Bioinformatica NGS Next Generation Sequencing

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Bioinformatica NGS Next Generation Sequencing"

Transcript

1 NGS Next Generation Sequencing

2 NGS Le tecnologie di sequenziamento di DNA rappresentano uno strumento fondamentale per la ricerca nel campo della genetica e della biologia molecolare; Dal 2005, piattaforme capaci di sequenziare enormi quantità di dati a costi sostenibili, hanno dato inizio all era del Next Generation Sequencing; 2

3 NGS: I numeri Tecnologie per il sequenziamento di DNA 1977 Sequenziamento manuale (100bp/run) 1987 Metodo SANGER (800bp/run) 1999 Metodo SANGER parallelo (70kbp/run) 2005 NGS Progetto Genoma Umano Inizio Inizio del progetto 1990 Tempi Tempo stimato 15 anni Soggetti Mix di 4 soggetti scelti da un pool di 20 Fine Costo 2.7 Miliardi di dollari 3

4 NGS: La rivoluzione Piattaforma ABI3730 Hiseq2000 Metodo Sanger Illumina Throughput (bp/run) Durata di un run 1 h 7 d Costo (Euro/Gbp) $ 500 $ Il metodo Sanger (first generation) produce reads di lunghezza di circa 800bp a costi molto alti e basso throughput; Metodi di NGS (Roche/454, Illumina/Solexa, etc.) producono reads di lunghezza di circa 100pb con costi molto bassi e alto throughout; I metodi di NGS producono la stessa quantità di dati prodotti dai vecchi metodi in 10 anni in solo un paio di settimane. 4

5 NGS: Produzione dei dati Il processo di sequenziamento consiste nel «rompere» fisicamente il DNA in milioni di piccoli frammenti; Affinché un singolo frammento possa essere «letto» dal sequenziatore, deve essere replicato diverse volte; I sequenziatori di NGS producono frammenti che vengono letti ad entrambe le estremità (paired-end reads) 5

6 NGS: Produzione dei dati I dati prodotti da un sequenziatore consistono in immagini, similmente ai microarray, in cui le luminosità indicano la presenza di un determinato nucleotide; Il sequenziatore possiede un software (base-caller) che permette di trasformare tali immagini in reads. A seconda delle intensità dei segnali vengono associate delle qualità ai singoli nucleotidi, producendo cosi dei file in formato GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 6

7 NGS: Produzione dei dati Formato GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT +!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65 Phread Quality Score Q: Se ad esempio per una base Q=30, allora le possibilità che essa sia un errore è 1/1000 Phred Quality Score Probability of incorrect base call Base call accuracy 10 1 in 10 90% 20 1 in % 30 1 in % 40 1 in % 50 1 in % 7 Esistono due metodi di codifica di Q. Phread33 e Phread64 che consistono nell assegnare un valore numerico in base al codice ascii a cui va aggiunto il valore 33 (o 64).

8 NGS: Allineamento??? Cosa si intende per allineare due sequenze? E possibile calcolare la distanza tra due stringhe utilizzando, per esempio, la distanza di editing; La distanza di editing è definita come il minimo numero di operazioni da eseguire (inserimenti, cancellazioni, sostituzioni) per trasformare una stringa in un altra. a - c c t g a a g c t t - a In questo caso per trasformare la prima stringa nella seconda dobbiamo inserire una g, sostituire una c con una t e cancellare una g. La distanza di editing tra le due stringhe è dunque 3. 8

9 NGS: Allineamento??? Cosa si intende per allineare due sequenze? Siano S e T due sequenze. Un allineamento A associa ad S e T le sequenze S e T, che possono contenere simboli di spazio -, in modo che S = T Rimuovendo gli spazi da S e T otteniamo S e T. Se l = S = T, lo score di un allineamento pairwise è definito da: l i= 1 σ ( S'[ i], T'[ i] ) L allineamento ottimale sarà quello che massimizza la similarità (lo score); 9

10 NGS: Allineamento??? 10 ESEMPIO: NEEDLEMAN-WUNSCH Lo score ottimale V(i,j) di due sequenze S 1.i T 1 j ha le seguenti proprietà: Algoritmo di programmazione dinamica per calcolare l allineamento = = = = = ), ( 1), ( ), ( ) 1, ( ), ( 1) 1, ( max ), ( ), ( ) (0, ), (,0) ( 0 0 j i j i j k k i k k T j i V S j i V T S j i V j i V T j V S i V σ σ σ σ σ match/mismatch deletion insertion

11 NGS: Allineamento??? ESEMPIO: NEEDLEMAN-WUNSCH i A C B C D B S 1 j C A D B D Allineamento ottimale V(6,5) = S 2 V ( i, j) = V max S 1 = ACBCDB S 2 = CADBD ( i 1, V ( i 1, 2 σ ( a, b) = 1 j 1) + σ ( S, T j) + σ ( S, ) V ( i, j 1) + σ (, T ) Otteniamo tre allineamenti ottimali: ACBCDB- ACBCDB- -ACBCDB -C-ADBD -CA-DBD CADB-D- i i j a = b j ) otherwise 11

12 NGS: Allineamento INPUT: Una sequenza Q (generalmente piccola) e un reference G; OUPUT: Posizionamento di Q rispetto a G. Possiamo permettere qualche differenza (mismatch) tra Q e G. Si potrebbe usare BLAST o BLAT: Sono algoritmi di allineamento locale; Sono inefficienti quando si ha a che fare con allineamento di milioni di piccole sequenze; 12

13 NGS: Allineamento rispetto a un reference Caratteristiche di un buon algoritmo di allineamento: Veloce; Permette solo mismatch o al più qualche piccolo indel; Usa tutta la reads (Allineamento globale); Usa le qualità delle basi; Per ogni read siamo interessati a: Posizione nel genoma di riferimento e strand; Posizioni dei mismatch rispetto al reference; 13

14 NGS: Allineamento rispetto a un reference INPUT: Una sequenza conosciuta di genoma di riferimento e un insieme (milioni) di reads provenienti dal sequenziamento del genoma di un individuo; OUPUT: Posizionamento delle reads rispetto al genoma di riferimento; Un certo numero (piccolo) di mismatch è permesso. Il genoma deve essere conosciuto Generalmente la fase di allineamento vero e proprio è preceduta da un preprocessing (INDEXING) del Genoma allo scopo di velocizzare l allineamento stesso. 14

15 NGS: Allineamento rispetto a un reference METODI BASATI SU HASH TABLE SEED (K=5) VALORI AAAAA 34,100000, AAAAC 3120,440, AAAAG. AAAAT. AAACA TTTTT ,12 Si costruisce un dizionario del reference che permette di ricercare le reads. Si considerano le prime K basi di una read (seed o K-mer) e si cerca la posizione nel genoma di riferimento. Una volta trovata si verifica che la parte rimanente della reads si allinei ad esempio con l algoritmo di Smith- Watermann (seed-and-extends). Alcune volte si usano gli spaced-seed cioè seed di lunghezza L dove si richiede che ci sia un match con il reference solo in K posizioni (K<L). Bisogna fare attenzione alla dimensione k. Allineatori di prima generazione: MAQ, ELAND 15

