INTRODUZIONE OBIETTIVI DEL PROGETTO. i) controllare la diffusione del virus nelle coltivazioni piemontesi

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "INTRODUZIONE OBIETTIVI DEL PROGETTO. i) controllare la diffusione del virus nelle coltivazioni piemontesi"

Transcript

1 Prosecuzione ed ampliamento studio epidemiologico per la caratterizzazione dello stato sanitario delle colture di Mirtillo del Piemonte, con particolare attenzione alla presenza del Carlavirus Blueberry scorch virus - acronimo MIRVI Partecipante B Sottoprogetti 1, 2, 3, 5 INTRODUZIONE Blueberry scorch virus (BlScV) è una delle virosi più importanti nella coltivazione del mirtillo gigante (Vaccinium corymbosum). Appartenente al genere Carlavirus, il virus è diffuso principalmente in Nord America ed in Canada, e causa, a seconda delle cultivar, sintomi variabili, che in alcuni casi portano a necrosi, clorosi marginale delle foglie e avvizzimento dei fiori con conseguente perdita dei frutti. La malattia è stata segnalata in Europa per la prima volta nel 2004 quando, in provincia di Cuneo (Piemonte) sono stati ritrovati campioni di mirtillo con sintomi riconducibili all infezione da BlScV, confermata tramite test ELISA e successivamente con analisi molecolare della sequenza genomica (Ciuffo et al., 2005). OBIETTIVI DEL PROGETTO i) controllare la diffusione del virus nelle coltivazioni piemontesi ii) iii) iv) messa a punto di metodi di analisi mediante RT-PCR quantitativa (qrt-pcr) effettuare studi sull epidemiologia del virus, e in particolare del ruolo operato dalle specie afidiche nella trasmissione in campo. studiare dal punto di vista molecolare le popolazioni di virus presenti in Italia al fine di supportare ipotesi riguardo all epidemiologia mediante analisi filogenetica degli isolati

2 PRINCIPALI RISULTATI RAGGIUNTI 1) Conclusioni relative al mappaggio e alla sintomatologia: Situazione in Piemonte sembra essere sotto controllo con presenza segnalata solo in 5 appezzamenti e nessuna nuova segnalazione relativa agli ultimi 3 anni di monitoraggio (Tabella 1). Risulta preoccupante la presenza di nuove infezioni anche nel campo estirpato e completamente rinnovato presso Costigliole di Saluzzo fraz. Ceretto (CN): tali nuove infezioni potrebbero essere attribuite a presenza della malattia in appezzamenti confinati nei quali non e stata consentita ispezione. La rilevazione di nuove piante infette di anno in anno sembra sottolineare la possibilità di efficiente trasmissione in campo (o alternativamente di scalarità nella comparsa di infezione, dovuta a lungo periodo di incubazione asintomatica). La distribuzione del gradiente di nuove infezioni sembra indicare la presenza di un vettore biologico presente nelle colture nella nostra regione, in quanto le nuove infezioni si originano spazialmente nella prossimità di piante precedentemente infette. Nel corso di questi anni si è a lungo tentato di stabilire una relazione tra presenza di virus ed espressione sintomatologica. La complessità dell interazione rende impossibile una diagnosi visiva della virosi, tranne che per alcune cultivar particolarmente sensibili (come Berkeley e Blueray), nei periodi di post-fioritua. Saggi ELISA per rilevare la presenza di virus in parti diverse di una pianta infetta hanno rilevato una infezione uniforme, sia in branche sintomatiche che non sintomatiche. Periodo migliore per accertamento della malattia a livello sintomatico è la fine fioritura. Nel 2009, per la prima volta sono stati osservati sintomi attribuibili a BlScV all esterno della regione Piemonte, con infezione inizialmente confermata mediante saggio ELISA specifico. Il nuovo focolaio di infezioni in Trentino Alto Adige, la zona a maggiore estensione di colture di piccoli frutti, ha presentato sintomatologie non diverse da quelle piemontesi. Si tratta della prima segnalazione di presenza di BlScV su V. ashei (Figura 1),

3 probabilmente il materiale originario importato infetto, dato che i focolai di infezione presentano gradienti accentrati sempre su piante di V. ashei, presenti in tutti e tre gli appezzamenti. Anche in questo caso sembra documentata la trasmissione in pieno campo. Tabella 1: Elenco dei comuni sul cui territorio sono stati identificati mirtilleti con piante infette da BlScV Comune (Provincia) Regione Sigla Identificativa Costigliole di Saluzzo fraz. Ceretto (CN) Cartignano fraz. Chaudieres (CN) Piemonte Piemonte CS-CN CC-CN Brondello (CN) Piemonte BR-CN Venasca (CN) Piemonte VE-CN Campiglione Fenile (TO) Piemonte CF-TO Carzano (TN) Trentino Alto Adige PM-TN Villa Agnedo (TN) Trentino Alto Adige CG-TN Spera (TN) Trentino Alto Adige PS-TN 2) Conclusioni relative a messa a punto di saggi per la presenza di BlScV mediante qrt-pcr Data la necessità di effettuare numerosi saggi per verificare la presenza di BlScV nel materiale vivaistico, e dato il costo relativamente elevato del kit ELISA commerciale, si era inizialmente pensato di produrre in loco antisiero specifico. Nonostante la purificazione del virus da fiori di campi infetti sia riuscita, l antisiero prodotto non e risultato idoneo per l allestimento di kit DAS-ELISA. Come alternativa, si e pensato di mettere a punto un saggio mediante qrt-pcr. Sono state individuate due coppie di sonde e primer, uno per il ceppo piemontese, ed uno per il ceppo del Trentino (Tabella 2).

4 Tabella 2 : Reagenti sintetizzati per saggio qrt-pcr per l analisi di presenza di BlScV nei due focolai di infezione presenti in Italia Oligo Real Time-F Oligo Real Time- R Sonda Reagenti per isolati dal Piemonte 5 ATGGCTAGAAGCCTACGCTGAT- 3 5 TGCAGAGATCGTCCGCAAT- 3 6FAM- ATGCTGATCCATTGCCCGCATTTC3 - TAMRA Reagenti per isolati dal Trentino Alto Adige 5 GCTGCTGTCCAGCCTGTTG-3 5 ATTGTGCGCAATGCACTCA- 3 VIC- AGGGCTCATACGAAGGCCCACACC- 3 -TAMRA Le coppie di sonde e primer fino ad ora individuate sono specifiche per i due ceppi individuati. Il test ELISA, più generico, risulta ancora il test di riferimento per il rilevamento di questa virosi. La possibilità di utilizzare le due sonde con fluorofori diversi in un saggio multiplex per i due ceppi va adottata con cautela e necessita di ulteriore messa a punto. Risulta particolarmente interessante invece il fatto che si può adottare un metodo di preparazione dei campioni rapido (Tabella 3), che permette di analizzare un numero di campioni elevato e ottenere il risultato in circa tre ore, con costi relativamente contenuti nel caso si possieda gia l apparecchiatura per qpcr. I costi di oligonucletidi modificati con fluoro fori e dei reagenti utilizzati nel saggio si e andato notevolmente abbassando negli ultimi anni rendendo il saggio mediante qrt-pcr competitivo anche rispetto al saggio ELISA anche nel caso di analisi massale.

5 Tabella 3: Confronto tra diagnosi mediante DAS-ELISA e qrt-pcr con metodo rapido per isolati piemontesi. In giallo sono evidenziati i campioni positivi. Campione Ct ottenuto in qrt-pcr Risultato DAS-ELISA (Agdia) 1 Non determinato Negativo 2 Non determinato Negativo 3 Non determinato Negativo Positivo Positivo Positivo 7 Non Determinato Negativo 8 Non Determinato Negativo 9 26,9 Positivo Positivo 3) Conclusioni rispetto agli aspetti relativi alla trasmissione in campo mediante specie di afidi vettori. Rimane la contraddizione di fondo tra quella che sembra una lenta, ma efficace trasmissione in campo della malattia, e le elevatissime difficoltà nel riprodurre sperimentalmente la trasmissione da pianta a pianta con la specie di afide maggiormente presente nel mirtilleto nei nostri areali (Ericapiys cammelli). Per il dettaglio si veda la relazione del partner DiVaPRA (Partner C) 4) L analisi filogenetica effettuata (Figura 1) ci aiuta a fare una serie di ipotesi di tipo epidemiologico. Da una parte risulta chiaro che i focolai di infezione in Trentino non hanno come fonte di inoculo primario le infezioni presenti in Piemonte, nonostante materiale vivaistico prodotto in Piemonte sia stato acquistato negli anni scorsi. Gli isolati del focolaio trentino sono tutti quasi identici tra di loro, e quasi identici all isolato tipo presente nello stato di Washinghton e caratterizzato a metà anni 90. Il Vaccinium ashei importato nel 2002 proviene infatti dall Oregon, stato confinante, per cui sembra di poter tracciare l importazione del nuovo ceppo nel contesto dell importazione di V. ashei infetto. La distribuzione delle piante infette di V. corymbosum segue infatti un gradiente che origina da piante infette di V. ashei. Per quanto riguarda l origine dell infezione piemontese, ci sembra di poter ipotizzare che si tratti di una infezione presente negli stati orientali degli Stati Uniti, dove una certa diversità all interno dello stesso ceppo è già stata dimostrata. Tuttavia i ceppi piemontesi, che costituiscono comunque una clade omogenea e ben distinta, si differenziano dai ceppi presenti in banca dati, per cui l esatta origine non è ipotizzabile.

6

GLERA E PINOT GRIGIO: NUOVE PREOCCUPAZIONI SANITARIE?

GLERA E PINOT GRIGIO: NUOVE PREOCCUPAZIONI SANITARIE? GLERA E PINOT GRIGIO: NUOVE PREOCCUPAZIONI SANITARIE? Elisa Angelini elisa.angelini@entecra.it C.R.A. Centro di Ricerca per la Viticoltura Conegliano (TV) Foto P. Marcuzzo Foto G. Rama UN PO DI

Dettagli

Come e quando fare i test. Antonino Di Caro INMI

Come e quando fare i test. Antonino Di Caro INMI Come e quando fare i test Antonino Di Caro INMI Come e quando fare il test Antonino Di Caro, antonino.dicaro@inmi.it Maria Rosaria Capobianchi, maria.capobianchi@inmi.it Concetta Castilletti, concetta.castilletti@inmi.it

Dettagli

Risultati della Ricerca

Risultati della Ricerca Risultati della Ricerca Titolo Protocollo diagnostico per il viroide Potato spindle tuber viroid (PSTVd) agente dell'affusolamento del tubero di patata Descrizione estesa del risultato Il viroide del tubero

Dettagli

Il sistema di sorveglianza dello screening per HIV nelle donazioni di sangue in Italia Alessandro Ghirardini, Margarita Gonzalez e Pietro Panei

Il sistema di sorveglianza dello screening per HIV nelle donazioni di sangue in Italia Alessandro Ghirardini, Margarita Gonzalez e Pietro Panei VOL. 1, N. 1 GENNAIO Il sistema di sorveglianza dello screening per HIV nelle donazioni di sangue in Italia Alessandro Ghirardini, Margarita Gonzalez e Pietro Panei Introduzione Il sistema di sorveglianza

Dettagli

Dott. M. Stella Grando, Christian Cainelli, Claudia Bisognin Redazione Dott. Wolfgang Jarausch Dott. Claudio Ioriatti. Foto: Mauro Varner

Dott. M. Stella Grando, Christian Cainelli, Claudia Bisognin Redazione Dott. Wolfgang Jarausch Dott. Claudio Ioriatti. Foto: Mauro Varner S MAP Notizie Scopazzi del melo - Apple proliferation Anno 2 Numero 1 Gennaio 2007 Sommario Istituto Agrario di San Michele Centro Sperimentale Via E. Mach 1 38010 San Michele all Adige (TN) Applicazioni

Dettagli

DEL CIRCUITO INTER-LABORATORIO BLUETONGUE-RT-PCR

DEL CIRCUITO INTER-LABORATORIO BLUETONGUE-RT-PCR Istituto G. Caporale Teramo Campo Boario 6 Teramo ITALY Telefono +9-86- Fax +9-86-5 R E P O R T F I N A L E DEL CIRCUITO INTER-LABORATORIO BLUETONGUE-RT-PCR Distribuzione / . INTRODUZIONE.... CAMPIONI.....

