni elevate. INDICE La presente guida contiene suggerimenti e indicazioni di carattere generale e a scopo puramente informativo. Non si deve prescindere dal leggere attentamente

Dettagli

2. L INQUINAMENTO ATMOSFERICO

2. L INQUINAMENTO ATMOSFERICO 2. L INQUINAMENTO ATMOSFERICO L aria è una miscela eterogenea formata da gas e particelle di varia natura e dimensioni. La sua composizione si modifica nello spazio e nel tempo per cause naturali e non,

Dettagli

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS)

Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) Pædiatric Rheumatology InterNational Trials Organisation Che cos é? Sindrome di Blau/Sarcoidosi ad esordio precoce (EOS) La sindrome di Blau è una malattia genetica. I pazienti affetti presentano rash

Dettagli