Bioinformatica NGS Next Generation Sequencing

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Bioinformatica NGS Next Generation Sequencing"

Transcript

1 NGS Next Generation Sequencing

2 NGS Le tecnologie di sequenziamento di DNA rappresentano uno strumento fondamentale per la ricerca nel campo della genetica e della biologia molecolare; Dal 2005, piattaforme capaci di sequenziare enormi quantità di dati a costi sostenibili, hanno dato inizio all era del Next Generation Sequencing; 2

3 NGS: I numeri Tecnologie per il sequenziamento di DNA 1977 Sequenziamento manuale (100bp/run) 1987 Metodo SANGER (800bp/run) 1999 Metodo SANGER parallelo (70kbp/run) 2005 NGS Progetto Genoma Umano Inizio Inizio del progetto 1990 Tempi Tempo stimato 15 anni Soggetti Mix di 4 soggetti scelti da un pool di 20 Fine Costo 2.7 Miliardi di dollari 3

4 NGS: La rivoluzione Piattaforma ABI3730 Hiseq2000 Metodo Sanger Illumina Throughput (bp/run) Durata di un run 1 h 7 d Costo (Euro/Gbp) $ 500 $ Il metodo Sanger (first generation) produce reads di lunghezza di circa 800bp a costi molto alti e basso throughput; Metodi di NGS (Roche/454, Illumina/Solexa, etc.) producono reads di lunghezza di circa 100pb con costi molto bassi e alto throughout; I metodi di NGS producono la stessa quantità di dati prodotti dai vecchi metodi in 10 anni in solo un paio di settimane. 4

5 NGS: Produzione dei dati Il processo di sequenziamento consiste nel «rompere» fisicamente il DNA in milioni di piccoli frammenti; Affinché un singolo frammento possa essere «letto» dal sequenziatore, deve essere replicato diverse volte; I sequenziatori di NGS producono frammenti che vengono letti ad entrambe le estremità (paired-end reads) 5

6 NGS: Produzione dei dati I dati prodotti da un sequenziatore consistono in immagini, similmente ai microarray, in cui le luminosità indicano la presenza di un determinato nucleotide; Il sequenziatore possiede un software (base-caller) che permette di trasformare tali immagini in reads. A seconda delle intensità dei segnali vengono associate delle qualità ai singoli nucleotidi, producendo cosi dei file in formato GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 6

7 NGS: Produzione dei dati Formato GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Phread Quality Score Q: Se ad esempio per una base Q=30, allora le possibilità che essa sia un errore è 1/1000 Phred Quality Score Probability of incorrect base call Base call accuracy 10 1 in 10 90% 20 1 in % 30 1 in % 40 1 in % 50 1 in % 7 Esistono due metodi di codifica di Q. Phread33 e Phread64 che consistono nell assegnare un valore numerico in base al codice ascii a cui va aggiunto il valore 33 (o 64).

8 NGS: Allineamento??? Cosa si intende per allineare due sequenze? E possibile calcolare la distanza tra due stringhe utilizzando, per esempio, la distanza di editing; La distanza di editing è definita come il minimo numero di operazioni da eseguire (inserimenti, cancellazioni, sostituzioni) per trasformare una stringa in un altra. a - c c t g a a g c t t - a In questo caso per trasformare la prima stringa nella seconda dobbiamo inserire una g, sostituire una c con una t e cancellare una g. La distanza di editing tra le due stringhe è dunque 3. 8

9 NGS: Allineamento??? Cosa si intende per allineare due sequenze? Siano S e T due sequenze. Un allineamento A associa ad S e T le sequenze S e T, che possono contenere simboli di spazio -, in modo che S = T Rimuovendo gli spazi da S e T otteniamo S e T. Se l = S = T, lo score di un allineamento pairwise è definito da: l i= 1 σ ( S'[ i], T'[ i] ) L allineamento ottimale sarà quello che massimizza la similarità (lo score); 9

10 NGS: Allineamento??? 10 ESEMPIO: NEEDLEMAN-WUNSCH Lo score ottimale V(i,j) di due sequenze S 1.i T 1 j ha le seguenti proprietà: Algoritmo di programmazione dinamica per calcolare l allineamento = = = = = ), ( 1), ( ), ( ) 1, ( ), ( 1) 1, ( max ), ( ), ( ) (0, ), (,0) ( 0 0 j i j i j k k i k k T j i V S j i V T S j i V j i V T j V S i V σ σ σ σ σ match/mismatch deletion insertion

11 NGS: Allineamento??? ESEMPIO: NEEDLEMAN-WUNSCH i A C B C D B S 1 j C A D B D Allineamento ottimale V(6,5) = S 2 V ( i, j) = V max S 1 = ACBCDB S 2 = CADBD ( i 1, V ( i 1, 2 σ ( a, b) = 1 j 1) + σ ( S, T j) + σ ( S, ) V ( i, j 1) + σ (, T ) Otteniamo tre allineamenti ottimali: ACBCDB- ACBCDB- -ACBCDB -C-ADBD -CA-DBD CADB-D- i i j a = b j ) otherwise 11

12 NGS: Allineamento INPUT: Una sequenza Q (generalmente piccola) e un reference G; OUPUT: Posizionamento di Q rispetto a G. Possiamo permettere qualche differenza (mismatch) tra Q e G. Si potrebbe usare BLAST o BLAT: Sono algoritmi di allineamento locale; Sono inefficienti quando si ha a che fare con allineamento di milioni di piccole sequenze; 12

13 NGS: Allineamento rispetto a un reference Caratteristiche di un buon algoritmo di allineamento: Veloce; Permette solo mismatch o al più qualche piccolo indel; Usa tutta la reads (Allineamento globale); Usa le qualità delle basi; Per ogni read siamo interessati a: Posizione nel genoma di riferimento e strand; Posizioni dei mismatch rispetto al reference; 13

14 NGS: Allineamento rispetto a un reference INPUT: Una sequenza conosciuta di genoma di riferimento e un insieme (milioni) di reads provenienti dal sequenziamento del genoma di un individuo; OUPUT: Posizionamento delle reads rispetto al genoma di riferimento; Un certo numero (piccolo) di mismatch è permesso. Il genoma deve essere conosciuto Generalmente la fase di allineamento vero e proprio è preceduta da un preprocessing (INDEXING) del Genoma allo scopo di velocizzare l allineamento stesso. 14