16 NGS: Allineamento rispetto a un reference METODI BASATI SU SUFFIX ARRAY Vengono memorizzati in un indice tutti i suffissi del genoma. Lo spazio e il tempo richiesto è O( G ) I suffissi vengono ordinati. La ricerca di una read r può avvenire con una semplice procedura di ricerca binaria O( r log G ). Allineatori di seconda generazione: SOAP 16

17 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Supponiamo dia vere la stringa: G = BANANA$ Consideriamo tutte le possibili rotazioni e ordiniamo (il simbolo $ può essere considerato come primo o ultimo indifferentemente nell ordinamento): 0 B A N A N A $ 1 A N A N A $ B 2 N A N A $ B A 3 A N A $ B A N 4 N A $ B A N A 5 A $ B A N A N 6 $ B A N A N A 1 A N A N A $ B 3 A N A $ B A N 5 A $ B A N A N 0 B A N A N A $ 2 N A N A $ B A 4 N A $ B A N A 6 $ B A N A N A SA BWT 17

18 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER La trasformata di BW è reversibile; B N N $ A A A BWT 18

19 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Trasformata inversa: Input sort add sort add sort add sort B A B A A N B A N A N A B A N A A N A N N A N A A N N A N A N A N A N A A N A $ N A N A A $ N A $ A $ B N A $ B A $ B A $ B $ B B A $ B A B A N $ B A N B A N A A N A N N A A N A N A N A N A N N A N A A N A N N A A N A N A $ A N A $ N A $ B A $ A $ $ B A $ B $ B A A $ B A $ B A N 19

20 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Trasformata inversa: sort A N A N add B A N A N sort A N A N A add B A N A N A sort A N A N A $ A N A $ A $ B A B A N A N A N A N A $ B $ B A N N A N A $ N A $ B A $ B A N A A N A N A A N A $ B A $ B A N A N A $ B A $ B A N B A N A N N A N A $ N A $ B A $ B A N A N A N A $ B N A $ B A N $ B A N A N A N A N A $ A N A $ B A A $ B A N A A N A $ B A A $ B A N A B A N A N A N A N A $ B N A $ B A N $ B A N A N 20

21 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Trasformata inversa: sort A N A N A $ A N A $ B A A $ B A N A B A N A N A N A N A $ B N A $ B A N $ B A N A N add B A N A N A $ N A N A $ B A N A $ B A N A $ B A N A N A A N A N A $ B A N A $ B A N A $ B A N A N 21

22 NGS: Allineamento rispetto a un reference METODI BASATI SU TRASFORMATA DI BURROWS WHEELER Ancora più importante in NGS è che la stringa trasformata è facilmente comprimibile; Metodi basati sulla trasformata di BW (FM-index) permettono di ricercare efficientemente sottostringhe lavorando direttamente con la BWT compressa. Allineatori di terza generazione: BWA, Bowtie, SOAP2 22

23 NGS: Allineamento rispetto a un reference RISORSE: Il minimo necessario Sistema operativo Linux; 8 processori; 32GB RAM; 2TB disk storage; 23

24 NGS: Assembly de novo INPUT: Un insieme R di piccole sequenze sull alfabeto ={A,C,G,T} estratte dal genoma G; OTPUT: La sequenza del genoma G. 24

25 NGS: Assembly de novo PROBLEMATICHE: Coverage incompleto del genoma; Errori di sequenziamento; Overlap tra reads potrebbero avvenire per caso e non perché effettivamente presenti nel genoma; Una read può provenire da uno strand o dall altro; Repeats; 25

26 NGS: Assembly de novo Reads prodotte (anche diverse librerie con diversi insert size) Pulitura, filtraggio da contaminanti, Error Correction Coverage. Numero medio di reads che coprono una determinata posizione enll assembly Trovare le reads che si sovrappongono e costruire i contig Determinare ordine e distanze tra i contig (usando le paired-end reads Sequenza finita 26

27 NGS: Assembly de novo PULITURA DELLE READS E FILTRAGGIO DA CONTAMINANTI (es rna). La prima fase consiste nel fare un trimming delle reads con scarsa qualità. Spesso accade che i sequenziatori di nuova generazione producano delle reads con scarsa qualità all inizio e alla fine della sequenza; Queste vanno eliminate (in parte o totalmente) al fine di produrre assembly migliori; Nella fase di preparazione, spesso accade che il DNA da sequenziare sia contaminato: Escherichia Coli; Bacteria; Fungi; Mithocondrion; Cloroplast; 27

28 NGS: Assembly de novo ERROR CORRECTION (es QUAKE) Le piattaforme di NGS producono short reads con elevati tassi di errore; La maggior parte degli algoritmi di error correction sono basati sul fatto che ciascuna posizione (base) nel genoma in media è sequenziata molte volte; Sfruttando questa informazione si cerca di correggere le basi in accordo con specifiche euristiche (ad es. k-mer frequency); 28

29 NGS: Assembly de novo ERROR CORRECTION (es QUAKE) La qualità dei risultati ottenuti con i vari error correctors può essere messa in evidenza plottando il grafico dei dei k-mers; ESEMPIO: Se sequenziamo senza errori un frammento di 100bp a 20x, avremo 20 reads da 100bp. Ogni k-mer che compone una read avrà copertura 20x; Se ad esempio abbiamo 19 reads sequenziate perfettamente e 1 read con un errore su una base centrale (ad es. C al posto di T), si avrà il k-mer K che si trova a cavallo di tale errore presente solo in una read (e non in 20) mentre gli altri 19 k-mer che si trovano nella stessa regione delle altre reads saranno concordi tra di loro (19x di copertura) ma discordi con K. Quindi la maggior parte dei k-mer avrà copertura 20x, un k-mer avrà copertura 1x e 1 kmer avra' copertura 19x (1x+19x=20x). Il kmer a copertura 1x è dato da un errore di sequenziamento. Tanto più basso è il picco all inizio del grafico, tanto migliore è il risultato; Il secondo picco dà un idea di quale sia la copertura approssimativa delle reads; Picco degli errori Coverage approssimativo 29

30 NGS: Assembly de novo METODI GREEDY. Partendo da una read a caso, estenderla finchè possibile; Problemi in NGS: Troppe reads da allineare; Zone ripetute provocano errori; Utili solo per piccoli genomi; 30

31 NGS: Assembly de novo METODI BASATI SU STRING GRAPHS (es SGA) OVERLAP GRAPH: E un grafo in cui ogni read è un nodo del grafo e due nodi sono collegati tra loro se le corrispondenti read si sovrappongono per k basi (k è un parametro); STRING GRAPH: Reads che sono contenute in un altra read sono considerate ridondanti e vengono escluse. I transitive edges vengono rimossi. R1 R2 R3 ACATACGATACA TACGATACAGTT GATACAGTTGCA R2 R1 GTTGCA ACATAC R3 Transitive edge Il path R1 > R2 > R3 è un possibile assembly uguale al path R1> R3. 31

32 NGS: Assembly de novo METODI BASATI SU GRAFI DI DE BRUIJN (ABySS, SOAPdenovo, ALLPATHS-LG) In un grafo di De Bruijn ogni nodo rapprersenta in k-mer e due nodi sono connessi tra di loro se i k- mer si sovrappongono per k-1 basi. READ AGATGATTCG AGA GAT ATG TGA GAT ATT TTC TCG Le reads vengono ridotte a k-mers. Il princpale vantaggio è che un k-mer è presente solo una volta. In una situazione ideale un assembly sarebbe un cammino che attraversa ogni arco / nodo solo una volta (cammino Hamiltoniano / Euleriano). AGA GAT ATG TGA ATT K=3 TTC TCG 32