Dettagli

Il progetto AGRO.FREE: la tutela della filiera vivaistica da agrobatterio Elisa Angelini

Il progetto AGRO.FREE: la tutela della filiera vivaistica da agrobatterio Elisa Angelini Il progetto AGRO.FREE: la tutela della filiera vivaistica da agrobatterio Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) Progetto di ricerca finanziato dalla Regione Veneto

Dettagli

METODI GENETICI NELLA IDENTIFICAZIONE DI

METODI GENETICI NELLA IDENTIFICAZIONE DI METODI GENETICI NELLA IDENTIFICAZIONE DI CIANOBATTERI Susanna Vichi, Simonetta Gemma, Emanuela Testai Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Convegno Cianobatteri

Dettagli

Servizio fitosanitario regionale

Servizio fitosanitario regionale Regione Toscana Servizio fitosanitario regionale Il laboratorio di diagnostica fitopatologica e biologia molecolare Direzione generale Competitività del sistema regionale e sviluppo delle competenze Sviluppo

Dettagli

L epatite E nei suini domestici e selvatici in Italia

L epatite E nei suini domestici e selvatici in Italia ZOONOSI EMERGENTI E RIEMERGENTI: tra vecchie conoscenze e nuove realtà Torino, 26 febbraio 2013 L epatite E nei suini domestici e selvatici in Italia Fabio Ostanello Dipartimento di Scienze Mediche Veterinarie

Dettagli

Indagine sugli ipotetici effetti collaterali dell impiego di miscele di gibberelline

Indagine sugli ipotetici effetti collaterali dell impiego di miscele di gibberelline Indagine sugli ipotetici effetti collaterali dell impiego di miscele di gibberelline Daniele Demaria 1, Giuseppe Monge 1, Alessandro Bevilacqua 1, Graziano Vittone 1, Guglielmo Costa 2 1 CReSO Consorzio

Dettagli

Avvizzimento maculato del pomodoro (Tornato Spotted Wilt Virus)

Avvizzimento maculato del pomodoro (Tornato Spotted Wilt Virus) In espansione gravi malattie da virus su piante ortensi e ornamentali Avvizzimento maculato del pomodoro (Tornato Spotted Wilt Virus) di V. Lisa Istituto di Virologia Applicata del CNR TORINO Un virus

Dettagli

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi

NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi NEBBIOLO GENOMICS: genomica strutturale-funzionale su aspetti patologici e qualitativi Il gruppo di ricerca è costituto da 2 enti pubblici ed un partner operativo: Istituto di Virologia Vegetale del Consiglio

Dettagli

Febbre del Nilo occidentale (West Nile Virus - WNV)

Febbre del Nilo occidentale (West Nile Virus - WNV) FSME (Frühsommermeningoenzephalitis) Febbre del Nilo occidentale (West Nile Virus - WNV) 95 West Nile Virus Foto: CNN Febbre del Nilo occidentale (West Nile Virus - WNV) DEFINIZIONE La febbre del Nilo

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

L innovazione tecnologica contro le malattie del campo

L innovazione tecnologica contro le malattie del campo Milano, 16 ottobre 2014 L innovazione tecnologica contro le malattie del campo Camilo GIANINAZZI, IpadLab, PTP L impatto delle fitopatie sulla sostenibilità economica Le fitopatie causano ingenti perdite

Dettagli

REGIONE LAZIO DIREZIONE REGIONALE AGRICOLTURA SERVIZIO FITOSANITARIO REGIONALE VAIOLATURA DELLE DRUPACEE O SHARKA

REGIONE LAZIO DIREZIONE REGIONALE AGRICOLTURA SERVIZIO FITOSANITARIO REGIONALE VAIOLATURA DELLE DRUPACEE O SHARKA REGIONE LAZIO DIREZIONE REGIONALE AGRICOLTURA SERVIZIO FITOSANITARIO REGIONALE VAIOLATURA DELLE DRUPACEE O SHARKA La sharka o vaiolatura delle drupacee è una grave malattia provocata da un virus, Plum

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Piano regionale dell Emilia-Romagna per la lotta alla zanzara tigre e la prevenzione della Chikungunya e della Dengue anno 2008

Piano regionale dell Emilia-Romagna per la lotta alla zanzara tigre e la prevenzione della Chikungunya e della Dengue anno 2008 Piano regionale dell Emilia-Romagna per la lotta alla zanzara tigre e la prevenzione della Chikungunya e della Dengue anno 2008 Dott.ssa Paola Angelini Servizio Sanità pubblica D.G. Sanità e Politiche

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

VIROSI DEL PEPERONE E DEL POMODORO

VIROSI DEL PEPERONE E DEL POMODORO VIROSI DEL PEPERONE E DEL POMODORO I virus che più comunemente colpiscono queste colture, e che negli ultimi anni hanno causato gravi perdite di prodotto commerciale, sono il virus del mosaico del cetriolo

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Problematiche di Laboratorio nell applicazione del Protocollo regionale

Problematiche di Laboratorio nell applicazione del Protocollo regionale Problematiche di Laboratorio nell applicazione del Protocollo regionale UOC di Microbiologia e Virologia DAI di Patologia e Diagnostica AOUI di Verona MALATTIE TRASMESSE DA VETTORI E SORVEGLIANZA DELLE

Dettagli

La gestione di un caso di morbillo

La gestione di un caso di morbillo La gestione di un caso di morbillo Eziologia del morbillo L agente causale è un paramyxovirus (virus ad RNA) Il virus è rapidamente inattivato dal calore e dalla luce L uomo è l unico ospite Patogenesi

Dettagli

e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle

Dettagli

Xylella fastidiosa (Wells et al.)

Xylella fastidiosa (Wells et al.) SERVIZIO FITOSANITARIO REGIONALE SISTEMATICA E DIFFUSIONE Xylella fastidiosa (Wells et al.) Xylella fastidiosa (XF) Welles et al. (1987) è un batterio gram-negativo non sporigeno appartenente alla famiglia

Dettagli

Piano per l organizzazione regionale della risposta alle emergenze infettive

Piano per l organizzazione regionale della risposta alle emergenze infettive ALLEGATO 1 Direzione Sanità Assessorato alla Tutela della Salute e Sanità Piano per l organizzazione regionale della risposta alle emergenze infettive INDICE INTRODUZIONE...3 REQUISITI E STRUTTURA DEL

Dettagli

IL MEDICO DI MEDICINA GENERALE E MEDICINA GENERALE L ALLARME EBOLA: CLINICA E MANAGEMENT DELLE EPIDEMIE DEL TERZO MILLENNIO NEL SETTING DELLA

IL MEDICO DI MEDICINA GENERALE E MEDICINA GENERALE L ALLARME EBOLA: CLINICA E MANAGEMENT DELLE EPIDEMIE DEL TERZO MILLENNIO NEL SETTING DELLA IL MEDICO DI MEDICINA GENERALE E L ALLARME EBOLA: CLINICA E MANAGEMENT DELLE EPIDEMIE DEL TERZO MILLENNIO NEL SETTING DELLA MEDICINA GENERALE CORSO DI FORMAZIONE A DISTANZA I CRITERI PER LA CLASSIFICAZIONE

Dettagli

SOPRALLUOGO PREVENTIVO N

SOPRALLUOGO PREVENTIVO N COMMISSIONE ISMEA ZONA NORD OVEST CAMPAGNA 2012 SOPRALLUOGO PREVENTIVO N 3 INCARICATI: Isp. DITARANTO DOMENICO Isp. GANORA PAOLO Isp. PASINI FIORENZO Isp. ROSSI ISAIA La presente relazione si riferisce

Dettagli

La conferma di laboratorio della rosolia

La conferma di laboratorio della rosolia La conferma di laboratorio della rosolia La risposta anticorpale all infezione post-natale da rosolia IgG Rash IgM Prodromi INCUBAZIONE 0 7 14 15 16 17 18 19 20 21 22 23 24 27 35 42 VIREMIA ESCREZIONE

Dettagli

SCHEDA DI NOTIFICA DI CASO DI INFEZIONE DA VIRUS DELLA ROSOLIA IN GRAVIDANZA. Primo invio Aggiornamento

SCHEDA DI NOTIFICA DI CASO DI INFEZIONE DA VIRUS DELLA ROSOLIA IN GRAVIDANZA. Primo invio Aggiornamento SCHEDA DI NOTIFICA DI CASO DI INFEZIONE DA VIRUS DELLA ROSOLIA IN GRAVIDANZA (riservato al Ministero della Salute) Codice identificativo Primo invio Aggiornamento Regione Provincia Comune ASL Sezione 1

Dettagli

S MAP Notizie SINTOMI DEGLI SCOPAZZI DEL MELO. Scopazzi del melo - Apple proliferation. Anno 1 Numero 2 Octobre 2006

S MAP Notizie SINTOMI DEGLI SCOPAZZI DEL MELO. Scopazzi del melo - Apple proliferation. Anno 1 Numero 2 Octobre 2006 S MAP Notizie Scopazzi del melo - Apple proliferation Anno 1 Numero 2 Octobre 2006 Sommario Istituto Agrario di San Michele Centro Sperimentale Via E. Mach 1 38010 San Michele all Adige (TN) SINTOMI DEGLI

Dettagli

Progetto INTERACT. Responsabile: Massimo Pilotti Collaboratori: Nicoletta Pucci, Angela Gallelli, Angela Brunetti, Stefania Loreti

Progetto INTERACT. Responsabile: Massimo Pilotti Collaboratori: Nicoletta Pucci, Angela Gallelli, Angela Brunetti, Stefania Loreti Interventi di coordinamento ed implementazione alle azioni di ricerca, lotta e difesa al cancro batterico dell Actinidia (INTERACT) Titolo della ricerca (WP) Biologia del patosistema kiwi-psa: diagnosi

Dettagli

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI Alcune malattie infettive ad eziologia virale e andamento benigno nei soggetti immunocompetenti, se sono contratte durante la gravidanza, possono rappresentare

Dettagli

Il Piano di sorveglianza nelle Marche. Relazione a cura di S.Gavaudan e A.Duranti; IZS Umbria e Marche.

Il Piano di sorveglianza nelle Marche. Relazione a cura di S.Gavaudan e A.Duranti; IZS Umbria e Marche. Piano di sorveglianza della West Nile disease Approfondimenti su un cluster di positività sierologica sui cavalli saggiati nelle attività di sorveglianza 2008; 1 semestre. Relazione a cura di S.Gavaudan

Dettagli

Piante certificate: necessità e vantaggi

Piante certificate: necessità e vantaggi Département fédéral de l'économie DFE Station de recherche Agroscope Changins-Wädenswil ACW Piante certificate: necessità e vantaggi 30 novembre 2012 Certificazione Basi legali 1. Ordinanza federale (RS

Dettagli

Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM)

Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM) II Corso Nazionale Teorico Pratico Emergenze in Infettivologia Ferrara, 30 Settembre 2009 Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM) Vittorio Sambri Laboratorio CRREM

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Organismi Geneticamente. Vademecum sugli OGM Cosa sono e quali sono le loro caratteristiche ed effetti

Organismi Geneticamente. Vademecum sugli OGM Cosa sono e quali sono le loro caratteristiche ed effetti Organismi Geneticamente Modificati Estratto da FederBio 2014 Vademecum sugli OGM Cosa sono e quali sono le loro caratteristiche ed effetti In Italia è vietata la coltivazione di OGM, anche se non ne è

Dettagli

West Nile Disease in Italia nel 2012

West Nile Disease in Italia nel 2012 19 luglio n. 3, 2012 West Nile Disease in Italia nel 2012 Introduzione Sorveglianza nelle specie avicole Situazione epidemiologica Sorveglianza entomologica Sorveglianza negli equidi Sorveglianza sulla

Dettagli

MINISTERO DELLE POLITICHE AGRICOLE, ALIMENTARI E FORESTALI. Standard tecnico ai sensi dell art. 49 comma 2 lettera c) del D.

MINISTERO DELLE POLITICHE AGRICOLE, ALIMENTARI E FORESTALI. Standard tecnico ai sensi dell art. 49 comma 2 lettera c) del D. MINISTERO DELLE POLITICHE AGRICOLE, ALIMENTARI E FORESTALI Standard tecnico ai sensi dell art. 49 comma 2 lettera c) del D.lgs 214/2005 Criteri di monitoraggio e di gestione delle infestazioni dell organismo

Dettagli

Dati di Validazione ring-test Clavibacter michiganensis subsp. michiganensis

Dati di Validazione ring-test Clavibacter michiganensis subsp. michiganensis Dati di Validazione ring-test Clavibacter michiganensis subsp. michiganensis Febbraio 2014 1 1 Metodi I metodi scelti per la validazione dei protocolli sono i seguenti: Tipo di saggio Metodi validati Componente

Dettagli

PAPILLOMA VIRUS UMANO E CARCINOMA DELLA CERVICE

PAPILLOMA VIRUS UMANO E CARCINOMA DELLA CERVICE PAPILLOMA VIRUS UMANO E CARCINOMA DELLA CERVICE Lo screening come forma di prevenzione LE INFEZIONI DA HPV (PAPILLOMA VIRUS UMANO) Cos è l HPV? L HPV è una categoria di virus molto diffusa. La trasmissione

Dettagli

L uso dei dati territoriali per la valutazione del mercato e la definizione dei target

L uso dei dati territoriali per la valutazione del mercato e la definizione dei target Banca Popolare di Vicenza L uso dei dati territoriali per la valutazione del mercato e la definizione dei target Filippo Catturi, Alfredo Pastega Roma, 14 dicembre 2005 Agenda Premessa La valutazione del

Dettagli

IL PIANO PANDEMICO REGIONALE

IL PIANO PANDEMICO REGIONALE REGIONE LIGURIA DIPARTIMENTO SALUTE E SERVIZI SOCIALI SETTORE, IGIENE E SANITA PUBBLICA IL PIANO PANDEMICO REGIONALE dr.ssa Paola Oreste - dr. Roberto Carloni - dr.ssa Ilaria Cremonesi Misure Misure adottate

Dettagli

Istituto Nazionale per le Malattie Infettive Lazzaro Spallanzani Istituto di Ricovero e Cura a Carattere Scientifico Via Portuense, 292-00149 Roma

Istituto Nazionale per le Malattie Infettive Lazzaro Spallanzani Istituto di Ricovero e Cura a Carattere Scientifico Via Portuense, 292-00149 Roma Istituto Nazionale per le Malattie Infettive Lazzaro Spallanzani Istituto di Ricovero e Cura a Carattere Scientifico Via Portuense, 292-00149 Roma PROCEDURA PER LA SORVEGLIANZA SANITARIA DEGLI OPERATORI

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Quando e come usare gli antibiotici Le infezioni da catetere venoso centrale. Elio Castagnola UOC Malattie Infettive Istituto Giannina Gaslini Genova

Quando e come usare gli antibiotici Le infezioni da catetere venoso centrale. Elio Castagnola UOC Malattie Infettive Istituto Giannina Gaslini Genova Quando e come usare gli antibiotici Le infezioni da catetere venoso centrale Elio Castagnola UOC Malattie Infettive Istituto Giannina Gaslini Genova paziente con sospetta infezione CVC-correlata: quale

Dettagli

Prot. Pisa 05.05.10. ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLE REGIONI LAZIO E TOSCANA (D.L.vo 30.06.1993 n. 270)

Prot. Pisa 05.05.10. ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLE REGIONI LAZIO E TOSCANA (D.L.vo 30.06.1993 n. 270) ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLE REGIONI LAZIO E TOSCANA (D.L.vo 30.06.1993 n. 270) SEZIONE DI PISA S.S. dell Abetone e del Brennero, 4 56123 PISA Responsabile: dott. Riccardo Forletta email:

Dettagli

Bollettino epidemiologico WND 15 gennaio 2015 n.16. West Nile Disease in Italia nel 2014

Bollettino epidemiologico WND 15 gennaio 2015 n.16. West Nile Disease in Italia nel 2014 Bollettino epidemiologico WND 5 gennaio 205 n.6 West Nile Disease in Italia nel 204 Sommario Introduzione 2 Situazione epidemiologica 3 Sorveglianza equidi 4 Sorveglianza uccelli di specie bersaglio 5

Dettagli

I MICRORGANISMI E GLI ALIMENTI

I MICRORGANISMI E GLI ALIMENTI Le applicazioni attuali delle biotecnologie NON OGM nel settore alimentare diego.mora@unimi.it www.distam.unimi.it I MICRORGANISMI E GLI ALIMENTI Quanti microrganismi ingeriamo con gli alimenti? Si ingeriscono

Dettagli

Aspetti preventivi clinici e gestionali della malattia da virus Ebola. Definizione di contatto e sua gestione Toni Francesco

Aspetti preventivi clinici e gestionali della malattia da virus Ebola. Definizione di contatto e sua gestione Toni Francesco Aspetti preventivi clinici e gestionali della malattia da virus Ebola Definizione di contatto e sua gestione Toni Francesco 15 Novembre 2014 Migranti che arrivano con gli sbarchi via mare 1- La grande

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Alcune malattie fungine dell olivo

Alcune malattie fungine dell olivo Alcune malattie fungine dell olivo Massimo Pilotti CRA- Centro di Ricerca per la Patologia Vegetale ROMA Malattia fungina nota già nel dopoguerra nelle zone di coltivazione meridionali. Segnalazioni del

Dettagli

I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE. Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino

I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE. Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino Sorveglianza delle malattie batteriche invasive Diagnosi di laboratorio

Dettagli

Verifica di diverse strategie di fertirrigazione biologica sulla CV Pink Lady

Verifica di diverse strategie di fertirrigazione biologica sulla CV Pink Lady Verifica di diverse strategie di fertirrigazione biologica sulla CV Pink Lady Pinna Massimo ( ) -Gamba Ursula ( ) -Spagnolo Sandra ( ) ( ) CRAB-Centro di Riferimento per l Agricoltura Biologica della Provincia

Dettagli

Parte I (punti 3-9): Misure sanitarie obbligatorie per il controllo della Paratubercolosi bovina

Parte I (punti 3-9): Misure sanitarie obbligatorie per il controllo della Paratubercolosi bovina LINEE GUIDA PER L ADOZIONE DI PIANI DI CONTROLLO E PER L ASSEGNAZIONE DELLA QUALIFICA SANITARIA DEGLI ALLEVAMENTI NEI CONFRONTI DELLA PARATUBERCOLOSI BOVINA 1. Definizioni Ai sensi delle presenti linee

Dettagli

CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE

CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE Padova 11 giugno 2007 Conferma di Laboratorio della Rosolia e Significato del Dosaggio degli Anticorpi Anna Piazza Giorgio Palù

Dettagli

IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino

IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino Torino 17 febbraio 2016 RISULTATI DI 11 ANNI DI ATTIVITÀ (2005-2015)

Dettagli

Streptococcus equi subsp. equi (S. equi) Adenite equina (Strangles)

Streptococcus equi subsp. equi (S. equi) Adenite equina (Strangles) Silvia Preziuso silvia.preziuso@unicam.it Facoltà di Medicina Veterinaria Università di Camerino Streptococcus Streptococcus equi subsp. equi (S. equi) Adenite equina (Strangles) Adenite equina (Strangles)

Dettagli

ALLEGATO A. Cadenza consegna: da concordare con il capotecnico del Laboratorio

ALLEGATO A. Cadenza consegna: da concordare con il capotecnico del Laboratorio ALLEGATO A Durata della fornitura: un (1) anno. Quantità: kit necessari ad analizzare circa 300/350 campioni l anno Importo a base d asta: 20.000,00 s/iva Scadenza reattivi: almeno sei mesi Cadenza consegna:

Dettagli

A.A. 2014-2015. Obiettivi formativi del CI di Metodologia epidemiologica OBIETTIVO GENERALE

A.A. 2014-2015. Obiettivi formativi del CI di Metodologia epidemiologica OBIETTIVO GENERALE A.A. 2014-2015 Obiettivi formativi del CI di Metodologia epidemiologica OBIETTIVO GENERALE Utilizzare gli strumenti epidemiologici e statistici appropriati per ridurre l'area dell'incertezza nella rilevazione

Dettagli

04/11/2014. Convegno HSF 25-26 ottobr e 2014

04/11/2014. Convegno HSF 25-26 ottobr e 2014 Virus Ebola: 15 cose da sapere Continuano ad aumentare le vittime della malattia emorragica in Africa. Come si previene? Come si cura? È sicuro viaggiare? Procedure tecniche e operative Convegno HSF 25-26

Dettagli

LE PIANTE COME BIOREATTORI

LE PIANTE COME BIOREATTORI LE PIANTE COME BIOREATTORI POSSIBILI PRODOTTI - Anticorpi - Proteine di interesse farmaceutico - Vaccini edibili - Metaboliti secondari - Polimeri biodegradabili Produzione di Anticorpi SISTEMI DI ESPRESSIONE

Dettagli

Introduzione del test HPV come test di screening primario: un analisi di Budget Impact. Guglielmo Ronco, CPO Piemonte Maria Calvia

Introduzione del test HPV come test di screening primario: un analisi di Budget Impact. Guglielmo Ronco, CPO Piemonte Maria Calvia Introduzione del test HPV come test di screening primario: un analisi di Budget Impact. Guglielmo Ronco, CPO Piemonte Maria Calvia Introduzione del test HPV: un analisi di Budget Impact. Caratteristiche

Dettagli

LA PRODUZIONE INTEGRATA IN VITICOLTURA ALLA LUCE DELL APPLICAZIONE DELLA DIRETTIVA 128CE

LA PRODUZIONE INTEGRATA IN VITICOLTURA ALLA LUCE DELL APPLICAZIONE DELLA DIRETTIVA 128CE LA PRODUZIONE INTEGRATA IN VITICOLTURA ALLA LUCE DELL APPLICAZIONE DELLA DIRETTIVA 128CE Esperienze innovative e strategie di difesa proposte nel TriVeneto. Il monitoraggio delle avversità: strumenti e

Dettagli

CAPITOLO III CONFRONTI TRA DISTRIBUZIONI

CAPITOLO III CONFRONTI TRA DISTRIBUZIONI CAPITOLO III CONFRONTI TRA DISTRIBUZIONI 3.1 CONFRONTI TRA DISTRIBUZIONI OSSERVATE E DISTRIBUZIONI TEORICHE OD ATTESE. Nella teoria statistica e nella pratica sperimentale, è frequente la necessità di

Dettagli

Fino al 1970 era possibile fare solo una diagnosi. 1970. Blumberg identifica l antigene Australia nei

Fino al 1970 era possibile fare solo una diagnosi. 1970. Blumberg identifica l antigene Australia nei STORIA DELL IDENTIFICAZIONE DEI VIRUS CHE CAUSANO EPATITE 1 Fino al 1970 era possibile fare solo una diagnosi generica di epatite, pur essendo distinti due tipi sul piano epidemiologico. 1970. Blumberg

Dettagli

RESOCONTO MONITORAGGIO 2004 SULLA CHERATOCONGIUNTIVITE DEI BOVIDI SELVATICI ALPINI IN VALLE PO E IN VALLE VARAITA

RESOCONTO MONITORAGGIO 2004 SULLA CHERATOCONGIUNTIVITE DEI BOVIDI SELVATICI ALPINI IN VALLE PO E IN VALLE VARAITA RESOCONTO MONITORAGGIO 2004 SULLA CHERATOCONGIUNTIVITE DEI BOVIDI SELVATICI ALPINI IN VALLE E IN VALLE VARAITA 1 Introduzione Nell ambito della gestione e della conservazione del patrimonio faunistico

Dettagli

Ministero della Salute

Ministero della Salute Ministero della Salute DIPARTIMENTO DELLA PREVENZIONE E DELLA COMUNICAZIONE DIREZIONE GENERALE DELLA SANITA' PUBBLICA VETERINARIA E DEGLI ALIMENTI UFFICI VIII Ordinanza del Ministro della Salute Misure

Dettagli

Le nuove tecnologie nel soccorso dei grandi eventi

Le nuove tecnologie nel soccorso dei grandi eventi Le nuove tecnologie nel soccorso dei grandi eventi _NICOLA COMODO Dipartimento di Sanità Pubblica Università degli Studi di Firenze L IL RUOLO DELLA SANITA PUBBLICA NELLE GRAVI EMERGENZE LA SORVEGLIANZA

Dettagli

EPIDEMIOLOGIA MOLECOLARE DELLE INFEZIONI NOSOCOMIALI

EPIDEMIOLOGIA MOLECOLARE DELLE INFEZIONI NOSOCOMIALI MANI PULITE E QUALITÀ NELL ASSISTENZA SANITARIA Governare il rischio infettivo. 2 a parte Pescara 28 marzo 2008 EPIDEMIOLOGIA MOLECOLARE DELLE INFEZIONI NOSOCOMIALI PRINCIPI ED APPLICAZIONI A SUPPORTO

Dettagli

sul ricorso numero di registro generale 754 del 2015, proposto da:

sul ricorso numero di registro generale 754 del 2015, proposto da: N. 00161/2015 REG.PROV.CAU. N. 00754/2015 REG.RIC. R E P U B B L I C A I T A L I A N A Il Tribunale Amministrativo Regionale per la Puglia Lecce Sezione Prima ha pronunciato la presente ORDINANZA sul ricorso

Dettagli

10 settembre 2012, n. 8

10 settembre 2012, n. 8 10 settembre 2012, n. 8 Introduzione Sorveglianza nelle specie avicole Situazione epidemiologica Sorveglianza entomologica Sorveglianza negli equidi Sorveglianza sulla mortalità negli uccelli selvatici

Dettagli

Guida pratica all identificazione delle classi di età del Cervo tramite esame dello stadio di usura dei denti permanenti differenziata per sesso e

Guida pratica all identificazione delle classi di età del Cervo tramite esame dello stadio di usura dei denti permanenti differenziata per sesso e Guida pratica all identificazione delle classi di età del Cervo tramite esame dello stadio di usura dei denti permanenti differenziata per sesso e ambiente Ambbi ieennttee aal lppi innoo Ambbi ieennttee

Dettagli

MALATTIE E TECNICHE DI CONTENIMENTO

MALATTIE E TECNICHE DI CONTENIMENTO Le prospettive del vivaismo viticolo europeo MALATTIE E TECNICHE DI CONTENIMENTO Elisa Angelini CRA VIT Centro di Ricerca per la Viticoltura Conegliano (TV) 1. Giallumi (Flavescenza dorata e Legno nero):

Dettagli

LA SICUREZZA NELLA MANUTENZIONE DEGLI IMPIANTI E DELLE APPARECCHIATURE ELETTRICHE

LA SICUREZZA NELLA MANUTENZIONE DEGLI IMPIANTI E DELLE APPARECCHIATURE ELETTRICHE LA SICUREZZA NELLA MANUTENZIONE DEGLI IMPIANTI E DELLE APPARECCHIATURE ELETTRICHE Scopo della tesi Questa tesi si propone di fornire una serie di procedure per l esecuzione IN SICUREZZA dei lavori elettrici,

Dettagli

Campo di applicazione

Campo di applicazione Paola Di Prospero Fanghella Istituto Superiore di Sanita` Stato di applicazione dei principi di BPL nei Centri di Saggio sul territorio nazionale:punti critici e difformita` XIV Congresso Nazionale GIQAR

Dettagli

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica Silvio Pascucci 1 Anamnesi Sintomi Lesioni Esami : Istologici Virologici Sierologici Diagnosi Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica 2

Dettagli

Recupero e caratterizzazione di vecchi ecotipi autoctoni di fagiolo da granella

Recupero e caratterizzazione di vecchi ecotipi autoctoni di fagiolo da granella Recupero e caratterizzazione di vecchi ecotipi autoctoni di fagiolo da granella Carmagnola 25 marzo 2011 Michele Baudino, Ezio Portis Il fagiolo da granella in Piemonte Fagiolo per produzione di granella

Dettagli

Controllo ufficiale degli OGM nel settore agroalimentare

Controllo ufficiale degli OGM nel settore agroalimentare Controllo ufficiale degli OGM nel settore agroalimentare Ugo Marchesi Istituto Zooprofilattico Sperimentale Lazio e Toscana Centro di Referenza Nazionale per la ricerca di OGM ugo.marchesi@izslt.it ORGANISMI

Dettagli

LA PARASSITOLOGIA NEL POLICLINICO UMBERTO 1, DAL

LA PARASSITOLOGIA NEL POLICLINICO UMBERTO 1, DAL PARASSITI d ITALIA Una rete al servizio del SSN Animali + Esseri umani = una sola salute ROMA 20-21 ottobre 2011 LA PARASSITOLOGIA NEL POLICLINICO UMBERTO 1, DAL 1974 AD OGGI Prof. Gabriella Cancrini P.A.

Dettagli

ANNESSO I al CONTRATTO N... "FORNITURA E MANUTENZIONE DI STRUMENTI PER LA REAL-TIME POLYMERASE CHAIN REACTION - 2 LOTTI"

ANNESSO I al CONTRATTO N... FORNITURA E MANUTENZIONE DI STRUMENTI PER LA REAL-TIME POLYMERASE CHAIN REACTION - 2 LOTTI Ref. Ares(2014)2178516-01/07/2014 COMMISSIONE EUROPEA CENTRO COMUNE DI RICERCA Istituto per la Salute e la Tutela del Consumatore Unità di Biologia Molecolare e Genomica ANNESSO I al CONTRATTO N... "FORNITURA

Dettagli

INFORMAZIONI DI BASE DELLA MALATTIA

INFORMAZIONI DI BASE DELLA MALATTIA SOMMARIO Dal 1 gennaio 2013 15 casi confermati in laboratorio di virus dell epatite A sono stati segnalati in Germania, Olanda e Polonia. Tutti i casi hanno storie di viaggi nelle provincie autonome di

Dettagli

Statistica descrittiva: prime informazioni dai dati sperimentali

Statistica descrittiva: prime informazioni dai dati sperimentali SECONDO APPUNTAMENTO CON LA SPERIMENTAZIONE IN AGRICOLTURA Statistica descrittiva: prime informazioni dai dati sperimentali La statistica descrittiva rappresenta la base di partenza per le applicazioni

Dettagli

Herpesviridae: Malattia nel cane - CaHV1

Herpesviridae: Malattia nel cane - CaHV1 Herpesviridae: Malattia nel cane - CaHV1 Eziologia CaHV1 Genoma DNA, lineare, doppia elica, simmetria icosaedrica 162 capsomeri Dimensioni 120-200 nm Colture cellule omologhe, testicolari, macrofagi replica

Dettagli

VALIDAZIONE METODI DI PROVA PROVE MICROBIOLOGICHE

VALIDAZIONE METODI DI PROVA PROVE MICROBIOLOGICHE VALIDAZIONE METODI DI PROVA PROVE MICROBIOLOGICHE 1 Il processo di validazione/qualificazione di un metodo microbiologico presuppone che i fattori critici siano adeguatamente disciplinati da indicazioni

Dettagli

Il ragionamento diagnostico TEST DIAGNOSTICO. Dott.ssa Marta Di Nicola. L accertamento della condizione patologica viene eseguito TEST DIAGNOSTICO

Il ragionamento diagnostico TEST DIAGNOSTICO. Dott.ssa Marta Di Nicola. L accertamento della condizione patologica viene eseguito TEST DIAGNOSTICO Il ragionamento diagnostico http://www.biostatistica biostatistica.unich unich.itit 2 L accertamento della condizione patologica viene eseguito All'inizio del decorso clinico, per una prima diagnosi In

Dettagli

Diffusione della malattia.

Diffusione della malattia. IL VIRUS DEL MOSAICO COMUNE DEL FRUMENTO Angelo Sarti, ASTRA Innovazione e Sviluppo U.O. Mario Neri Imola (BO) angelo.sarti@astrainnovazione.it Coception Rubies-Autonnell, Dista Area di Patologia Vegetale

Dettagli

SETTORE PROGRAMMAZIONE E GESTIONE RIFIUTI

SETTORE PROGRAMMAZIONE E GESTIONE RIFIUTI SETTORE PROGRAMMAZIONE E GESTIONE RIFIUTI anno 211 Assessorato Ambiente, risorse idriche, acque minerali e termali, difesa del suolo, attività estrattive, economia montana, protezione civile Direzione

Dettagli

Organizzazione e ottimizzazione dell attività nel laboratorio di virologia: l esempio del CMV a Torino

Organizzazione e ottimizzazione dell attività nel laboratorio di virologia: l esempio del CMV a Torino Organizzazione e ottimizzazione dell attività nel laboratorio di virologia: l esempio del CMV a Torino CRISTINA COSTA SC Microbiologia e Virologia U Azienda Ospedaliera Città della Salute e della Scienza

Dettagli

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA CLM Biotecnologie per l Alimentazione CLM in Biotecnologie Sanitarie Corso di Chimica e certificazione degli alimenti DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA VIRUS ENTERICI virus escreti tramite

Dettagli

R e g i o n e L a z i o

R e g i o n e L a z i o R e g i o n e L a z i o Titolo del programma: Innovazione tecnologica PS su mammella, cervice uterina e colon-retto Identificativo della Linea di intervento generale: 3.1 Prevenzione della popolazione

Dettagli

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale

Dettagli

Il Marketing Definizione di marketing cinque fasi

Il Marketing Definizione di marketing cinque fasi 1 2 3 Definizione di marketing: il marketing è l arte e la scienza di conquistare, fidelizzare e far crescere clienti che diano profitto. Il processo di marketing può essere sintetizzato in cinque fasi:

Dettagli

Marina Barba Centro di ricerca per la Patologia Vegetale - Roma F. Campanile, B. Giuliano, F. Miracolo, A. Pentangelo, M.

Marina Barba Centro di ricerca per la Patologia Vegetale - Roma F. Campanile, B. Giuliano, F. Miracolo, A. Pentangelo, M. Campagna 2014: Problematiche fitosanitarie del pomodoro Marina Barba Centro di ricerca per la Patologia Vegetale - Roma F. Campanile, B. Giuliano, F. Miracolo, A. Pentangelo, M. Tridentino Il 2014 è stato

Dettagli

Bluetongue: malattia e situazione epidemiologica

Bluetongue: malattia e situazione epidemiologica Bluetongue: malattia e situazione epidemiologica Stefano Marangon Istituto Zooprofilattico Sperimentale delle Venezie AGRICOLTURA. Il Ministero ha ridotto l area soggetta a restrizioni per contenere la

Dettagli

HPV & Cervico-carcinoma

HPV & Cervico-carcinoma Infezione HPV & Cervico-carcinoma Infezione HPV HPV ad alto rischio Età all infezione 80% 20% Fattori mmunologici Transitoria Infezione persistente Infezione da C. trachomatis Displasia basso grado CIN

Dettagli

L Italia delle fonti rinnovabili

L Italia delle fonti rinnovabili L Italia delle fonti rinnovabili Le fonti rinnovabili in Italia Il GSE, Gestore dei Servizi Energetici, pubblica periodicamente dati e statistiche sulle fonti rinnovabili utilizzate in Italia. L uscita

Dettagli

ABI-7700 User Bulletin #5

ABI-7700 User Bulletin #5 ABI-7700 User Bulletin #5 1. halogen tungsten lamp 2b. emission filters 3. intensifier 5. ccd detector 350,000 pixels 2a. excitation filters 4. sample plate www.biorad.com 3 Real-time qpcr - La fluorescenza

Dettagli