15 NGS: Allineamento rispetto a un reference METODI BASATI SU HASH TABLE SEED (K=5) VALORI AAAAA 34,100000, AAAAC 3120,440, AAAAG. AAAAT. AAACA TTTTT ,12 Si costruisce un dizionario del reference che permette di ricercare le reads. Si considerano le prime K basi di una read (seed o K-mer) e si cerca la posizione nel genoma di riferimento. Una volta trovata si verifica che la parte rimanente della reads si allinei ad esempio con l algoritmo di Smith- Watermann (seed-and-extends). Alcune volte si usano gli spaced-seed cioè seed di lunghezza L dove si richiede che ci sia un match con il reference solo in K posizioni (K<L). Bisogna fare attenzione alla dimensione k. Allineatori di prima generazione: MAQ, ELAND 15

16 NGS: Allineamento rispetto a un reference METODI BASATI SU SUFFIX ARRAY Vengono memorizzati in un indice tutti i suffissi del genoma. Lo spazio e il tempo richiesto è O( G ) I suffissi vengono ordinati. La ricerca di una read r può avvenire con una semplice procedura di ricerca binaria O( r log G ). Allineatori di seconda generazione: SOAP 16

17 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Supponiamo dia vere la stringa: G = BANANA$ Consideriamo tutte le possibili rotazioni e ordiniamo (il simbolo $ può essere considerato come primo o ultimo indifferentemente nell ordinamento): 0 B A N A N A $ 1 A N A N A $ B 2 N A N A $ B A 3 A N A $ B A N 4 N A $ B A N A 5 A $ B A N A N 6 $ B A N A N A 1 A N A N A $ B 3 A N A $ B A N 5 A $ B A N A N 0 B A N A N A $ 2 N A N A $ B A 4 N A $ B A N A 6 $ B A N A N A SA BWT 17

18 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER La trasformata di BW è reversibile; B N N $ A A A BWT 18

19 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Trasformata inversa: Input sort add sort add sort add sort B A B A A N B A N A N A B A N A A N A N N A N A A N N A N A N A N A N A A N A $ N A N A A $ N A $ A $ B N A $ B A $ B A $ B $ B B A $ B A B A N $ B A N B A N A A N A N N A A N A N A N A N A N N A N A A N A N N A A N A N A $ A N A $ N A $ B A $ A $ $ B A $ B $ B A A $ B A $ B A N 19

20 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Trasformata inversa: sort A N A N add B A N A N sort A N A N A add B A N A N A sort A N A N A $ A N A $ A $ B A B A N A N A N A N A $ B $ B A N N A N A $ N A $ B A $ B A N A A N A N A A N A $ B A $ B A N A N A $ B A $ B A N B A N A N N A N A $ N A $ B A $ B A N A N A N A $ B N A $ B A N $ B A N A N A N A N A $ A N A $ B A A $ B A N A A N A $ B A A $ B A N A B A N A N A N A N A $ B N A $ B A N $ B A N A N 20

21 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Trasformata inversa: sort A N A N A $ A N A $ B A A $ B A N A B A N A N A N A N A $ B N A $ B A N $ B A N A N add B A N A N A $ N A N A $ B A N A $ B A N A $ B A N A N A A N A N A $ B A N A $ B A N A $ B A N A N 21

22 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Ancora più importante in NGS è che la stringa trasformata è facilmente comprimibile; Metodi basati sulla trasformata di BW (FM-index) permettono di ricercare efficientemente sottostringhe lavorando direttamente con la BWT compressa. Allineatori di terza generazione: BWA, Bowtie, SOAP2 22

23 NGS: Allineamento rispetto a un reference RISORSE: Il minimo necessario Sistema operativo Linux; 8 processori; 32GB RAM; 2TB disk storage; 23

24 NGS: Assembly de novo INPUT: Un insieme R di piccole sequenze sull alfabeto ={A,C,G,T} estratte dal genoma G; OTPUT: La sequenza del genoma G. 24

25 NGS: Assembly de novo PROBLEMATICHE: Coverage incompleto del genoma; Errori di sequenziamento; Overlap tra reads potrebbero avvenire per caso e non perché effettivamente presenti nel genoma; Una read può provenire da uno strand o dall altro; Repeats; 25

26 NGS: Assembly de novo Reads prodotte (anche diverse librerie con diversi insert size) Pulitura, filtraggio da contaminanti, Error Correction Coverage. Numero medio di reads che coprono una determinata posizione enll assembly Trovare le reads che si sovrappongono e costruire i contig Determinare ordine e distanze tra i contig (usando le paired-end reads Sequenza finita 26

27 NGS: Assembly de novo PULITURA DELLE READS E FILTRAGGIO DA CONTAMINANTI (es rna). La prima fase consiste nel fare un trimming delle reads con scarsa qualità. Spesso accade che i sequenziatori di nuova generazione producano delle reads con scarsa qualità all inizio e alla fine della sequenza; Queste vanno eliminate (in parte o totalmente) al fine di produrre assembly migliori; Nella fase di preparazione, spesso accade che il DNA da sequenziare sia contaminato: Escherichia Coli; Bacteria; Fungi; Mithocondrion; Cloroplast; 27

28 NGS: Assembly de novo ERROR CORRECTION (es QUAKE) Le piattaforme di NGS producono short reads con elevati tassi di errore; La maggior parte degli algoritmi di error correction sono basati sul fatto che ciascuna posizione (base) nel genoma in media è sequenziata molte volte; Sfruttando questa informazione si cerca di correggere le basi in accordo con specifiche euristiche (ad es. k-mer frequency); 28

29 NGS: Assembly de novo ERROR CORRECTION (es QUAKE) La qualità dei risultati ottenuti con i vari error correctors può essere messa in evidenza plottando il grafico dei dei k-mers; ESEMPIO: Se sequenziamo senza errori un frammento di 100bp a 20x, avremo 20 reads da 100bp. Ogni k-mer che compone una read avrà copertura 20x; Se ad esempio abbiamo 19 reads sequenziate perfettamente e 1 read con un errore su una base centrale (ad es. C al posto di T), si avrà il k-mer K che si trova a cavallo di tale errore presente solo in una read (e non in 20) mentre gli altri 19 k-mer che si trovano nella stessa regione delle altre reads saranno concordi tra di loro (19x di copertura) ma discordi con K. Quindi la maggior parte dei k-mer avrà copertura 20x, un k-mer avrà copertura 1x e 1 kmer avra' copertura 19x (1x+19x=20x). Il kmer a copertura 1x è dato da un errore di sequenziamento. Tanto più basso è il picco all inizio del grafico, tanto migliore è il risultato; Il secondo picco dà un idea di quale sia la copertura approssimativa delle reads; Picco degli errori Coverage approssimativo 29