33 NGS: Assembly de novo METODI BASATI SU GRAFI DI DE BRUIJN (ABySS, SOAPdenovo, ALLPATHS-LG) ERRORI: Un errore nelle reads provoca una biforcazione K=3 GTA ACG CGT GTC SNP: Uno SNP provoca una biforcazione che presto converge K=3 CGT GTC TCA ACG CAG CGA GAC ACA 33

34 NGS: Assembly de novo METODI BASATI SU GRAFI DI DE BRUIJN (ABySS, SOAPdenovo, ALLPATHS-LG) REPEATS: Una zona ripetuta provoca la convergenza di due o più path in uno solo K=3 ACG CGT GTC TCA CAG TCG CAT 34

35 NGS: Assembly de novo REPEATS E ASSEMBLY DENOVO Le zone ripetute causano grossi problemi agli assemblatori 35

36 NGS: Assembly de novo SCAFFOLDING Sfruttando le informazioni provenienti dalle paired-end reads (o mate pairs con insert size più grandi), i contig prodotti dagli assemblatori: Vengono ordinati; La distanza tra contig adiacenti viene stimata usando le paired-end reads; 36

37 NGS: Assembly de novo TOOL COMPLETI PER L ASSEMBLY DENOVO Abyss (parallelo): E basato sui grafi di de Bruijn. Si costruisce un grafo in cui i nodi sono k- mers. Due nodi sono legati da un arco se i due k-meri che essi rappresentano si sovrappongono per k-1 caratteri. SGA (multithread): Si costruisce un grafo in cui ogni read è un nodo e due nodi sono legati da un arco se le corrispondenti read si sovrappongono per k valori. Al fine di velocizzare la costruzione del grafo si fa uso di FM-index. ALLPATHS-LG (multithread): Basato anch esso su grafi richiede almeno due librerie: paired-end reads con piccolo (100bp) e alto (3kb, 20kb) insert size. Richiede moltissima RAM. SOAPdenovo (multithread): Basato sempre su Grafi di de Bruijn, richiede molta RAM. 37

38 NGS: Assembly de novo TOOL DEDICATI Quake: Tool per l individuazione e correzione di errori. SOPRA: Tool di scaffolding basato sulla programmazione dinamica. SSPACE: Tool di Scaffolding che sfrutta librerie multiple di paired-end reads. OPERA: Basato su grafi. 38

39 NGS: Assembly de novo TOOL PER LA VISUALIZZAZIONE E ANALISI Tablet: IGV: Gbrowse: Savant: 39

40 NGS: Assembly de novo CRITERI DI VALUTAZIONE Error Correction: Plot dei k-mer; Testing dei vari software con diversi parametri; Lunghezza dell assembly. E possibile stimare la dimensione di un genoma; Lunghezza Max/Media di un contig; N50: La lunghezza del contig tale che la somma di tutti i contig più grandi di esso copra almeno il 50% del genoma (La dimensione N tale che almeno il 50% del genoma è contenuto in contig di size N o maggiore); Sfruttare genomi già esistenti; Mappare le reads sul genoma appena creato (paired-end reads che mappano solo per una delle reads indicano possibili misassembly); Coverage sufficientemente alti; 40

41 NGS: Assembly de novo CRITERI DI VALUTAZIONE Molti tool forniscono delle statistiche che aiutano a capire la qualità dell assembly prodotto. Ad esempio ABySS produce un file di dati che contiene due colonne: La prima colonna contiene la distanza; La seconda colonna contiene il numero di reads allineate a quella distanza; Il picco da informazioni in merito all insert size delle reads; L ampiezza della campana fornisce invece la deviazione standard; file 3- hist di abyss

42 NGS: Assembly de novo Esempio ABySS (su genoma di Olea chloroplast) CONTIGS k trim Total Length Average Max Sequences N50 L50 31 tutte , tutte , tutte , , , tutte , tutte , tutte , , SCAFFOLDS k trim Total Length Average Max Sequences N50 L50 31 tutte , tutte , , , tutte , , , tutte , , , tutte tutte ,

43 NGS: Assembly de novo Esempio ABySS (su genoma di Olea chloroplast) Quando è disponibile un genoma di riferimento si può considerare il dotplot (nei casi in cui il genoma sia abbastanza piccolo) 43

44 NGS: Files e Tools SAM/BAM: Il formato testuale SAM (e corrispondente binario conpresso BAM) permette di memorizzare gli allineamenti prodotti dagli assemblatori. SAMTOOLS permettono di manipolare allineamenti e dati di NGS (samtools.sourceforge.net) 44

45 NGS: Dopo L allineamento Analisi a livello di singola base 45

46 NGS: Dopo L allineamento } 46 SNP Calling

47 NGS: Dopo L allineamento Varianti Strutturali: DELEZIONE Si ossono sfruttano le paired-end reads allineate con il genoma di riferimento e quello prodotto reference Individuo (assembly denovo) 47

48 NGS: Dopo L allineamento Varianti Strutturali: INSERZIONE Si sfruttano le paired-end reads allineate con il genoma di riferimento e quello prodotto (cluster of singletons) 48

49 NGS: Dopo L allineamento IDENTIFICAZIONE DI DUPLICAZIONI Si identificano le zone con copertura inattesa delle reads. 49

50 NGS: Dopo L allineamento ALLINEAMENTO RISPETTO A UN REFERENCE Frazione di genoma di P. Trichocarpa non coperta dalle reads di P. Nigra Populus Trichocarpa reference Populus Nigra reads Abbiamo a che fare con una regione specifica di P. Trichocarpa??? 50

51 NGS: RNA-SEQ E possibile produrre reads provenienti da RNA piuttosto che da DNA al fine di ricostruire il trascrittoma (coding ma anche non coding rna); Genome guided: Le reads relative a mrna vengono allineate a un genoma di riferimento (con o senza annotazioni). Genome Independent: viene fatto un assembly denovo delle reads; Il conteggio delle reads che mappano negli esoni di un gene danno una informazione sul suo livello di espressione; Le reads mappate possono dare indicazioni anche rispetto a nuove strutture (nuovi geni???). 51

52 NGS: Referenze Li H., Handsaker B., Wysoker A., Fennell T., Ruan J., Homer N., Marth G., Abecasis G., Durbin R. and 1000 Genome Project Data Processing Subgroup, The Sequence alignment/map (SAM) format and SAMtools, Bioinformatics, 2010, 25, David R Kelley, Michael C Schatz, Steven L Salzberg, Quake: quality-aware detection and correction of sequencing errors, Genome Biology 2010, 11:R116 doi: /gb r116, software: Jared T. Simpson, Richard Durbin, Efficient construction of an assembly string graph using the FMindex (and supplemental materials), Bioinformatics, vo. 26 ISMB 2010, pages , doi: / bioinformatics/btq217, software: https://github.com/jts/sga Li H. and Durbin R., Fast and accurate long-read alignment with Burrows-Wheeler Transform. Bioinformatics, Paolo Ferragina and Giovanni Manzini, "Opportunistic Data Structures with Applications", Proceedings of the 41st Annual Symposium on Foundations of Computer Science. p.390, Eugene Myers, The fragment Assembly String Graph, Bioinformatics,2005, 21,ii79-ii85 52

53 NGS: Referenze The SGA google group: https://groups.google.com/forum/?fromgroups#!forum/sga-users The SGA on line wiki: https://github.com/jts/sga/wiki Butler J, MacCallum I, Kleber M, Shlyakhter IA, Belmonte MK, Lander ES, Nusbaum C, Jaffe DB ALLPATHS: de novo assembly of whole-genome shotgun microreads. Genome Research 18: , software: MacCallum I, Przybylski D, Gnerre S, Burton J, Shlyakhter I, Gnirke A, Malek J, McKernan K, Ranade S, Shea TP, Williams L, Young S, Nusbaum C, Jaffe DB ALLPATHS 2: small genomes assembled accurately and with high continuity from short paired reads. Genome Biology 10: R103. ABySS: A parallel assembler for short read sequence data. Simpson JT, Wong K, Jackman SD, Schein JE, Jones SJ, Birol I. Genome Research, 2009-June. (Genome Research, PubMed), software: Luo et al.: SOAPdenovo2: an empirically improved memory-efficient short-read de novo assembler. GigaScience :18, software: Adel Dayarian, Todd P Michael, Anirvan M Sengupta, SOPRA: Scaffolding algorithm for paired reads via statistical optimization, BMC bioinformatics, 2010, 11:345 doi: / , software: Boetzer M, Henkel CV, Jansen HJ, Butler D, Pirovano W, Scaffolding pre-assembled contigs using SSPACE, Bioinformatics Feb 15;27(4): doi: /bioinformatics/btq683, software: 53

54 NGS: Referenze Gao S, Sung WK, Nagarajan N, Opera: reconstructing optimal genomic scaffolds with high-throughput paired-end sequences, J Comput Biol Nov;18(11): doi: /cmb , software: Ben Langmead, Cole Trapnell, Mihai Pop and Steven L Salzberg, Ultrafast and memory-efficient alignment of short DNA sequences to the human genome, Genome Biology 2009, 10:R25, doi: /gb r25 Trapnell C, Pachter L, Salzberg SL. TopHat: discovering slice junctions with RNA-seq. Bioinformatics doi: /bioinformatics/btp120, software: Trapnell C, Williams BA, Pertea G, Mortazavi AM, Kwan G, van Baren MJ, Salzberg SL, Wold B, Pachter L., Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation, Nature Biotechnology doi: /nbt.1621, software: 54

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Introduzione agli algoritmi e alla programmazione in VisualBasic.Net

Introduzione agli algoritmi e alla programmazione in VisualBasic.Net Lezione 1 Introduzione agli algoritmi e alla programmazione in VisualBasic.Net Definizione di utente e di programmatore L utente è qualsiasi persona che usa il computer anche se non è in grado di programmarlo

Dettagli

Nella prima lezione... Che cos è il Digitale. Prima parte: Che cos è il Digitale. Che cos è il Digitale. Che cos è il Digitale

Nella prima lezione... Che cos è il Digitale. Prima parte: Che cos è il Digitale. Che cos è il Digitale. Che cos è il Digitale !"$#%!" #% Nella prima lezione... Definizione di Informatica Cosa è una soluzione algoritmica Esempi di algoritmi cicalese@dia.unisa.it 2 Prima parte: Società dell informazione Ma cosa vuol dire società

Dettagli

Rappresentazione dei numeri in un calcolatore

Rappresentazione dei numeri in un calcolatore Corso di Calcolatori Elettronici I A.A. 2010-2011 Rappresentazione dei numeri in un calcolatore Lezione 2 Università degli Studi di Napoli Federico II Facoltà di Ingegneria Rappresentazione dei numeri

Dettagli

Quando A e B coincidono una coppia ordinata é determinata anche dalla loro posizione.

Quando A e B coincidono una coppia ordinata é determinata anche dalla loro posizione. Grafi ed Alberi Pag. /26 Grafi ed Alberi In questo capitolo richiameremo i principali concetti di due ADT che ricorreranno puntualmente nel corso della nostra trattazione: i grafi e gli alberi. Naturale

Dettagli

2 Formulazione dello shortest path come problema di flusso

2 Formulazione dello shortest path come problema di flusso Strumenti della Teoria dei Giochi per l Informatica A.A. 2009/10 Lecture 20: 28 Maggio 2010 Cycle Monotonicity Docente: Vincenzo Auletta Note redatte da: Annibale Panichella Abstract In questa lezione

Dettagli

Guida rapida all uso di ECM Titanium

Guida rapida all uso di ECM Titanium Guida rapida all uso di ECM Titanium Introduzione Questa guida contiene una spiegazione semplificata del funzionamento del software per Chiputilizzare al meglio il Tuning ECM Titanium ed include tutte

Dettagli

Corso di Informatica Generale (C. L. Economia e Commercio) Ing. Valerio Lacagnina Rappresentazione in virgola mobile

Corso di Informatica Generale (C. L. Economia e Commercio) Ing. Valerio Lacagnina Rappresentazione in virgola mobile Problemi connessi all utilizzo di un numero di bit limitato Abbiamo visto quali sono i vantaggi dell utilizzo della rappresentazione in complemento alla base: corrispondenza biunivoca fra rappresentazione

Dettagli

Esercizi per il corso di Algoritmi e Strutture Dati

Esercizi per il corso di Algoritmi e Strutture Dati 1 Esercizi per il corso di Algoritmi e Strutture Dati Esercizi sulla Tecnica Divide et Impera N.B. Tutti gli algoritmi vanno scritti in pseudocodice (non in Java, né in C++, etc. ). Di tutti gli algoritmi

Dettagli

Principal Component Analysis

Principal Component Analysis Principal Component Analysis Alessandro Rezzani Abstract L articolo descrive una delle tecniche di riduzione della dimensionalità del data set: il metodo dell analisi delle componenti principali (Principal

Dettagli

Data Alignment and (Geo)Referencing (sometimes Registration process)

Data Alignment and (Geo)Referencing (sometimes Registration process) Data Alignment and (Geo)Referencing (sometimes Registration process) All data aquired from a scan position are refered to an intrinsic reference system (even if more than one scan has been performed) Data

Dettagli

VIRTUALIZE IT. www.digibyte.it - digibyte@digibyte.it

VIRTUALIZE IT. www.digibyte.it - digibyte@digibyte.it il server? virtualizzalo!! Se ti stai domandando: ma cosa stanno dicendo? ancora non sai che la virtualizzazione è una tecnologia software, oggi ormai consolidata, che sta progressivamente modificando

Dettagli

Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera

Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera Ricerca Operativa Branch-and-Bound per problemi di Programmazione Lineare Intera L. De Giovanni AVVERTENZA: le note presentate di seguito non hanno alcuna pretesa di completezza, né hanno lo scopo di sostituirsi

Dettagli

Manipolazione di testi: espressioni regolari

Manipolazione di testi: espressioni regolari Manipolazione di testi: espressioni regolari Un meccanismo per specificare un pattern, che, di fatto, è la rappresentazione sintetica di un insieme (eventualmente infinito) di stringhe: il pattern viene

