Il sequenziamento del DNA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il sequenziamento del DNA"

Transcript

1 Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile di praticamente qualunque tecnica di manipolazione genica Determinare la sequenza di una particolare regione di DNA può rappresentare un fine già di per sé (ad esempio se si voglia studiare una mutazione ereditaria) Ancora più importante è il fatto che le informazioni ottenute tramite il sequenziamento sono la base indispensabile per la messa in atto di qualsiasi procedura di manipolazione del DNA La conoscenza delle proprietà chimico-fisiche degli acidi nucleici ha reso possibile la messa a punto di due tecniche per la determinazione della sequenza del DNA L obiettivo principale della maggior parte dei progetti del genoma èdi determinare la sequenza del DNA dell intero genoma o quella di un numero elevato di trascritti Progetti di sequenziamento completo del genoma Microrganismi organuli >600 virus, >10 archaea, >50 batteri e diversi viroidi, plasmidi, e 24 genomi di organuli (completi) S. cerevisiae (completo) Animali Piante superiori Choenorhabditis elegans (in corso) Drosophyla melanogaster (in corso) Mus musculus (completo) Homo sapiens (completo) Arabidopsis thaliana (completo) Oryza sativa (completo) Medicago truncatula (in corso) 1

2 Le prime procedura per il sequenziamento del DNA vennero messe a punto da Maxam e Gilbert nel 1977 Basato sul trattamento con reagenti chimici capaci di degradare una molecola di DNA in corrispondenza di specifici nucelotidi Nel 1981 Sanger e collaboratori: Metodo Sanger o metodo dideossi Basato sulla sintesi enzimatica di molecole di DNA che terminano in corrispondenza di specifici nucelotidi Per entrambi i metodi la visualizzazione della sequenza avviene per elettroforesi in gel ad altissima risoluzione (si devono separare frammenti che differiscono per un singolo nucleotide) L idea che sta alla base del metodo Sanger è di produrre tutte le possibili molecole di DNA a filamento singolo, complementari a una sequenza stampo, che inizia con una base e che si estende fino a una di stanza di 1 kb in direzione 3. Reazione di polimerizzazione che si arresta specificamente dopo ogni G oppure dopo ogni A o T o C. L arresto specifico si ottiene aggiungendo alla reazione di polimerizzazione dei dideossinucleotidi trifosfati (ddntp) 2

3 In pratica si parte da una popolazione numerosa di molecole di DNA identiche ottenute per amplificazione enzimatica o batterica (E. coli) Prevede l uso di un primer complementare ad una sequenza terminale del frammento prodotto per PCR o ad una sequenza del DNA plasmidico adiacente al frammento clonato da sequenziare La reazione è catalizzata dalla DNA polimersai in direzione 5-3 a partire dall ossidrile contenuto nel primer e richiede i 4 nucleotidi (datp, dttp, dctp, dgtp) come precursori Il sequenziamento necessita anche di uno stampo di DNA e 4 differenti reazioni di sintesi in ciascuna delle quali c è un diverso ddntp Siccome la DNA polimerasi non è in grado di discriminare tra il ddntp e il corrispondente dntp ognuno dei possibili nucleotidi può essere inserito nella catena di DNA in allungamento 3

4 La separazione delle molecole in base alle loro dimensioni, ottenuta tramite elettroforesi, origina una serie di bande, ciascuna delle quali corrisponde a una classe di molecole che differisce per un nucleotide in più rispetto alla banda successiva Perché non ci sono due o più frammenti di una determinata lunghezza? Perchè il primer utilizzato è complementare soltanto alla sequenza che ci interessa (è progettato in modo da essere specifico) Direzione elettroforesi Direzione lettura A T C G 4

5 Risultato della corsa elettroforetica di un sequenziamento Evoluzione della tecnica Primers marcati con fluorocromi differenti ddatp ddctp ddgtp A AC ACG ddttp ACGT Le 4 reazioni possono correre insieme 5

6 Terminatori marcati ddatp ddctp ddgtp A AC ACG ddttp ACGT PCR Incorporazione dei terminatori marcati denaturazione appaiamento Miscela di reazione A C G T A C G T Prodotti marcati A C G T A estensione A C G T G A C G T 6