30 NGS: Assembly de novo METODI GREEDY. Partendo da una read a caso, estenderla finchè possibile; Problemi in NGS: Troppe reads da allineare; Zone ripetute provocano errori; Utili solo per piccoli genomi; 30

31 NGS: Assembly de novo METODI BASATI SU STRING GRAPHS (es SGA) OVERLAP GRAPH: E un grafo in cui ogni read è un nodo del grafo e due nodi sono collegati tra loro se le corrispondenti read si sovrappongono per k basi (k è un parametro); STRING GRAPH: Reads che sono contenute in un altra read sono considerate ridondanti e vengono escluse. I transitive edges vengono rimossi. R1 R2 R3 ACATACGATACA TACGATACAGTT GATACAGTTGCA R2 R1 GTTGCA ACATAC R3 Transitive edge Il path R1 > R2 > R3 è un possibile assembly uguale al path R1> R3. 31

32 NGS: Assembly de novo METODI BASATI SU GRAFI DI DE BRUIJN (ABySS, SOAPdenovo, ALLPATHS-LG) In un grafo di De Bruijn ogni nodo rapprersenta in k-mer e due nodi sono connessi tra di loro se i k- mer si sovrappongono per k-1 basi. READ AGATGATTCG AGA GAT ATG TGA GAT ATT TTC TCG Le reads vengono ridotte a k-mers. Il princpale vantaggio è che un k-mer è presente solo una volta. In una situazione ideale un assembly sarebbe un cammino che attraversa ogni arco / nodo solo una volta (cammino Hamiltoniano / Euleriano). AGA GAT ATG TGA ATT K=3 TTC TCG 32

33 NGS: Assembly de novo METODI BASATI SU GRAFI DI DE BRUIJN (ABySS, SOAPdenovo, ALLPATHS-LG) ERRORI: Un errore nelle reads provoca una biforcazione K=3 GTA ACG CGT GTC SNP: Uno SNP provoca una biforcazione che presto converge K=3 CGT GTC TCA ACG CAG CGA GAC ACA 33

34 NGS: Assembly de novo METODI BASATI SU GRAFI DI DE BRUIJN (ABySS, SOAPdenovo, ALLPATHS-LG) REPEATS: Una zona ripetuta provoca la convergenza di due o più path in uno solo K=3 ACG CGT GTC TCA CAG TCG CAT 34

35 NGS: Assembly de novo REPEATS E ASSEMBLY DENOVO Le zone ripetute causano grossi problemi agli assemblatori 35

36 NGS: Assembly de novo SCAFFOLDING Sfruttando le informazioni provenienti dalle paired-end reads (o mate pairs con insert size più grandi), i contig prodotti dagli assemblatori: Vengono ordinati; La distanza tra contig adiacenti viene stimata usando le paired-end reads; 36

37 NGS: Assembly de novo TOOL COMPLETI PER L ASSEMBLY DENOVO Abyss (parallelo): E basato sui grafi di de Bruijn. Si costruisce un grafo in cui i nodi sono k- mers. Due nodi sono legati da un arco se i due k-meri che essi rappresentano si sovrappongono per k-1 caratteri. SGA (multithread): Si costruisce un grafo in cui ogni read è un nodo e due nodi sono legati da un arco se le corrispondenti read si sovrappongono per k valori. Al fine di velocizzare la costruzione del grafo si fa uso di FM-index. ALLPATHS-LG (multithread): Basato anch esso su grafi richiede almeno due librerie: paired-end reads con piccolo (100bp) e alto (3kb, 20kb) insert size. Richiede moltissima RAM. SOAPdenovo (multithread): Basato sempre su Grafi di de Bruijn, richiede molta RAM. 37

38 NGS: Assembly de novo TOOL DEDICATI Quake: Tool per l individuazione e correzione di errori. SOPRA: Tool di scaffolding basato sulla programmazione dinamica. SSPACE: Tool di Scaffolding che sfrutta librerie multiple di paired-end reads. OPERA: Basato su grafi. 38

39 NGS: Assembly de novo TOOL PER LA VISUALIZZAZIONE E ANALISI Tablet: IGV: Gbrowse: Savant: 39

40 NGS: Assembly de novo CRITERI DI VALUTAZIONE Error Correction: Plot dei k-mer; Testing dei vari software con diversi parametri; Lunghezza dell assembly. E possibile stimare la dimensione di un genoma; Lunghezza Max/Media di un contig; N50: La lunghezza del contig tale che la somma di tutti i contig più grandi di esso copra almeno il 50% del genoma (La dimensione N tale che almeno il 50% del genoma è contenuto in contig di size N o maggiore); Sfruttare genomi già esistenti; Mappare le reads sul genoma appena creato (paired-end reads che mappano solo per una delle reads indicano possibili misassembly); Coverage sufficientemente alti; 40

41 NGS: Assembly de novo CRITERI DI VALUTAZIONE Molti tool forniscono delle statistiche che aiutano a capire la qualità dell assembly prodotto. Ad esempio ABySS produce un file di dati che contiene due colonne: La prima colonna contiene la distanza; La seconda colonna contiene il numero di reads allineate a quella distanza; Il picco da informazioni in merito all insert size delle reads; L ampiezza della campana fornisce invece la deviazione standard; file 3- hist di abyss

42 NGS: Assembly de novo Esempio ABySS (su genoma di Olea chloroplast) CONTIGS k trim Total Length Average Max Sequences N50 L50 31 tutte , tutte , tutte , , , tutte , tutte , tutte , , SCAFFOLDS k trim Total Length Average Max Sequences N50 L50 31 tutte , tutte , , , tutte , , , tutte , , , tutte tutte ,

43 NGS: Assembly de novo Esempio ABySS (su genoma di Olea chloroplast) Quando è disponibile un genoma di riferimento si può considerare il dotplot (nei casi in cui il genoma sia abbastanza piccolo) 43