Dettagli

Alberi binari. Ilaria Castelli castelli@dii.unisi.it A.A. 2009/2010. Università degli Studi di Siena Dipartimento di Ingegneria dell Informazione

Alberi binari. Ilaria Castelli castelli@dii.unisi.it A.A. 2009/2010. Università degli Studi di Siena Dipartimento di Ingegneria dell Informazione Alberi binari Ilaria Castelli castelli@dii.unisi.it Università degli Studi di Siena Dipartimento di Ingegneria dell Informazione A.A. 2009/2010 I. Castelli Alberi binari, A.A. 2009/2010 1/20 Alberi binari

Dettagli

> MULTI TASKING > MULTI PROCESS > MULTI CORE

> MULTI TASKING > MULTI PROCESS > MULTI CORE > MULTI TASKING > MULTI PROCESS > MULTI CORE WorkNC V21 multicore 64 bits : Benefici di WorkNC Aumento generale della produttività, grazie alle nuove tecnologie multi-core, 64 bit e Windows 7 Calcolo di

Dettagli

Indicizzazione terza parte e modello booleano

Indicizzazione terza parte e modello booleano Reperimento dell informazione (IR) - aa 2014-2015 Indicizzazione terza parte e modello booleano Gruppo di ricerca su Sistemi di Gestione delle Informazioni (IMS) Dipartimento di Ingegneria dell Informazione

Dettagli

Ricerca non informata in uno spazio di stati

Ricerca non informata in uno spazio di stati Università di Bergamo Facoltà di Ingegneria Intelligenza Artificiale Paolo Salvaneschi A5_2 V2.4 Ricerca non informata in uno spazio di stati Il contenuto del documento è liberamente utilizzabile dagli

Dettagli

Universita' di Ferrara Dipartimento di Matematica e Informatica. Algoritmi e Strutture Dati. Rappresentazione concreta di insiemi e Hash table

Universita' di Ferrara Dipartimento di Matematica e Informatica. Algoritmi e Strutture Dati. Rappresentazione concreta di insiemi e Hash table Universita' di Ferrara Dipartimento di Matematica e Informatica Algoritmi e Strutture Dati Rappresentazione concreta di insiemi e Hash table Copyright 2006-2015 by Claudio Salati. Lez. 9a 1 Rappresentazione

Dettagli

Seconda Prova di Ricerca Operativa. Cognome Nome Numero Matricola A 1/12 A 2/12

Seconda Prova di Ricerca Operativa. Cognome Nome Numero Matricola A 1/12 A 2/12 A / A / Seconda Prova di Ricerca Operativa Cognome Nome Numero Matricola Nota: LA RISOLUZIONE CORRETTA DEGLI ESERCIZI CONTRADDISTINTI DA UN ASTERISCO È CONDIZIONE NECESSARIA PER IL RAGGIUNGIMENTO DELLA

Dettagli

I FILTRI SED, GREP (e AWK) Tratto da http://www.pluto.it/files/ildp/guide/abs/textproc.html SED

I FILTRI SED, GREP (e AWK) Tratto da http://www.pluto.it/files/ildp/guide/abs/textproc.html SED I FILTRI SED, GREP (e AWK) Tratto da http://www.pluto.it/files/ildp/guide/abs/textproc.html SED SED è un programma in grado di eseguire delle trasformazioni elementari in un flusso di dati di ingresso,

Dettagli

Predire la struttura terziaria

Predire la struttura terziaria Predire la struttura terziaria E di gran lunga la predizione più complessa che si possa fare su una proteina. Esistono 3 metodi principali di predizione: 1 - Homology modelling: se si conoscono proteine

Dettagli

IL PROBLEMA DELLO SHORTEST SPANNING TREE

IL PROBLEMA DELLO SHORTEST SPANNING TREE IL PROBLEMA DELLO SHORTEST SPANNING TREE n. 1 - Formulazione del problema Consideriamo il seguente problema: Abbiamo un certo numero di città a cui deve essere fornito un servizio, quale può essere l energia

Dettagli

Sistemi Operativi. Interfaccia del File System FILE SYSTEM : INTERFACCIA. Concetto di File. Metodi di Accesso. Struttura delle Directory

Sistemi Operativi. Interfaccia del File System FILE SYSTEM : INTERFACCIA. Concetto di File. Metodi di Accesso. Struttura delle Directory FILE SYSTEM : INTERFACCIA 8.1 Interfaccia del File System Concetto di File Metodi di Accesso Struttura delle Directory Montaggio del File System Condivisione di File Protezione 8.2 Concetto di File File

Dettagli

Introduzione a MySQL

Introduzione a MySQL Introduzione a MySQL Cinzia Cappiello Alessandro Raffio Politecnico di Milano Prima di iniziare qualche dettaglio su MySQL MySQL è un sistema di gestione di basi di dati relazionali (RDBMS) composto da

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

1. Si consideri uno spazio di indirizzamento logico di otto pagine di 1024 parole ognuna, mappate su una memoria fisica di 32 frame.

1. Si consideri uno spazio di indirizzamento logico di otto pagine di 1024 parole ognuna, mappate su una memoria fisica di 32 frame. 1. Si consideri uno spazio di indirizzamento logico di otto pagine di 1024 parole ognuna, mappate su una memoria fisica di 32 frame. (a) Da quanti bit è costituito l indirizzo logico? (b) Da quanti bit

Dettagli

Altri cifrari a blocchi

Altri cifrari a blocchi Altri cifrari a blocchi Barbara Masucci Dipartimento di Informatica ed Applicazioni Università di Salerno masucci@dia.unisa.it http://www.dia.unisa.it/professori/masucci RC2 [1989] IDEA (International

Dettagli

Dati importati/esportati

Dati importati/esportati Dati importati/esportati Dati importati Al workspace MATLAB script Dati esportati file 1 File di testo (.txt) Spreadsheet Database Altro Elaborazione dati Grafici File di testo Relazioni Codice Database

Dettagli

CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1

CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1 1.1 Che cos è un algoritmo CAPITOLO PRIMO IL CONCETTO DI ALGORITMO 1 Gli algoritmi sono metodi per la soluzione di problemi. Possiamo caratterizzare un problema mediante i dati di cui si dispone all inizio

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova. Metodi per supportare le decisioni relative alla gestione di progetti

Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova. Metodi per supportare le decisioni relative alla gestione di progetti Project Management Massimo Paolucci (paolucci@dist.unige.it) DIST Università di Genova Project Management 2 Metodi per supportare le decisioni relative alla gestione di progetti esempi sono progetti nell

Dettagli

Test di comunicazione tra due LOGO! 0BA7: Master - Master

Test di comunicazione tra due LOGO! 0BA7: Master - Master Industry Test di comunicazione tra due LOGO! 0BA7: Master - Master Dispositivi utilizzati: - 2 LOGO! 0BA7 (6ED1 052-1MD00-0AB7) - Scalance X-208 LOGO! 0BA7 Client IP: 192.168.0.1 LOGO! 0BA7 Server IP:

Dettagli

I.Stat Guida utente Versione 1.7 Dicembre 2010

I.Stat Guida utente Versione 1.7 Dicembre 2010 I.Stat Guida utente Versione 1.7 Dicembre 2010 1 Sommario INTRODUZIONE 3 I concetti principali di I.Stat 4 Organizzazione dei dati 4 Ricerca 5 GUIDA UTENTE 6 Per iniziare 6 Selezione della lingua 7 Individuazione

Dettagli

EndNote Web. Quick Reference Card THOMSON SCIENTIFIC

EndNote Web. Quick Reference Card THOMSON SCIENTIFIC THOMSON SCIENTIFIC EndNote Web Quick Reference Card Web è un servizio online ideato per aiutare studenti e ricercatori nel processo di scrittura di un documento di ricerca. ISI Web of Knowledge, EndNote

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

v in v out x c1 (t) Molt. di N.L. H(f) n

v in v out x c1 (t) Molt. di N.L. H(f) n Comunicazioni elettriche A - Prof. Giulio Colavolpe Compito n. 3 3.1 Lo schema di Fig. 1 è un modulatore FM (a banda larga). L oscillatore che genera la portante per il modulatore FM e per la conversione

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

Process mining & Optimization Un approccio matematico al problema

Process mining & Optimization Un approccio matematico al problema Res User Meeting 2014 con la partecipazione di Scriviamo insieme il futuro Paolo Ferrandi Responsabile Tecnico Research for Enterprise Systems Federico Bonelli Engineer Process mining & Optimization Un

Dettagli

RefWorks Guida all utente Versione 4.0

RefWorks Guida all utente Versione 4.0 Accesso a RefWorks per utenti registrati RefWorks Guida all utente Versione 4.0 Dalla pagina web www.refworks.com/refworks Inserire il proprio username (indirizzo e-mail) e password NB: Agli utenti remoti

Dettagli

lavorare con dati tabellari in ArcGis

lavorare con dati tabellari in ArcGis lavorare con dati tabellari in ArcGis 1. gestione delle tabelle 2. aggregazione di dati tabellari 3. relazioni con tabelle esterne 4. modifica di dati tabellari (1) gestione delle tabelle Tipi di tabelle

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

AA 2006-07 LA RICORSIONE

AA 2006-07 LA RICORSIONE PROGRAMMAZIONE AA 2006-07 LA RICORSIONE AA 2006-07 Prof.ssa A. Lanza - DIB 1/18 LA RICORSIONE Il concetto di ricorsione nasce dalla matematica Una funzione matematica è definita ricorsivamente quando nella

Dettagli

Flusso a costo minimo e simplesso su reti

Flusso a costo minimo e simplesso su reti Flusso a costo minimo e simplesso su reti La particolare struttura di alcuni problemi di PL può essere talvolta utilizzata per la progettazione di tecniche risolutive molto più efficienti dell algoritmo

Dettagli

INTRODUZIONE, LINGUAGGIO, HANDS ON. Giuseppe Cirillo g.cirillo@unina.it

INTRODUZIONE, LINGUAGGIO, HANDS ON. Giuseppe Cirillo g.cirillo@unina.it INTRODUZIONE, LINGUAGGIO, HANDS ON Giuseppe Cirillo g.cirillo@unina.it Il linguaggio C 1972-Dennis Ritchie 1978-Definizione 1990-ANSI C 1966 Martin Richars (MIT) Semplificando CPL usato per sviluppare

Dettagli

Minimo sottografo ricoprente. Minimo sottografo ricoprente. Minimo albero ricoprente. Minimo albero ricoprente

Minimo sottografo ricoprente. Minimo sottografo ricoprente. Minimo albero ricoprente. Minimo albero ricoprente Minimo sottografo ricoprente Minimo sottografo ricoprente Dato un grafo connesso G = (V, E) con costi positivi sugli archi c e, un minimo sottografo ricoprente è un insieme di archi E E tale che: G = (V,

Dettagli

Informatica. Scopo della lezione

Informatica. Scopo della lezione 1 Informatica per laurea diarea non informatica LEZIONE 1 - Cos è l informatica 2 Scopo della lezione Introdurre le nozioni base della materia Definire le differenze tra hardware e software Individuare

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Preprocessamento dei Dati

Preprocessamento dei Dati Preprocessamento dei Dati Raramente i dati sperimentali sono pronti per essere utilizzati immediatamente per le fasi successive del processo di identificazione, a causa di: Offset e disturbi a bassa frequenza

Dettagli

Corso di Informatica

Corso di Informatica CdLS in Odontoiatria e Protesi Dentarie Corso di Informatica Prof. Crescenzio Gallo crescenzio.gallo@unifg.it L Informatica!2 Informatica Il termine informatica deriva dal francese Informatique Inform(ation

Dettagli

Definizione di una policy per l archivio istituzionale ISS

Definizione di una policy per l archivio istituzionale ISS CONFERENCE Institutional archives for research: experiences and projects in open access Istituto Superiore di Sanità Rome, 30/11-1/12 2006 Definizione di una policy per l archivio istituzionale ISS Paola

Dettagli

RSYNC e la sincronizzazione dei dati

RSYNC e la sincronizzazione dei dati RSYNC e la sincronizzazione dei dati Introduzione Questo breve documento intende spiegare come effettuare la sincronizzazione dei dati tra due sistemi, supponendo un sistema in produzione (master) ed uno

Dettagli

Energy Studio Manager Manuale Utente USO DEL SOFTWARE

Energy Studio Manager Manuale Utente USO DEL SOFTWARE Energy Studio Manager Manuale Utente USO DEL SOFTWARE 1 ANALYSIS.EXE IL PROGRAMMA: Una volta aperto il programma e visualizzato uno strumento il programma apparirà come nell esempio seguente: Il programma

Dettagli

Marco Giorgi. Palazzo di Giustizia di Torino 30 marzo 2012

Marco Giorgi. Palazzo di Giustizia di Torino 30 marzo 2012 Marco Giorgi Palazzo di Giustizia di Torino 30 marzo 2012 Post mortem (Dopo lo spegnimento del sistema) Si smonta il dispositivo e lo si collega ad un PC dedicato all'acquisizione Live forensics (Direttamente

Dettagli

Quando troncare uno sviluppo in serie di Taylor

Quando troncare uno sviluppo in serie di Taylor Quando troncare uno sviluppo in serie di Taylor Marco Robutti October 13, 2014 Lo sviluppo in serie di Taylor di una funzione è uno strumento matematico davvero molto utile, e viene spesso utilizzato in

Dettagli

Attività 9. La città fangosa Minimal Spanning Trees

Attività 9. La città fangosa Minimal Spanning Trees Attività 9 La città fangosa Minimal Spanning Trees Sommario la nostra società ha molti collegamenti in rete: la rete telefonica, la rete energetica, la rete stradale. Per una rete in particolare, ci sono

Dettagli

Il problema del massimo flusso. Preflow-push e augmenting path: un approccio unificante

Il problema del massimo flusso. Preflow-push e augmenting path: un approccio unificante Introduzione Il problema del massimo flusso. Preflow-push e augmenting path: un approccio unificante Il problema del massimo flusso è uno dei fondamentali problemi nell ottimizzazione su rete. Esso è presente

Dettagli

Procedura corretta per mappare con ECM Titanium

Procedura corretta per mappare con ECM Titanium Procedura corretta per mappare con ECM Titanium Introduzione: In questo documento troverete tutte le informazioni utili per mappare correttamente con il software ECM Titanium, partendo dalla lettura del

Dettagli

Basi di Dati prof. Letizia Tanca lucidi ispirati al libro Atzeni-Ceri-Paraboschi-Torlone. SQL: il DDL

Basi di Dati prof. Letizia Tanca lucidi ispirati al libro Atzeni-Ceri-Paraboschi-Torlone. SQL: il DDL Basi di Dati prof. Letizia Tanca lucidi ispirati al libro Atzeni-Ceri-Paraboschi-Torlone SQL: il DDL Parti del linguaggio SQL Definizione di basi di dati (Data Definition Language DDL) Linguaggio per modificare

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Dipartimento del Tesoro

Dipartimento del Tesoro Dipartimento del Tesoro POWER POINT AVANZATO Indice 1 PROGETTAZIONE DELL ASPETTO...3 1.2 VISUALIZZARE GLI SCHEMI...4 1.3 CONTROLLARE L ASPETTO DELLE DIAPOSITIVE CON GLI SCHEMI...5 1.4 SALVARE UN MODELLO...6

Dettagli

Integrazione numerica

Integrazione numerica Integrazione numerica Lucia Gastaldi Dipartimento di Matematica, http://dm.ing.unibs.it/gastaldi/ Lezione 6-20-26 ottobre 2009 Indice 1 Formule di quadratura semplici e composite Formule di quadratura

Dettagli

FIRESHOP.NET. Gestione Utility & Configurazioni. Rev. 2014.3.1 www.firesoft.it

FIRESHOP.NET. Gestione Utility & Configurazioni. Rev. 2014.3.1 www.firesoft.it FIRESHOP.NET Gestione Utility & Configurazioni Rev. 2014.3.1 www.firesoft.it Sommario SOMMARIO Introduzione... 4 Impostare i dati della propria azienda... 5 Aggiornare il programma... 6 Controllare l integrità

Dettagli

Equazioni non lineari

Equazioni non lineari Dipartimento di Matematica tel. 011 0907503 stefano.berrone@polito.it http://calvino.polito.it/~sberrone Laboratorio di modellazione e progettazione materiali Trovare il valore x R tale che f (x) = 0,

Dettagli

Ricapitoliamo. Ricapitoliamo

Ricapitoliamo. Ricapitoliamo Ricapitoliamo Finora ci siamo concentrati sui processi computazionali e sul ruolo che giocano le procedure nella progettazione dei programmi In particolare, abbiamo visto: Come usare dati primitivi (numeri)

Dettagli

PROBLEMA DELLA RICERCA DI UN ELEMENTO IN UN ARRAY E ALGORITMI RISOLUTIVI

PROBLEMA DELLA RICERCA DI UN ELEMENTO IN UN ARRAY E ALGORITMI RISOLUTIVI PROBLEMA DELLA RICERCA DI UN ELEMENTO IN UN ARRAY E ALGORITMI RISOLUTIVI PROBLEMA DELLA RICERCA in termini generali: Dati in input un insieme S di elementi (numeri, caratteri, stringhe, ) e un elemento

Dettagli

Guida Dell di base all'acquisto dei server

Guida Dell di base all'acquisto dei server Guida Dell di base all'acquisto dei server Per le piccole aziende che dispongono di più computer è opportuno investire in un server che aiuti a garantire la sicurezza e l'organizzazione dei dati, consentendo

Dettagli

Comandi filtro: sed. Se non si specificano azioni, sed stampa sullo standard output le linee in input, lasciandole inalterate.

Comandi filtro: sed. Se non si specificano azioni, sed stampa sullo standard output le linee in input, lasciandole inalterate. Comandi filtro: sed Il nome del comando sed sta per Stream EDitor e la sua funzione è quella di permettere di editare il testo passato da un comando ad un altro in una pipeline. Ciò è molto utile perché

Dettagli

di4g: Uno strumento di clustering per l analisi integrata di dati geologici

di4g: Uno strumento di clustering per l analisi integrata di dati geologici di4g: Uno strumento di clustering per l analisi integrata di dati geologici Alice Piva 1, Giacomo Gamberoni 1, Denis Ferraretti 1, Evelina Lamma 2 1 intelliware snc, via J.F.Kennedy 15, 44122 Ferrara,

Dettagli

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi:

Routing (instradamento) in Internet. Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Routing (instradamento) in Internet Internet globalmente consiste di Sistemi Autonomi (AS) interconnessi: Stub AS: istituzione piccola Multihomed AS: grande istituzione (nessun ( transito Transit AS: provider

Dettagli

Principal Component Analysis (PCA)

Principal Component Analysis (PCA) Principal Component Analysis (PCA) Come evidenziare l informazione contenuta nei dati S. Marsili-Libelli: Calibrazione di Modelli Dinamici pag. Perche PCA? E un semplice metodo non-parametrico per estrarre

Dettagli

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica).

AUTOLIVELLI (orizzontalità ottenuta in maniera automatica); LIVELLI DIGITALI (orizzontalità e lettura alla stadia ottenute in maniera automatica). 3.4. I LIVELLI I livelli sono strumenti a cannocchiale orizzontale, con i quali si realizza una linea di mira orizzontale. Vengono utilizzati per misurare dislivelli con la tecnica di livellazione geometrica

Dettagli

Data warehouse.stat Guida utente

Data warehouse.stat Guida utente Data warehouse.stat Guida utente Versione 3.0 Giugno 2013 1 Sommario INTRODUZIONE 3 I concetti principali 4 Organizzazione dei dati 4 Ricerca 5 Il browser 5 GUIDA UTENTE 6 Per iniziare 6 Selezione della

Dettagli

SciPy. Programmazione Orientata agli Oggetti e Scripting in Python

SciPy. Programmazione Orientata agli Oggetti e Scripting in Python SciPy Programmazione Orientata agli Oggetti e Scripting in Python SciPy: Informazioni di Base Libreria di algoritmi e strumenti matematici Fornisce: moduli per l'ottimizzazione, per l'algebra lineare,

Dettagli

Metodi e Strumenti per la Caratterizzazione e la Diagnostica di Trasmettitori Digitali RF ing. Gianfranco Miele g.miele@unicas.it

Metodi e Strumenti per la Caratterizzazione e la Diagnostica di Trasmettitori Digitali RF ing. Gianfranco Miele g.miele@unicas.it Corso di laurea magistrale in Ingegneria delle Telecomunicazioni Metodi e Strumenti per la Caratterizzazione e la Diagnostica di Trasmettitori Digitali RF ing. Gianfranco Miele g.miele@unicas.it Trasmettitore

Dettagli

LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA

LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA LA TECHNOLOGY TRANSFER PRESENTA SUZANNE ROBERTSON MASTERING THE REQUIREMENTS PROCESS COME COSTRUIRE IL SISTEMA CHE IL VOSTRO UTENTE DESIDERA ROMA 20-22 OTTOBRE 2014 RESIDENZA DI RIPETTA - VIA DI RIPETTA,

Dettagli

Esercizi Capitolo 5 - Alberi

Esercizi Capitolo 5 - Alberi Esercizi Capitolo 5 - Alberi Alberto Montresor 19 Agosto, 2014 Alcuni degli esercizi che seguono sono associati alle rispettive soluzioni. Se il vostro lettore PDF lo consente, è possibile saltare alle

Dettagli

Analisi dei requisiti e casi d uso

Analisi dei requisiti e casi d uso Analisi dei requisiti e casi d uso Indice 1 Introduzione 2 1.1 Terminologia........................... 2 2 Modello della Web Application 5 3 Struttura della web Application 6 4 Casi di utilizzo della Web

Dettagli

ARP (Address Resolution Protocol)

ARP (Address Resolution Protocol) ARP (Address Resolution Protocol) Il routing Indirizzo IP della stazione mittente conosce: - il proprio indirizzo (IP e MAC) - la netmask (cioè la subnet) - l indirizzo IP del default gateway, il router

Dettagli

Background (sfondo): Finestra: Una finestra serve a mostrare il contenuto di un disco o di una cartella -, chiamata anche directory.