7 CCD Camera Laser Scanner Plates with acrylamide gel Elettroforesi capillare capillare Laser Camera CCD Buffer + _ 7

8 CCD (Chip Colour Detection) camera Lettura dei tracciati La lettura dei tracciati grezzi (non elaborati) viene anche detta identificazione delle basi (base-calling) è oggi effettuata tramite software che leggono automaticamente le basi, allinea le sequenze simili e fornisce una base intuitiva per la correzione di bozze (editing) 8

9 Mentre leggono i tracciati, i software assegnano punteggi di probabilità all accuratezza di identificazione di ciascuna base e le informazioni ottenute vengono usate nei passaggi successivi della procedura di allineamento errori Gli errori di sequenziamento possono essere provocati da problemi molto frequenti: Le prime 50 basi di una lettura sono indistinguibili dal rumore di fondo a causa della migrazione anomala di brevi frammenti di DNA che contengono agglomerati di coloranti 9

10 errori Inoltre i tracciati diventano progressivamente meno uniformi con l avanzare della corsa: aumentano gli effetti della diffusione molecolare e contemporaneamente diminuiscono le differenze relative di massa tra frammenti successivi Assemblaggio dei contig Lo stadio di rifinitura nel sequenziamento di un tratto di DNA più lungo di un singolo clone comprende l allineamento, il controllo e la correzione degli errori Questi passaggi sono in genere eseguiti con software di controllo delle sequenze (esempio il pacchetto Vector NTI) Le caratteristiche fondamentali sono: 1 - La capacità di visualizzare i tracciati di sequenze comparate tra di loro, di navigare tra di essi e segnalare con precisione le ambiguità (Conting express) 10

11 2 una visibilità facile e immediata del filamento complementare 3 gli strumenti per correggere manualmente la sequenza, come ad es. la possibilità di inserire o eliminare basi senza alterare in modo significativo i file dei tracciati originali 4 la capacità di individuare eventuali siti polimorfici 11

12 Il software produce, quindi, un interfaccia grafica che permette di richiamare e correggere in maniera interattiva le singole letture di contig Il compito finale di un programma di controllo delle sequenze è di aiutare a risolvere le lacune e le ambiguità 12

13 We sequenced 6 colonies for each RACE experiments We aligned the sequences by using the software VECTOR NTI The coding regions were mostly similar But..the 5 and 3 UTRs of some colonies were different This let us believe that for some genes we obtained more alleles at the same time 13

14 Also intriguing was the fact that the few differences were at the restriction sites of fragments... Mse-I Restriction site Sequenziamento del genoma Le sequenze dei cromosomi interi vengono ricostruite a partire dalle sequenze di centinaia di migliaia di frammenti di DNA, normalmente di lunghezza compresa fra 500 e 800 pb Si usano 2 strategie generali per la frammentazione e la ricostruzione: Il sequenziamento gerarchico Il sequenziamento a rosa di pallini (shotgun) Le due strategie sono reciprocamente complementari 14

15 Differenze: Nel sequenziamento gerarchico il prmo passaggio è quello di costruire un sentiero principale (tiling path) che serva ad assicurarsi che la sequenza sia ottenuta in grandi pezzi ordinati tra di loro Mentre nel metodo shotgun frammenta semplicemente il genoma in piccole unità sequenziabili e si affida ad algoritmi del computer per ricostruire l ordine dei frammenti Sequenziamento gerarchico (genoma umano) Le strategie gerarchiche conosciute anche come dall alto in basso (topdown), basate su mappe o clone per clone sono state ideate alla fine degli anni 80 quando i reagenti erano molto costosi e i computer non erano ancora abbastanza potenti per elaborare sequenze intere ottenute con lo shotgun Metodologia: frammentare il genoma in unità sempre più piccole le cui posizioni relative sono conosciute prima di iniziare il sequenziamento Vantaggi: favorisce la ricostruzione di mappe fisiche e genetiche ad alta risuluzione e permette a gruppi di lavoro di tutto il mondo di formare consorzi e lavorare insieme senza rischiare di ripetere le stesse ricerce (un gruppo = un cromosoma) 15

16 Il primo passaggio è quello di ottenere cloni del genoma umano di dimensioni comprese tra 50 e 200 kb I vettori in cui è possibile inserire tratti genomici di grandi dimensioni sono i BAC i PAC (derivati dal fago P1) Si costruiscono librerie di DNA tramite digestione parziale o frammentazione del DNA genomico tramite sonicazione In genere si desidera un certo grado di ridondanza Questo perché i cloni in teoria dovrebbero avere estremità diverse e questo dovrebbe rendere possibile selezionare una impalcatura di cloni che formino una sequenza contigua comprendente l intero cromosoma un tiling path 16