44 NGS: Files e Tools SAM/BAM: Il formato testuale SAM (e corrispondente binario conpresso BAM) permette di memorizzare gli allineamenti prodotti dagli assemblatori. SAMTOOLS permettono di manipolare allineamenti e dati di NGS (samtools.sourceforge.net) 44

45 NGS: Dopo L allineamento Analisi a livello di singola base 45

46 NGS: Dopo L allineamento } 46 SNP Calling

47 NGS: Dopo L allineamento Varianti Strutturali: DELEZIONE Si ossono sfruttano le paired-end reads allineate con il genoma di riferimento e quello prodotto reference Individuo (assembly denovo) 47

48 NGS: Dopo L allineamento Varianti Strutturali: INSERZIONE Si sfruttano le paired-end reads allineate con il genoma di riferimento e quello prodotto (cluster of singletons) 48

49 NGS: Dopo L allineamento IDENTIFICAZIONE DI DUPLICAZIONI Si identificano le zone con copertura inattesa delle reads. 49

50 NGS: Dopo L allineamento ALLINEAMENTO RISPETTO A UN REFERENCE Frazione di genoma di P. Trichocarpa non coperta dalle reads di P. Nigra Populus Trichocarpa reference Populus Nigra reads Abbiamo a che fare con una regione specifica di P. Trichocarpa??? 50

51 NGS: RNA-SEQ E possibile produrre reads provenienti da RNA piuttosto che da DNA al fine di ricostruire il trascrittoma (coding ma anche non coding rna); Genome guided: Le reads relative a mrna vengono allineate a un genoma di riferimento (con o senza annotazioni). Genome Independent: viene fatto un assembly denovo delle reads; Il conteggio delle reads che mappano negli esoni di un gene danno una informazione sul suo livello di espressione; Le reads mappate possono dare indicazioni anche rispetto a nuove strutture (nuovi geni???). 51

52 NGS: Referenze Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup, The Sequence alignment/map (SAM) format and SAMtools, Bioinformatics, 2010, 25, David R Kelley, Michael C Schatz, Steven L Salzberg, Quake: quality-aware detection and correction of sequencing errors, Genome Biology 2010, 11:R116 doi: /gb r116, software: Jared T. Simpson, Richard Durbin, Efficient construction of an assembly string graph using the FMindex (and supplemental materials), Bioinformatics, vo. 26 ISMB 2010, pages , doi: / bioinformatics/btq217, software: https://github.com/jts/sga Li H. and Durbin R., Fast and accurate long-read alignment with Burrows-Wheeler Transform. Bioinformatics, Paolo Ferragina and Giovanni Manzini, "Opportunistic Data Structures with Applications", Proceedings of the 41st Annual Symposium on Foundations of Computer Science. p.390, Eugene Myers, The fragment Assembly String Graph, Bioinformatics,2005, 21,ii79-ii85 52

53 NGS: Referenze The SGA google group: https://groups.google.com/forum/?fromgroups#!forum/sga-users The SGA on line wiki: https://github.com/jts/sga/wiki Butler J, MacCallum I, Kleber M, Shlyakhter IA, Belmonte MK, Lander ES, Nusbaum C, Jaffe DB ALLPATHS: de novo assembly of whole-genome shotgun microreads. Genome Research 18: , software: MacCallum I, Przybylski D, Gnerre S, Burton J, Shlyakhter I, Gnirke A, Malek J, McKernan K, Ranade S, Shea TP, Williams L, Young S, Nusbaum C, Jaffe DB ALLPATHS 2: small genomes assembled accurately and with high continuity from short paired reads. Genome Biology 10: R103. ABySS: A parallel assembler for short read sequence data. Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ, Birol I. Genome Research, 2009-June. (Genome Research, PubMed), software: Luo et al.: SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. GigaScience :18, software: Adel Dayarian, Todd P Michael, Anirvan M Sengupta, SOPRA: Scaffolding algorithm for paired reads via statistical optimization, BMC bioinformatics, 2010, 11:345 doi: / , software: Boetzer M, Henkel CV, Jansen HJ, Butler D, Pirovano W, Scaffolding pre-assembled contigs using SSPACE, Bioinformatics Feb 15;27(4): doi: /bioinformatics/btq683, software: 53

54 NGS: Referenze Gao S, Sung WK, Nagarajan N, Opera: reconstructing optimal genomic scaffolds with high-throughput paired-end sequences, J Comput Biol Nov;18(11): doi: /cmb , software: Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome, Genome Biology 2009, 10:R25, doi: /gb r25 Trapnell C, Pachter L, Salzberg SL. TopHat: discovering slice junctions with RNA-seq. Bioinformatics doi: /bioinformatics/btp120, software: Trapnell C, Williams BA, Pertea G, Mortazavi AM, Kwan G, van Baren MJ, Salzberg SL, Wold B, Pachter L., Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nature Biotechnology doi: /nbt.1621, software: 54

Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):

Dettagli

Lezione 8. DNA sequencing informatics

Lezione 8. DNA sequencing informatics Lezione 8 DNA sequencing informatics Il materiale di questa lezione è contenuto nel libro Next-generation DNA sequencing informatics Edited by Stuart M Brown Disponibile in biblioteca (CHIOSTRO 572.8633

Dettagli

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL

Alcuni aspetti legati al calcolo bioinformatico su CRESCO. Giuseppe Aprea UTMEA-CAL Alcuni aspetti legati al calcolo bioinformatico su CRESCO Giuseppe Aprea UTMEA-CAL Principali attività bioinformatiche ENEA legate al calcolo Assemblaggio de Novo* Trascrittomica Analisi filogenetica Metagenomica*

Dettagli

Analisi di dati RNA-Seq. Alberto Ferrarini

Analisi di dati RNA-Seq. Alberto Ferrarini Analisi di dati RNA-Seq Alberto Ferrarini Il dogma centrale della biologia molecolare DNA Replicazione RNA Trascrizione Traduzione PROTEIN Geni sono trascritti da DNA ad mrnache lascia il nucleo e viene

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of

Dettagli

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq):

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): Il vostro progetto Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): 1. Analisi di qualità 2. Mappatura sul genoma 3. Calcolo dell espressione 4. Test di espressione differenziale 5. Visualizzazione

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione

Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Università degli Studi di Padova Dipartimento di Ingegneria dell Informazione Corso di Laurea in Ingegneria dell Informazione Analisi Critica di Tecniche di Sequenziamento di Nuova Generazione Laureando:

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #3 Dr. Marco Galardini AA 2012/2013 Analisi dati sequenziamento massivo Lezione #3 Dr. Marco Galardini AA 2012/2013 NGS: Next Generation Sequencing

Dettagli

Esercitazioni di Genomica

Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of Padua Perché bioinformatica?

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

DNA sequencing. Reading Genomes. Giovanni Bacci

DNA sequencing. Reading Genomes. Giovanni Bacci Reading Genomes Giovanni Bacci Evoluzione del sequenziamento 1977 Frederick Sanger Prima tecnica di sequenziamento 1987 Applyed Biosystems Prima macchina automatica per il sequenziamento del DNA 1998 Phil

Dettagli

TECNICHE DI COMPRESSIONE DATI

TECNICHE DI COMPRESSIONE DATI TECNICHE DI COMPRESSIONE DATI COMPRESSIONE DATI La compressione produce una rappresentazione più compatta delle informazioni è come se si usassero meno parole per dire la stessa cosa in modo diverso. Esistono

Dettagli

Metodologie informa/che per l analisi dei genomi

Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Metodologie informa/che per l analisi dei genomi Perchè sono qui? Walter Sanseverino, CEO at !? Informa/cs = Genomics? We have a problem!!! Focus curve

Dettagli

Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Richiami di informatica e programmazione

Richiami di informatica e programmazione Richiami di informatica e programmazione Il calcolatore E una macchina usata per Analizzare Elaborare Collezionare precisamente e velocemente una grande quantità di informazioni. Non è creativo Occorre

Dettagli

Riconoscimento e recupero dell informazione per bioinformatica

Riconoscimento e recupero dell informazione per bioinformatica Riconoscimento e recupero dell informazione per bioinformatica Clustering: similarità Manuele Bicego Corso di Laurea in Bioinformatica Dipartimento di Informatica - Università di Verona Definizioni preliminari

Dettagli

Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT

Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Note del Corso di Modelli Biologici Discreti: Un paio di algoritmi DNA per risolvere SAT Giuditta Franco Corso di Laurea in Bioinformatica - AA 2012/2013 Uno dei più grossi risultati nell informatica degli

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

Genomics Session. Lezione 2 Assemblaggio del genoma

Genomics Session. Lezione 2 Assemblaggio del genoma Genomics Session Assemblaggio del genoma Genomica Computazionale, Laurea Magistrale AA 2010/2011 Genome assembly software: Celera Whole-genome Assembler Maschera sequenze ripetute Identifica regioni sovrapposte

Dettagli

Altri metodi di indicizzazione

Altri metodi di indicizzazione Organizzazione a indici su più livelli Altri metodi di indicizzazione Al crescere della dimensione del file l organizzazione sequenziale a indice diventa inefficiente: in lettura a causa del crescere del

Dettagli

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi

Summer School 2015. Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Summer School 2015 Alloreattività e trapianti nell uomo: le nuove metodiche di studio e i trapianti alternativi Applicazioni della Next-Generation Sequencing con tecnologia Illumina Roberto Cusano 04-06

Dettagli

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq):

Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): Il vostro progetto Analisi di dati di sequenziamento del trascrittoma (RNA-Seq): 1. Analisi di qualità 2. Mappatura sul genoma 3. Calcolo dell espressione 4. Test di espressione differenziale 5. Visualizzazione

Dettagli

Corso di Elementi di Bionformatica

Corso di Elementi di Bionformatica Corso di Elementi di Bionformatica Laurea Triennale in Informatica Il formato FASTQ per la qualità delle sequenze Anno Accademico 2015-2016 Docente del laboratorio: Raffaella Rizzi 1 La qualità delle sequenze

Dettagli

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW

Lezione 2: Allineamento di sequenze. BLAST e CLUSTALW Lezione 2: Allineamento di sequenze BLAST e CLUSTALW Allineamento di sequenze Allineamenti L avvento della genomica moderna permette di analizzare le similitudini e le differenze tra organismi a livello

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Bioinformatica: DNA e Algoritmi

Bioinformatica: DNA e Algoritmi Bioinformatica: DNA e Algoritmi Alberto Policriti Dpt. of Mathematics and Informatics, University of Udine. Applied Genomics Institute Di cosa parleremo In generale Deniamo i termini: DNA & Algoritmi Tecnologie

Dettagli

Algoritmi e strutture dati. Codici di Huffman

Algoritmi e strutture dati. Codici di Huffman Algoritmi e strutture dati Codici di Huffman Memorizzazione dei dati Quando un file viene memorizzato, esso va memorizzato in qualche formato binario Modo più semplice: memorizzare il codice ASCII per

Dettagli

Tesi di Laurea di Mauro Baluda matr. 038208

Tesi di Laurea di Mauro Baluda matr. 038208 Università degli Studi di Milano Bicocca Facoltà di Scienze Matematiche Fisiche e Naturali Corso di Laurea in Informatica Algoritmi per l'allineamento di Sequenze Tesi di Laurea di matr. 038208 Relatore:

Dettagli

Informatica e biotecnologie II parte

Informatica e biotecnologie II parte Informatica e biotecnologie II parte Analisi di sequenze: allineamenti CGCTTCGGACGAAATCGCATCAGCATACGATCGCATGCCGGGCGGGATAAC CGAAATCGCATCAGCATACGATCGCATGC Bioinformatica La Bioinformatica è una disciplina

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015

Next Generation Sequencers: from the bacterial culture to raw data. Valeria Michelacci NGS course, June 2015 Next Generation Sequencers: from the bacterial culture to raw data Valeria Michelacci NGS course, June 2015 COSTS ASSOCIATED WITH DNA SEQUENCING 80-100 $ per Bacterial Genome!! Benefits from NGS Massive

Dettagli

Varianti del genoma umano

Varianti del genoma umano 1000 genomes Varianti del genoma umano dbsnp 132 30,442,771 SNP (1% del genoma) Varianti strutturali (DGV) CNVs: 66741 Inversioni: 953 InDels (100bp-1Kb): 34229 Total CNV loci: 15963 35% del genoma Obiettivi