Background (sfondo): Finestra: Una finestra serve a mostrare il contenuto di un disco o di una cartella -, chiamata anche directory. @ PC (Personal computer): Questa sigla identificò il primo personal IBM del 1981 a cura di R.Mangini Archiviazione: Il sistema operativo si occupa di archiviare i file. Background (sfondo): Cursore: Nei

Dettagli

Appendice I. Principali procedure ed istruzioni per la gestione di files, l'analisi statistica di tipo descrittivo e la correlazione semplice

Appendice I. Principali procedure ed istruzioni per la gestione di files, l'analisi statistica di tipo descrittivo e la correlazione semplice . Principali procedure ed istruzioni per la gestione di files, l'analisi statistica di tipo descrittivo e la correlazione semplice Ordinamento di osservazioni: PROC SORT PROC SORT DATA=fa il sort è numerico

Dettagli

Rational Unified Process Introduzione

Rational Unified Process Introduzione Rational Unified Process Introduzione G.Raiss - A.Apolloni - 4 maggio 2001 1 Cosa è E un processo di sviluppo definito da Booch, Rumbaugh, Jacobson (autori dell Unified Modeling Language). Il RUP è un

Dettagli

Minimizzazione di Reti Logiche Combinatorie Multi-livello

Minimizzazione di Reti Logiche Combinatorie Multi-livello Minimizzazione di Reti Logiche Combinatorie Multi-livello Maurizio Palesi Maurizio Palesi 1 Introduzione Obiettivo della sintesi logica: ottimizzazione delle cifre di merito area e prestazioni Prestazioni:

Dettagli

1) Le Espressioni regolari

1) Le Espressioni regolari ESPRESSIONI REGOLARI e FILTRI SED, GREP e AWK 1) Le Espressioni regolari Un'espressione regolare è un modello che descrive un insieme di stringhe. Le espressioni regolari sono costruite, in maniera analoga

Dettagli

Introduzione ad Access

Introduzione ad Access Introduzione ad Access Luca Bortolussi Dipartimento di Matematica e Informatica Università degli studi di Trieste Access E un programma di gestione di database (DBMS) Access offre: un supporto transazionale

Dettagli

The Directed Closure Process in Hybrid Social-Information Networks

The Directed Closure Process in Hybrid Social-Information Networks The Directed Closure Process in Hybrid Social-Information Networks with an Analysis of Link Formation on Twitter Dario Nardi Seminario Sistemi Complessi 15 Aprile 2014 Dario Nardi (CAS) 15/4/14 1 / 20

Dettagli

Elementi di Statistica

Elementi di Statistica Elementi di Statistica Contenuti Contenuti di Statistica nel corso di Data Base Elementi di statistica descrittiva: media, moda, mediana, indici di dispersione Introduzione alle variabili casuali e alle

Dettagli

Import Dati Release 4.0

Import Dati Release 4.0 Piattaforma Applicativa Gestionale Import Dati Release 4.0 COPYRIGHT 2000-2005 by ZUCCHETTI S.p.A. Tutti i diritti sono riservati.questa pubblicazione contiene informazioni protette da copyright. Nessuna

Dettagli

Gli eventi sono stati definiti come i possibili risultati di un esperimento. Ogni evento ha una probabilità

Gli eventi sono stati definiti come i possibili risultati di un esperimento. Ogni evento ha una probabilità Probabilità Probabilità Gli eventi sono stati definiti come i possibili risultati di un esperimento. Ogni evento ha una probabilità Se tutti gli eventi fossero ugualmente possibili, la probabilità p(e)

Dettagli

Guida alla scansione su FTP

Guida alla scansione su FTP Guida alla scansione su FTP Per ottenere informazioni di base sulla rete e sulle funzionalità di rete avanzate della macchina Brother, consultare la uu Guida dell'utente in rete. Per ottenere informazioni

Dettagli

Serduino - SERRA CON ARDUINO

Serduino - SERRA CON ARDUINO Serduino - SERRA CON ARDUINO 1 Componenti Facchini Riccardo (responsabile parte hardware) Guglielmetti Andrea (responsabile parte software) Laurenti Lorenzo (progettazione hardware) Rigolli Andrea (reparto

Dettagli

Analisi dei requisiti e casi d uso

Analisi dei requisiti e casi d uso Analisi dei requisiti e casi d uso Indice 1 Introduzione 2 1.1 Terminologia........................... 2 2 Modello del sistema 4 2.1 Requisiti hardware........................ 4 2.2 Requisiti software.........................

Dettagli

Funzioni matlab per la gestione dei file. Informatica B Prof. Morzenti

Funzioni matlab per la gestione dei file. Informatica B Prof. Morzenti Funzioni matlab per la gestione dei file Informatica B Prof. Morzenti File Contenitori di informazione permanenti Sono memorizzati su memoria di massa Possono continuare a esistere indipendentemente dalla

Dettagli

DESMATRON TEORIA DEI GRAFI

DESMATRON TEORIA DEI GRAFI DESMATRON TEORIA DEI GRAFI 0 Teoria dei Grafi Author: Desmatron Release 1.0.0 Date of Release: October 28, 2004 Author website: http://desmatron.altervista.org Book website: http://desmatron.altervista.org/teoria_dei_grafi/index.php

Dettagli

Lezione 12: La visione robotica

Lezione 12: La visione robotica Robotica Robot Industriali e di Servizio Lezione 12: La visione robotica L'acquisizione dell'immagine L acquisizione dell immagine Sensori a tubo elettronico (Image-Orthicon, Plumbicon, Vidicon, ecc.)

Dettagli

UML Component and Deployment diagram

UML Component and Deployment diagram UML Component and Deployment diagram Ing. Orazio Tomarchio Orazio.Tomarchio@diit.unict.it Dipartimento di Ingegneria Informatica e delle Telecomunicazioni Università di Catania I diagrammi UML Classificazione

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Come scaricare sul Desktop i dati necessari allo svolgimento di un esercitazione link Save it to disk OK.

Come scaricare sul Desktop i dati necessari allo svolgimento di un esercitazione link Save it to disk OK. Come scaricare sul Desktop i dati necessari allo svolgimento di un esercitazione Per svolgere correttamente alcune esercitazioni operative, è previsto che l utente utilizzi dei dati forniti attraverso

Dettagli