17 È possibile ricostruire un tiling path mediante una combinazione di 3 metodi: Ibridazione: è possibile identificare rapidamente in una libraria tutti i cloni che contengono una particolare sequenza, ibridando una sonda di piccole dimensioni, marcata con isotopi radioattivi o molecole fluorescenti, e contenente la sequenza, a un filtro su cui è fissata una combinazione di decine di migliaia di cloni In seguito si può usare l estremità di questi cloni come sonda per individuare i cloni adiacenti in quello che viene denominato chromosome walking 17

18 Fingerprinting: il modo meno costoso e più efficace per ricostruire l ordine dei contig di grandi cloni inseriti nei vettori è quello di confrontarli tra loro e allinearli in base ai profili di digestione con enzimi di restrizione Se si usa un enzima esacutter, questo opererà un taglio ogni 4 kb: se sono usati per tagliare un BAC di 100 kb, producono a 20 a 30 frammenti. Questi possono essere separati tramite elettroforesi e, quindi, assegnati a gruppi dimensionali, dopo una adeguata normalizzazione statistica 18

19 End-sequencing=sequenziare le estremità della raccolta di cloni BAC. Modo comune per identificare i cloni che si sovrappongono alle lacune rimanenti dopo il fingerprinting Una volta raggiunta una soglia critica di ricostruzione della sequenza, vi è una probabilità elevata che almeno un BAC si trovi all interno di una regione già ricostruita: di conseguenza l altra estremità del clone si estenderà nella lacuna o si collegherà ad un contig adiacente Il sequenziamento a una estremità è inoltre un componente importante delle tecniche usate per verificare la correttezza della ricostruzione delle sequenze. Tornando al sequenziamento gerarchico. Una volta scelto il tiling path, i singoli cloni BAC sono suddivisi in piccoli frammenti, che sono clonati a loro volta per il sequenziamento automatico La frammentazione viene fatta con ultrasuoni e questo assicura che ogni frammento abbia estremità diverse dagli altri 19

20 Sequenziamento shotgun Nel sequenziamento shotgun si usano algoritmi del computer per ricostruire la sequenza dei contig derivati da migliaia di cloni sovrapposti. I contig sono prodotti da una libreria plasmidica costruita a partire da un unico genoma intero Come nel sequenziamento gerarchico lo scopo è quello di ottenere una ridondanza di ciascun frammento del genoma da 5 a 10 volte L allineamento serve per ottenere l assemblaggio delle sequenze contigue di cloni, ma anche per migliorare l accuratezza della sequenza, tramite la produzione di una sequenza consenso Ad esempio nel genoma umano la Celera ha utilizzato 5 algoritmi con l obiettivo di riunire insieme il più possibile le parti dell unica sequenza sovrapponendo tra loro le sequenze parziali Così facendo le uniche lacune che restano sono quelle dovute a DNA ripetitivo o a sequenze non rappresentate nella libreria 20

21 Sequenziamento di interi genomi Frammento cromosomico sequenziato DNA genomico Frammentazione Assemblaggio dei frammenti sequenziati contigui (Software appositi) Clonaggio in vettori Sequenziamento 21

22 Verifica delle sequenze La veridicità di qualunque sequenza di un intero genoma deve essere valutata a tre livelli: la completezza, l accuratezza della sequenza di basi e la validità della ricostruzione. Completezza: in genere i microrganismi (così pure l uomo, il riso, arabidopsis e il topo) sono stati sequenziati per intero Possono contenere comunque lacune difficili da colmare (di circa 1 kb). Questo può essere dovuto a sequenze ripetute difficili da colmare o al fatto che il sequenziamento è stato effettuato partendo da individui diversi per cui potrebbero esserci polimorfismo dovuti a indel o a duplicazioni Accuratezza: l accuratezza è stabilita in punteggi di probabilità Validità della ricostruzione: non è facilmente determinabile: è possibile averne un idea approssimativa misurando al coerenza interna della sequenza, oppure paragonando la ricostruzione con mappe genetiche o fisiche preesisteti o fatte all uopo. 22

23 Chromosome painting con cloni BAC 12.7 Mb CEN 14.4 Mb Condizioni di Painting 1. Chromosoma 1 di Arabidopsis thaliana 2. Un totale di 183 cloni BAC del chr-1 3. BAC dal braccio superiore (12.7 MB) marcati con biotin-dutp (rosso) 4. BACs dal braccio inferiore (14.4 MB) marcati con digoxygenin-dutp (verde) FISH painting del cromosoma 4 con 131 BAC 23