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

RICOGNIZIONE DEL SOFTWARE DISPONIBILE PER ANALISI PRIMARIA DI DATI NGS

RICOGNIZIONE DEL SOFTWARE DISPONIBILE PER ANALISI PRIMARIA DI DATI NGS Consiglio Nazionale delle Ricerche Istituto di Calcolo e Reti ad Alte Prestazioni RICOGNIZIONE DEL SOFTWARE DISPONIBILE PER ANALISI PRIMARIA DI DATI NGS R. Cassandra, Mario R. Guarracino RT-ICAR-NA-2013-5

Dettagli

Politecnico di Milano

Politecnico di Milano Politecnico di Milano Scuola di Ingegneria Industriale e dell Informazione - Milano Leonardo Corso di Studi in Ingegneria Matematica Analisi di forma dei profili ChIP-Seq Relatore: Prof. Piercesare Secchi

Dettagli

La tecnologia dei microarray

La tecnologia dei microarray La tecnologia dei microarray I microarray I progetti di sequenziamento (progetti permesso di identificare migliaia di geni genoma) ) hanno Migliaia di geni (ed i loro prodotti, le proteine) operano in

Dettagli

Speciale AGRICOLTURA E AGROINDUSTRIA. Introduzione

Speciale AGRICOLTURA E AGROINDUSTRIA. Introduzione eciale AGRICOLTURA E AGROINDUSTRIA Il ruolo dell ICT nelle scienze omiche high-throughput Lo sviluppo delle nuove scienze omiche (genomica, trascrittomica, metabolomica ecc.) e della strumentazione ad

Dettagli

PROGRAMMA DEL CORSO. Teoria

PROGRAMMA DEL CORSO. Teoria CORSO DI LAUREA in BIOLOGIA PROGRAMMA DEL CORSO INTRODUZONE ALL INFORMATICA A.A. 2014-15 Docente: Annamaria Bria Esercitatori: Salvatore Ielpa Barbara Nardi PROGRAMMA DEL CORSO Teoria 1. Cosa si intende

Dettagli

La codifica dell informazione

La codifica dell informazione La codifica dell informazione Parte I Sui testi di approfondimento: leggere dal Cap. del testo C (Console, Ribaudo):.,. fino a pg.6 La codifica delle informazioni Un calcolatore memorizza ed elabora informazioni

Dettagli

Memorizzazione dei dati: Dischi e File

Memorizzazione dei dati: Dischi e File Memorizzazione dei dati: Dischi e File Query\update Query plan Execution Engine richieste di indici, record e file Index/file/record Manager comandi su pagine Query Compiler Buffer Manager Lettura/scrittura

Dettagli

LABORATORIO. 2 Lezioni su Basi di Dati Contatti:

LABORATORIO. 2 Lezioni su Basi di Dati Contatti: PRINCIPI DI INFORMATICA CORSO DI LAUREA IN SCIENZE BIOLOGICHE Gennaro Cordasco e Rosario De Chiara {cordasco,dechiara}@dia.unisa.it Dipartimento di Informatica ed Applicazioni R.M. Capocelli Laboratorio

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Sequence Alignment Algorithms

Sequence Alignment Algorithms Sequence Alignment Algorithms Algoritmi per l Allineamento di Sequenze Relatore: Prof. Giancarlo Mauri Correlatore: Prof. Gianluca Della Vedova Tesi di Laurea di: Mauro Baluda Matricola 038208 Part of

Dettagli

Software Applicativo. Hardware. Sistema Operativo Software di Base Traduttori e Linguaggi

Software Applicativo. Hardware. Sistema Operativo Software di Base Traduttori e Linguaggi : di base e applicativo L HardWare (monitor, tastiera, circuiti, stampante, ) è il nucleo fondamentale del calcolatore ma da solo non serve a nulla. Bisogna utilizzare il software per poterlo fare funzionare.

Dettagli

DNA sequence alignment

DNA sequence alignment DNA sequence alignment - Introduzione: un possibile modello per rappresentare il DNA. Il DNA (Acido desossiribonucleico) è una sostanza presente nei nuclei cellulari, sia vegetali che animali; a questo

Dettagli

Sistemi Operativi Il Sistema Operativo Windows (parte 3)

Sistemi Operativi Il Sistema Operativo Windows (parte 3) Sistemi Operativi Il Sistema Operativo Windows (parte 3) Docente: Claudio E. Palazzi cpalazzi@math.unipd.it Crediti per queste slides al Prof. Tullio Vardanega Architettura di NTFS 1 NTFS file system adottato

Dettagli

GESTIONE DELLA MEMORIA CENTRALE

GESTIONE DELLA MEMORIA CENTRALE GESTIONE DELLA MEMORIA CENTRALE E MEMORIA VIRTUALE 7.1 Gestione della memoria Segmentazione Segmentazione con paginazione Memoria Virtuale Paginazione su richiesta Sostituzione delle pagine Trashing Esempi:

Dettagli

Struttura logica di un programma

Struttura logica di un programma Struttura logica di un programma Tutti i programmi per computer prevedono tre operazioni principali: l input di dati (cioè l inserimento delle informazioni da elaborare) il calcolo dei risultati cercati

Dettagli

11 Realizzazione del File System. 11.1.1 Struttura a livelli (fig. 11.1) 11.4 Allocazione dei file

11 Realizzazione del File System. 11.1.1 Struttura a livelli (fig. 11.1) 11.4 Allocazione dei file 11 Realizzazione del File System 1 Metodi di allocazione Allocazione contigua Allocazione concatenata e varianti Allocazione indicizzata e varianti Gestione dello spazio libero 11.1.1 Struttura a livelli

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Microsoft SQL Server Integration Services

Microsoft SQL Server Integration Services Sistemi Informativi Dott.ssa Elisa Turricchia Alma Mater Studiorum - Università di Bologna elisa.turricchia2@unibo.it 1 Microsoft SQL Server Integration Services 1 SQL Server Integration Services SSIS

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

L architettura del calcolatore (Prima parte)

L architettura del calcolatore (Prima parte) L architettura del calcolatore (Prima parte) Percorso di Preparazione agli Studi di Ingegneria Università degli Studi di Brescia Docente: Massimiliano Giacomin Calcolatore astratto e reale Concetto astratto

Dettagli

Elementi di Bioinformatica per lʼanalisi di dati NGS

Elementi di Bioinformatica per lʼanalisi di dati NGS Corso di Alta formazione in Elementi di Bioinformatica per lʼanalisi di dati NGS 21-23 Settembre 2011 Centro Didattico Morgagni Viale Morgagni 40, Firenze Presentazione del corso Il corso di alta formazione

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile

Dettagli

Informatica 3. LEZIONE 23: Indicizzazione. Modulo 1: Indicizzazione lineare, ISAM e ad albero Modulo 2: 2-3 trees, B-trees e B + -trees

Informatica 3. LEZIONE 23: Indicizzazione. Modulo 1: Indicizzazione lineare, ISAM e ad albero Modulo 2: 2-3 trees, B-trees e B + -trees Informatica 3 LEZIONE 23: Indicizzazione Modulo 1: Indicizzazione lineare, ISAM e ad albero Modulo 2: 2-3 trees, B-trees e B + -trees Informatica 3 Lezione 23 - Modulo 1 Indicizzazione lineare, ISAM e

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE

Dettagli

Le Macchine di Turing

Le Macchine di Turing Le Macchine di Turing Come è fatta una MdT? Una MdT è definita da: un nastro una testina uno stato interno un programma uno stato iniziale Il nastro Il nastro è infinito suddiviso in celle In una cella

Dettagli

Capitolo Quarto...2 Le direttive di assemblaggio di ASM 68000...2 Premessa...2 1. Program Location Counter e direttiva ORG...2 2.

Capitolo Quarto...2 Le direttive di assemblaggio di ASM 68000...2 Premessa...2 1. Program Location Counter e direttiva ORG...2 2. Capitolo Quarto...2 Le direttive di assemblaggio di ASM 68000...2 Premessa...2 1. Program Location Counter e direttiva ORG...2 2. Dichiarazione di dati: le direttive DS e DC...3 2.1 Direttiva DS...3 2.2

Dettagli

I tipi di dato astratti

I tipi di dato astratti I tipi di dato astratti.0 I tipi di dato astratti c Diego Calvanese Fondamenti di Informatica Corso di Laurea in Ingegneria Elettronica A.A. 001/00.0 0 I tipi di dato astratti La nozione di tipo di dato

Dettagli

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST

ESERCITAZIONE 3. OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST ESERCITAZIONE 3 OBIETTIVO: Ricerca di omologhe mediante i programmi FASTA e BLAST L'esercitazione prevede l'utilizzo di risorse web per effettuare ricerche di similarità con la proteina GRB2 (growth factor

Dettagli

Sistemi RAID tutti i dati che contiene RAID

Sistemi RAID tutti i dati che contiene RAID Sistemi RAID 1 Sistemi RAID Dei tre elementi fondamentali di un qualsiasi sistema computerizzato: processore, memoria primaria, memoria secondaria, quest ultimo è di gran lunga il più lento. Inoltre, il

Dettagli

Sistemi RAID. Sistemi RAID. Sistemi RAID

Sistemi RAID. Sistemi RAID. Sistemi RAID Sistemi RAID 1 Sistemi RAID Dei tre elementi fondamentali di un qualsiasi sistema computerizzato: processore, memoria primaria, memoria secondaria, quest ultimo è di gran lunga il più lento. Inoltre, il

Dettagli

Sistemi RAID. Sistemi RAID

Sistemi RAID. Sistemi RAID Sistemi RAID 1 Sistemi RAID Dei tre elementi fondamentali di un qualsiasi sistema computerizzato: processore, memoria primaria, memoria secondaria, quest ultimo è di gran lunga il più lento. Inoltre, il

Dettagli

Progetto Febbraio 2013 - Appello 1: Diffusione di tweets sul grafo di Twitter

Progetto Febbraio 2013 - Appello 1: Diffusione di tweets sul grafo di Twitter UNIVERSITÀ DEGLI STUDI DI MILANO, DIPARTIMENTO DI INFORMATICA LAUREA TRIENNALE IN COMUNICAZIONE DIGITALE CORSO DI RETI DI CALCOLATORI ANNO ACCADEMICO 2011/2012 Progetto Febbraio 2013 - Appello 1: Diffusione

Dettagli

Software di compressione

Software di compressione Software di compressione di Giulia Giacon 1 Di cosa stiamo parlando? Si tratta di software applicativi in grado di comprimere e di decomprimere un file. 1. La quantità di bit necessari alla rappresentazione

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie

Dettagli

L enigma del XXI secolo: decifrare il codice della vita

L enigma del XXI secolo: decifrare il codice della vita L enigma del XXI secolo: decifrare il codice della vita David Horner Dipar9mento di Bioscienze Università degli Studi di Milano Via Celoria 26 Milano 20133 david.horner@unimi.it Regola di Chargaff %A =

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Sommario. 1 Realizzazione del STG. Introduzione. 1 traduzione delle specifiche informali in specifiche formali (STG o

Sommario. 1 Realizzazione del STG. Introduzione. 1 traduzione delle specifiche informali in specifiche formali (STG o Sommario Sintesi di macchine a stati finiti 1 Realizzazione del ST M. avalli 2 utoma minimo di SM completamente specificate 6th June 2007 3 Ottimizzazione di SM non completamente specificate Sommario ()

Dettagli

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni Anomalie Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni 17 Transcrittasi inversa 18 Codice genetico mitocondriale 19 Codone

Dettagli

PROVA FINALE V. AULETTA G. PERSIANO ALGORITMI II - -MAGIS INFO

PROVA FINALE V. AULETTA G. PERSIANO ALGORITMI II - -MAGIS INFO PROVA FINALE V. AULETTA G. PERSIANO ALGORITMI II - -MAGIS INFO 1. Load Balancing Un istanza del problema del load balancing consiste di una sequenza p 1,..., p n di interi positivi (pesi dei job) e un

Dettagli

Corso di Informatica Generale (C. L. Economia e Commercio) Ing. Valerio Lacagnina Rappresentazione dell informazione negli elaboratori

Corso di Informatica Generale (C. L. Economia e Commercio) Ing. Valerio Lacagnina Rappresentazione dell informazione negli elaboratori Informazione e computer Si può rappresentare l informazione attraverso varie forme: Numeri Testi Suoni Immagini 0001010010100101010 Computer Cerchiamo di capire come tutte queste informazioni possano essere

Dettagli

PROGETTAZIONE FISICA

PROGETTAZIONE FISICA PROGETTAZIONE FISICA Memorizzazione su disco, organizzazione di file e tecniche hash 2 Introduzione La collezione di dati che costituisce una BDD deve essere fisicamente organizzata su qualche supporto

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

ENZIMI DI RESTRIZIONE

ENZIMI DI RESTRIZIONE ENZIMI DI RESTRIZIONE La scoperta degli enzimi di restrizione e modificazione Intorno agli anni 50 si notò che talvolta l introduzione in E.coli di DNA esogeno, proveniente da un diverso ceppo di E.coli,

Dettagli

SISTEMI OPERATIVI. Gestione dei dischi. Gestione dei dischi e sistemi RAID

SISTEMI OPERATIVI. Gestione dei dischi. Gestione dei dischi e sistemi RAID SISTEMI OPERATIVI 08.c Gestione dei dischi e sistemi RAID Gestione dei dischi Caratteristiche dei dischi magnetici Schedulazione degli accessi al disco Sistemi RAID 1 Struttura meccanica 2 traccia testina

Dettagli

TSP con eliminazione di sottocicli

TSP con eliminazione di sottocicli TSP con eliminazione di sottocicli Un commesso viaggiatore deve visitare 7 clienti in modo da minimizzare la distanza percorsa. Le distanze (in Km) tra ognuno dei clienti sono come segue: 3 5 7-8 9 57

Dettagli

Livello di Rete. Prof. Filippo Lanubile. Obiettivo

Livello di Rete. Prof. Filippo Lanubile. Obiettivo Livello di Rete Circuiti virtuali e datagram La funzione di instradamento Costruzione della tabella di routing Algoritmi di routing adattivi: distance vector routing e link-state routing Routing gerarchico

Dettagli

gestisci client/fornitori, progetti e documenti aziendali con un unica applicazione web Introduzione... 2 Accesso... 2 Gestione anagrafica...

gestisci client/fornitori, progetti e documenti aziendali con un unica applicazione web Introduzione... 2 Accesso... 2 Gestione anagrafica... DocCloud gestisci client/fornitori, progetti e documenti aziendali con un unica applicazione web Introduzione... 2 Accesso... 2 Gestione anagrafica... 3 Gestione documenti... 4 Ricerca documenti... 8 Persone...11

Dettagli

Svantaggi della Commutazione di Circuito. Commutazione di Pacchetto. Struttura di un Pacchetto

Svantaggi della Commutazione di Circuito. Commutazione di Pacchetto. Struttura di un Pacchetto Università degli studi di Salerno Laurea in Informatica I semestre / Commutazione di Pacchetto Prof. Vincenzo Auletta auletta@dia.unisa.it http://www.dia.unisa.it/professori/auletta/ Svantaggi della Commutazione

Dettagli

Varianti Macchine di Turing

Varianti Macchine di Turing Varianti Macchine di Turing Esistono definizioni alternative di macchina di Turing. Chiamate Varianti. Tra queste vedremo: MdT a più nastri e MdT non deterministiche. Mostriamo: tutte le varianti ragionevoli

Dettagli

Complessità Computazionale

Complessità Computazionale Complessità Computazionale Analisi Algoritmi e pseudocodice Cosa significa analizzare un algoritmo Modello di calcolo Analisi del caso peggiore e del caso medio Esempio di algoritmo in pseudocodice INSERTION

Dettagli

Linguaggi di programmazione

Linguaggi di programmazione Linguaggi di programmazione Programmazione L attività con cui si predispone l elaboratore ad eseguire un particolare insieme di azioni su particolari dati, allo scopo di risolvere un problema Dati Input

Dettagli

Architettura di un computer

Architettura di un computer Architettura di un computer Modulo di Informatica Dott.sa Sara Zuppiroli A.A. 2012-2013 Modulo di Informatica () Architettura A.A. 2012-2013 1 / 36 La tecnologia Cerchiamo di capire alcuni concetti su

Dettagli

Corso: Informatica+ Andrea Cremonini. Lezione del 20/10/2014

Corso: Informatica+ Andrea Cremonini. Lezione del 20/10/2014 Corso: Informatica+ Andrea Cremonini Lezione del 20/10/2014 1 Cosa è un computer? Un elaboratore di dati e immagini Uno smartphone Il decoder di Sky Una console di gioco siamo circondati! andrea.cremon

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

CAPITOLO 1 INTRODUZIONE ALLE RETI COMPLESSE

CAPITOLO 1 INTRODUZIONE ALLE RETI COMPLESSE CAPITOLO 1 INTRODUZIONE ALLE RETI COMPLESSE Negli ultimi anni si è compreso che sistemi anche molto diversi tra loro possono essere efficacemente descritti in termini di cosiddetti "networks" o reti complesse.

Dettagli

Sorgenti autorevoli in ambienti hyperlinkati.

Sorgenti autorevoli in ambienti hyperlinkati. Sorgenti autorevoli in ambienti hyperlinkati. La qualità di un metodo di ricerca richiede la valutazione umana dovuta alla soggettività inerente alla nozione di rilevanza. I motori di ricerca correnti,

Dettagli

INFORMATICA. Corso di Laurea in Scienze dell'educazione

INFORMATICA. Corso di Laurea in Scienze dell'educazione INFORMATICA Corso di Laurea in Scienze dell'educazione Introduzione all Informatica Docente: Mario Alviano Studio: Dipartimento di Matematica Cubo 30B 2 Piano Ricevimento: giovedì 18:30 19:30 (avvisare

Dettagli

Avviare il computer e collegarsi in modo sicuro utilizzando un nome utente e una password.

Avviare il computer e collegarsi in modo sicuro utilizzando un nome utente e una password. Uso del computer e gestione dei file Primi passi col computer Avviare il computer e collegarsi in modo sicuro utilizzando un nome utente e una password. Spegnere il computer impiegando la procedura corretta.

Dettagli

Introduzione all elaborazione di immagini Part II

Introduzione all elaborazione di immagini Part II Introduzione all elaborazione di immagini Part II Obiettivi delle tecniche di elaborazione di immagini: miglioramento di qualità (image enhancement) ripristino di qualità o restauro (image restoration)

Dettagli