24 WS (knob)? C24 (knobless) * F9H3 F4C21 24

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Tecniche per il sequenziamento degli acidi nucleici

Tecniche per il sequenziamento degli acidi nucleici Tecniche per il sequenziamento degli acidi nucleici Nel 1965 viene determinata la prima sequenza completa di un Acido Nucleico: il trna dell alanina di lievito (78 nucleotidi) 1971: prima mappa di restrizione

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

ALGORITMI PER L'ANALISI ED IL TROUBLESHOOTING DI SEGNALI DI SEQUENZIAMENTO SANGER DEL DNA

ALGORITMI PER L'ANALISI ED IL TROUBLESHOOTING DI SEGNALI DI SEQUENZIAMENTO SANGER DEL DNA UNIVERSITA DEGLI STUDI DI PADOVA FACOLTA DI INGEGNERIA CORSO DI LAUREA SPECIALISTICA IN BIOINGEGNERIA ALGORITMI PER L'ANALISI ED IL TROUBLESHOOTING DI SEGNALI DI SEQUENZIAMENTO SANGER DEL DNA ALGORITHMS

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Analisi del DNA genomico mediante Southern Blot Hybridization

Analisi del DNA genomico mediante Southern Blot Hybridization Analisi del DNA genomico mediante Southern Blot Hybridization Permette la mappatura dei siti di restrizione attorno al frammento di DNA genomico per il quale si dispone di una sonda specifica a) Il DNA

Dettagli

Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Immagine di una sequenza ben riuscita. Sequences troubleshooting

Immagine di una sequenza ben riuscita. Sequences troubleshooting Immagine di una sequenza ben riuscita. Sequences troubleshooting Sequenza fallita Reazione fallita: non presenta picchi definiti e ha un alto rumore di fondo. il primer non trova sito di annealing il DNA

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

LA GENOMICA SYSTEM BIOLOGY

LA GENOMICA SYSTEM BIOLOGY LA GENOMICA Lo scopo della genomica funzionale è quello di capire la funzione dei geni e delle altre parti del genoma. Molte altre informazioni possono arrivare dalla genomica comparata, che consiste nel

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Indice IX X Prefazione Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Capitolo 1 LA MANIPOLAZIONE GENICA, UNA TECNICA DALLE VASTE 1 APPLICAZIONI 1 Introduzione 1 Sequenziamento

Dettagli

Genotipizzazione virale

Genotipizzazione virale Genotipizzazione virale Typing Separazione basata su maggiori differenze genetiche tra i membri di una singola specie virale Subtyping Individuazione di differenze stabili all interno di un gruppo di virus

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Tecniche molecolari per la diagnosi di funghi fitopatogeni

Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche che consentono l identificazione, la diagnosi, la quantificazione di un organismo mediante l analisi degli acidi nucleici: DNA RNA Diagnosi

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Capitolo 1 Introduzione alla PCR

Capitolo 1 Introduzione alla PCR Capitolo 1 Introduzione alla PCR La tecnologia della PCR ha rivoluzionato l attività dei laboratori di ricerca e di diagnostica trovando applicazioni ed impieghi in svariati campi della medicina e della

Dettagli

Avanzamento dei sistemi di sequenziamento

Avanzamento dei sistemi di sequenziamento Avanzamento dei sistemi di sequenziamento Sistemi di sequenziamento capillare basati su: Lunghezza delle read: 800 basi Poche sequenze prodotte in una singola corsa Second Generation Sequencing (SGS):

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Leggere il Dna. Innovazione. Dal metodo Sanger al Next generation sequencing: il genoma a disposizione della ricerca scientifica.

Leggere il Dna. Innovazione. Dal metodo Sanger al Next generation sequencing: il genoma a disposizione della ricerca scientifica. Innovazione Leggere il Dna Rosario Iacono Dal metodo Sanger al Next generation sequencing: il genoma a disposizione della ricerca scientifica. Nel 1977 fu pubblicato il metodo per il sequenziamento delle

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine Università degli Studi del Piemonte Orientale A. Avogadro CORSO DI ALTA FORMAZIONE IN LEGISLAZIONE ALIMENTARE Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi

Dettagli

Genomica Servizio Sequenziamento DNA

Genomica Servizio Sequenziamento DNA Genomica Servizio Sequenziamento DNA Listino prezzi 1 maggio 2005 Value Read Codice Descrizione Prezzo / Lettura 1001-000000 Tubi 13,50 1001-000010 Tubi con etichetta codice a barre 12,00 1094-000050 Etichette

Dettagli

Un nuovo approccio: la VEQ in biologia molecolare

Un nuovo approccio: la VEQ in biologia molecolare Un nuovo approccio: la VEQ in biologia molecolare Il crescente interesse nella biologia molecolare applicata alla diagnostica è il risultato dei profondi progressi ottenuti nelle conoscenze scientifiche

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

Identificazione e quantificazione degli acidi nucleici DNA RNA

Identificazione e quantificazione degli acidi nucleici DNA RNA BIOLOGIA MOLECOLARE Identificazione e quantificazione degli acidi nucleici DNA RNA ESTRAZIONE DEGLI ACIDI NUCLEICI DNA genomico RNA totale messaggero 1) OMOGENIZZAZIONE LISI Soluzione alcalina concentrata

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica

Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e virologia medica Il laboratorio di Biologia Molecolare: introduzione alle tecniche e alla loro applicazione Il sequenziamento genico e le sue applicazioni nella diagnostica molecolare del laboratorio di microbiologia e

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

S.C.D.U. Anatomia Patologica AOU San Luigi Gonzaga Orbassano (Torino) Marcatori molecolari di sensibilità ai trattamenti farmacologici Susanna Cappia

S.C.D.U. Anatomia Patologica AOU San Luigi Gonzaga Orbassano (Torino) Marcatori molecolari di sensibilità ai trattamenti farmacologici Susanna Cappia S.C.D.U. Anatomia Patologica AOU San Luigi Gonzaga Orbassano (Torino) Marcatori molecolari di sensibilità ai trattamenti farmacologici Susanna Cappia STESSO TRATTAMENTO FARMACOLOGICO NON RESPONSIVI RESPONSIVI

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

ENZIMI DI RESTRIZIONE

ENZIMI DI RESTRIZIONE ENZIMI DI RESTRIZIONE La scoperta degli enzimi di restrizione e modificazione Intorno agli anni 50 si notò che talvolta l introduzione in E.coli di DNA esogeno, proveniente da un diverso ceppo di E.coli,

Dettagli

Caratterizzazione della comunità microbica

Caratterizzazione della comunità microbica Caratterizzazione della comunità microbica Monitoraggio biologico annuale dell impianto Dipartimento di Biologia Università di Pisa Monitoraggio biologico del reattore Monitoraggio biologico del prototipo

Dettagli

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Moria del pero (Candidatus Phytoplasma pyri) Fitoplasmi: Microrganismi

Dettagli

PROGETTO BIOFORM. Tipizzazione del locus PV92

PROGETTO BIOFORM. Tipizzazione del locus PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole celle. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto

Dettagli

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING

DALL ESTRAZIONE DEL DNA AL FINGERPRINTING DALL ESTRAZIONE DEL DNA AL FINGERPRINTING SCOPO DELL'ATTIVITÀ Ciascuno studente estrae il proprio DNA da cellule della mucosa boccale. Quindi, mediante PCR, vengono amplificati frammenti corrispondenti

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

lezione 19-20 martedi 13 aprile 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM)

lezione 19-20 martedi 13 aprile 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) lezione 19-20 martedi 13 aprile 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) AFLP Amplified restriction fragment lenght polymorphisms Ogni genoma ha un certo

Dettagli

Tecniche di biologia

Tecniche di biologia Tecniche di biologia Negli anni 70, la scoperta degli enzimi di restrizione, della trasformazione batterica e dell elettroforesi su gel di agarosio ha avviato lo sviluppo della biologia molecolare e dell

Dettagli

Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM)

Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) Lezione 7-8 Giovedì 18 Marzo 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) materiale del T-Rex system pfrt/laczeo = Flp-In target site vector for stable transfection

Dettagli

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA 1 I PROGETTI OMICI Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA Studia il contenuto in mrna di una cellula (in differenti fasi di sviluppo, in risposta a vari stimoli o a

Dettagli

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA

LA RIASSOCIAZIONE MOLECOLARE DNA/DNA LA RIASSOCIAZIONE MOLECOLARE DNA/DNA Il grado di riassociazione o ibridazione molecolare DNA/DNA rappresenta uno dei cardini su cui si basa la definizione di specie batterica. Allo scopo ricordiamo cosa

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli