Basi della diversità genetica nei microrganismi. Mutazioni. Mutazioni spontanee 07/01/2015

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Basi della diversità genetica nei microrganismi. Mutazioni. Mutazioni spontanee 07/01/2015"

Transcript

1 Basi della diversità genetica nei microrganismi Fluidità dell informazione genica: Mutazioni e trasferimento orizzontale Mutazioni Le mutazioni possono avvenire spontaneamente in seguito ad errori di incorporazione di nucleotidi nel DNA Tipi di mutazione (in base ai loro effetti): Mutazioni spontanee Frequenza estremamente bassa (<10-7 ) per presenza di sistemi di riparazione del DNA Quindi: <1 evento per replicazione di un genoma batterico medio Può essere aumentata anche di volte da mutagenesi ambientale (raggi UV, stress ossidativo) Può avvenire ad elevate frequenze a siti particolari detti hot spots 1

2 Mutazioni causate da polymerase slippage AGGTCTCGCAACGTGTTCGACA Sequenze di questo tipo non presentano insidie particolari per la DNA polimerasi AGGTCTCGAAAAAAAAAAGACA Sequenze con ripetizioni dello stesso nucleotide sono più problematiche per la DNA polimerasi batterica. Ad esempio, con frequenza elevata le 10 A verranno replicate erroneamente (es T ) causando mutazioni frameshift Le mutazioni da polymerase slippage rappresentano un meccanismo di mimetizzazione molecolare Alcune strutture caratteristiche della superficie cellulare sono altamente immunogeniche (cioè facilmente riconoscibili dagli anticorpi): mutazioni che ne bloccano l espressione rendono le cellule batteriche meno visibili al sistema immunitario dell ospite. Eterogeneità della produzione della capsula in B. fragilis 2

3 Trasferimento genico orizzontale (HGT) Una fonte principale di diversità genica all interno di una popolazione batterica è l acquisizione di elementi di DNA mobili (plasmidi, trasposoni) Queste molecole possono portare in dote informazioni genetiche vantaggiose per la cellula batterica ricevente (es. geni di resistenza agli antibiotici) Tutti questi processi sembrano avvenire con più elevata frequenza in cellule batteriche facenti parte di biofilm Elementi di DNA mobile Virus (lisogenia, profagi) Plasmidi Trasposoni e anche, in alcune circostanze, frammenti più o meno estesi di DNA genomico I PLASMIDI Molti batteri oltre al cromosoma contengono molecole di DNA più piccole (da 2,000 a ,000 pdb), dette plasmidi. Queste molecole non sono indispensabili per le funzioni fondamentali del batterio (ceppi della stessa specie possono esserne privi). I plasmidi sono generalmente molecole di DNA circolare e superavvolto, presenti in copia multipla nel batterio. I plasmidi replicano indipendentemente dal cromosoma del batterio, anche se necessitano del medesimo macchinario enzimatico del cromosoma perché avvenga la loro replicazione. I plasmidi possono trasferirsi da un ceppo batterico ad un altro (meccanismi di trasformazione e di coniugazione batterica) 3

4 La coniugazione batterica Ceppo F+ di E. coli Ceppo F- di E. coli Pilus: fattore di adesione Sistemi di secrezione di tipo IV : canali di trasferimento del DNA Geni dei plasmidi coniugativi I plasmidi coniugativi portano i geni necessari al loro trasferimento (es. pilus coniugativo) Spesso portano geni vantaggiosi per la cellula ricevente (antibiotico-resistenza, utilizzo di nuove vie metaboliche) Plasmide coniugativo R100 Resistenze Mer= Hg++ Sul= Sulfonamide Str= Streptomicina Tet= Tetraciclina Cat= Cloramfenicolo Geni per il trasferimento 4

5 Trasformazione batterica Frammenti di DNA libero possono essere riconosciuti da proteine di membrana e trasportati all interno della cellula batterica, dove possono incontrare due destini diversi: Degradazione/ Integrazione (in maniera dipendente da sequenza, condizioni ambientali, etc.) I plasmidi possono mantenere le loro caratteristiche di unità di DNA dotate di replicazione autonoma (in aggiunta alle altre possibilità) In che occasione possiamo avere DNA libero in un ambiente naturale? L esperimento di Griffith su Streptococcus pneumoniae è un semplice esperimento di trasformazione La capacità di un batterio di assumere DNA esogeno è detta competenza Concetti dell esperimento di Griffith Il ceppo virulento (Streptococcus pneumoniae di tipo S=smooth) possiede la capacità di produrre la capsula Può passare questa capacità ad un ceppo non-capsulato (tipo R=rough). Questo passaggio di informazione non richiede una partecipazione attiva da parte del ceppo S. Una componente cellulare del ceppo S è la sede di questa informazione. 5

6 Schema semplificato della trasformazione batterica I batteri devono essere in uno stato di competenza per essere trasformabili Il meccanismo di uptake del DNA è mediato da proteine specifiche (fattori di competenza) che vengono espresse in risposta a precise condizioni ambientali e fisiologiche. I trasposoni: vagabondi a livello molecolare IS GCATGGTGCCGATATAC CGTACCACGGCTATATG IS GTATATCGGCACCATGC CATATAGCCGTGGTACG Gene codificante l enzima trasposasi 6

7 Trasposoni complessi La trasposizione risulta in una migrazione dell elemento trasponibile Taglio sfasato del sito di inserzione Inserzione del trasposone Reazione di filling delle regioni di DNA a singola elica La trasposasi induce l escissione del trasposone In maniera dipendente da segnali ambientali o dalla replicazione della cellula batterica, l espressione della trasposasi può essere attivata e portare al distacco (escissione) del trasposone. La rottura a doppia elica nel cromosoma può essere risaldata dalla trasposasi stessa 7

8 Importanza dei trasposoni come fonte di diversità genetica I trasposoni possono portare geni codificanti per fattori di virulenza, resistenza ad antibiotici, vie metaboliche La loro capacità di saltare da un elemento genetico all altro (es. cromosoma>plasmide) ne permette un frequente trasferimento intercellulare e interspecie 8

07/01/2015. La trasposasi induce l escissione del trasposone. Importanza dei trasposoni come fonte di diversità genetica

07/01/2015. La trasposasi induce l escissione del trasposone. Importanza dei trasposoni come fonte di diversità genetica La trasposasi induce l escissione del trasposone In maniera dipendente da segnali ambientali o dalla replicazione della cellula batterica, l espressione della trasposasi può essere attivata e portare al

Dettagli

Importanza della genetica dei microrganismi

Importanza della genetica dei microrganismi Importanza della genetica dei microrganismi 1.I microrganismi rappresentano un mezzo essenziale per comprendere la genetica di tutti gli organismi. 2.Vengono usati per isolare e duplicare specifici geni

Dettagli

Interazioni proteina-dna

Interazioni proteina-dna Interazioni proteina-dna 1) Proteine che legano la doppia elica del DNA in maniera non sequenza-specifica: histone-like proteins (HU protein) 2) Proteine che legano strutture particolari del DNA: - single

Dettagli

Nei batteri non è presente una membrana nucleare

Nei batteri non è presente una membrana nucleare La cellula procariota (Bacteria e Archaea) Morfologia generale Composizione chimica Le strutture cellulari e le loro funzioni parte 1 L involucro Appendici esterne: Le strutture cellulari e le loro funzioni

Dettagli

C.L. in TECNICHE DI FISIOPATOLOGIA CARDIOCIRCOLATORIA E PERFUSIONE CARDIOVASCOLARE C.I. Medicina Microbiologica AA Genetica batterica

C.L. in TECNICHE DI FISIOPATOLOGIA CARDIOCIRCOLATORIA E PERFUSIONE CARDIOVASCOLARE C.I. Medicina Microbiologica AA Genetica batterica C.L. in TECNICHE DI FISIOPATOLOGIA CARDIOCIRCOLATORIA E PERFUSIONE CARDIOVASCOLARE C.I. Medicina Microbiologica AA 2011-2012 Genetica batterica Giovanni Di Bonaventura, PhD, B.Sc. Genoma batterico Il genoma

Dettagli

Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico

Materiale genetico presente nella cellula batterica. Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Genetica batterica Materiale genetico presente nella cellula batterica Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Nucleoide (morfologia) È costituito da un unica unica molecola

Dettagli

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali.

I VIRUS. Tutti i virus esistono in due stati: EXTRACELLULARE e INTRACELLULARE. Nel primo caso si parla comnemente di virioni o particelle virali. I VIRUS Un virus è definito come materiale nucleico (DNA o RNA) organizzato in una struttura di rivestimento proteico. Il materiale nucleico del virus contiene l informazione necessaria alla sua replicazione

Dettagli

MECCANISMI DI VARIABILITA GENETICA

MECCANISMI DI VARIABILITA GENETICA GENETICA BATTERICA MECCANISMI DI VARIABILITA GENETICA La biodiversità nei microrganismi, come in tutti i viventi, dipende da un buon equilibrio tra i processi di conservazione e quelli di cambiamento del

Dettagli

Genetica Settima edizione italiana condotta sulla decima edizione americana

Genetica Settima edizione italiana condotta sulla decima edizione americana A. J. Griffiths S. R. Wessler S. B. Carroll J. Doebley Genetica Settima edizione italiana condotta sulla decima edizione americana Capitolo 15: Il genoma dinamico: gli elementi trasponibili A. J. Griffiths

Dettagli

Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico

Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico Cromosoma batterico Plasmidi Elementi genetici trasponibili DNA fagico NUCLEOIDE = unico cromosoma libero nel citoplasma, dsdna, circolare superspiralizzato (lineare nei cromosomi eucariotici), mancano

Dettagli

Il TRAFERIMENTO GENICO E LA RICOMBINAZIONE GENETICA. I batteri possiedono anche materiale genetico Extra-cromosomale.

Il TRAFERIMENTO GENICO E LA RICOMBINAZIONE GENETICA. I batteri possiedono anche materiale genetico Extra-cromosomale. Il TRAFERIMENTO GENICO E LA RICOMBINAZIONE GENETICA I batteri possiedono anche materiale genetico Extra-cromosomale FAGI e PLASMIDI rappresentano elementi genetici, di piccole e grandi dimensioni, che

Dettagli

Indica lo studio dell ereditarietà e della variazione tra generazioni di organismi. geni cromosomi Batteri :1 cromosoma batterico 5000 geni.

Indica lo studio dell ereditarietà e della variazione tra generazioni di organismi. geni cromosomi Batteri :1 cromosoma batterico 5000 geni. Genetica dei batteri Indica lo studio dell ereditarietà e della variazione tra generazioni di organismi. Le unità fondamentali dell ereditarietà sono i geni. I geni sono disposti lungo filamenti di materiale

Dettagli

Genetica di virus e batteri

Genetica di virus e batteri Genetica di virus e batteri Genetica batterica Trasformazione : l uccisione di una cellula non distrugge il DNA che mantiene le sue proprietà, nel caso penetri in una nuova cellula batterica. Coniugazione

Dettagli

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico

Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico Il DNA mobile rappresenta una componente importante del genoma eucariotico e procariotico In Drosophila meta delle mutazioni sono generate da elementi genetici mobili Generalmente le componenti mobili

Dettagli

A COSA SERVE il CLONAGGIO del DNA?? COME FUNZIONA il CLONAGGIO del DNA? COME FUNZIONA il CLONAGGIO del DNA?

A COSA SERVE il CLONAGGIO del DNA?? COME FUNZIONA il CLONAGGIO del DNA? COME FUNZIONA il CLONAGGIO del DNA? A COSA SERVE il CLONAGGIO del DNA?? CREARE COPIE IDENTICHE (= CLONI) DI UN FRAMMENTO DI DNA DIFFERENZE con la PCR: è una reazione in vivo sfrutta l apparato di replicazione del DNA della cellula ospite

Dettagli

CONIUGAZIONE BATTERICA

CONIUGAZIONE BATTERICA CONIUGAZIONE BATTERICA Come si coltivano batteri in laboratorio Terreno minimo: acqua, sali inorganici, fonte di carbonio Batteri prototrofici: crescono in terreno minimo Batteri auxotrofici: Incapaci

Dettagli

I telomeri. In molti eucarioti le estremità dei cromosomi presentano delle sequenze ripetitive: i telomeri.

I telomeri. In molti eucarioti le estremità dei cromosomi presentano delle sequenze ripetitive: i telomeri. I telomeri 1 I telomeri In molti eucarioti le estremità dei cromosomi presentano delle sequenze ripetitive: i telomeri. A ogni duplicazione la cellula perde una porzione del DNA telomerico, fino a quando

Dettagli

Natura delle mutazioni GASP. GASP: Growth Advantage in Stationary Phase. Competizione all interno di popolazioni miste: il futuro è dei vecchi

Natura delle mutazioni GASP. GASP: Growth Advantage in Stationary Phase. Competizione all interno di popolazioni miste: il futuro è dei vecchi Dinamiche di popolazioni nella fase stazionaria: il fenomeno GASP Competizione all interno di popolazioni miste: il futuro è dei vecchi Colture fresche (A), non adattate A B Domanda iniziale: La fase di

Dettagli

Il genoma dei batteri

Il genoma dei batteri Il genoma dei batteri Trovare mutazioni nei geni batterici Mutazioni che colpiscono la morfologia della colonia, Mutazioni che conferiscono resistenza agli agenti battericidi Mutazioni che creano auxotrofi

Dettagli

Caratteristiche generali

Caratteristiche generali La trasposizione Caratteristiche generali Gli elementi genetici trasponibili sono frammenti di DNA che hanno la capacità di spostarsi all interno di una singola cellula da una posizione all altra del cromosoma

Dettagli

4-Quali sono i fattori di virulenza

4-Quali sono i fattori di virulenza 1- Caratteristiche della cellula batterica Sruttura componenti essenziali ( nucleo citoplasma, membrana citoplasmatica parete cellulare ) e facoltativi ( pili,fagelli,capsula e spora) Caratteristiche dei

Dettagli

GENETICA DEI BATTERI E DEI VIRUS

GENETICA DEI BATTERI E DEI VIRUS GENETICA DEI BATTERI E DEI VIRUS Negli eucarioti la ricombinazione genica è un processo strettamente associato alla riproduzione e si verifica tra cromosomi omologhi durante la meiosi. Nei procarioti,

Dettagli

Percorso formativo di BIOLOGIA. I Biennio (Lo studio scientifico della vita Dal macroscopico al microscopico)

Percorso formativo di BIOLOGIA. I Biennio (Lo studio scientifico della vita Dal macroscopico al microscopico) Percorso formativo di BIOLOGIA I Biennio (Lo studio scientifico della vita Dal macroscopico al microscopico) Principi di classificazione e filogenesi degli organismi viventi e basi dell evoluzione Le principali

Dettagli

Controllo della crescita con antibiotici: batteriostatici

Controllo della crescita con antibiotici: batteriostatici La curva di crescita in terreno liquido: un modello di fisiologia batterica Controllo della crescita con antibiotici: batteriostatici Momento di aggiunta dell antibiotico Densità ottica Arresto della crescita

Dettagli

Escherichia coli. Applicazioni biotecnologie con microrganismi procarioti. Una delle speci batteriche più biotecnologica è senza dubbio

Escherichia coli. Applicazioni biotecnologie con microrganismi procarioti. Una delle speci batteriche più biotecnologica è senza dubbio Applicazioni biotecnologie con microrganismi procarioti Escherichia coli, Bacillus subtilis con altri batteri appartenenti ai generi Pseudomonas, Rhizobium, Lactobacillus possono essere usati: - piani

Dettagli

Mutazione e riparazione del DNA, ed elementi trasponibili

Mutazione e riparazione del DNA, ed elementi trasponibili Mutazione e riparazione del DNA, ed elementi trasponibili Prof. Renato Fani Lab. di Evoluzione Microbica e Molecolare Dip.to di Biologia Evoluzionistica,Via Romana 17-19, Università di Firenze, 50125 Firenze

Dettagli

LA RESISTENZA AGLI ANTIBIOTICI

LA RESISTENZA AGLI ANTIBIOTICI LA RESISTENZA AGLI ANTIBIOTICI E un fenomeno perfettamente naturale che un organismo vivente sviluppi metodi di sopravvivenza all interno di un ambiente ostile xoomer.virgilio.it/.../mecca nismi.jpg Antibiotico-resistenza

Dettagli

Farmaci antibiotici e chemioterapici

Farmaci antibiotici e chemioterapici Farmaci antibiotici e chemioterapici Definizioni e caratteristiche Antibiotici: sostanze prodotte da varie specie di microrganismi (batteri o funghi) che sopprimono la crescita di altri microrganismi e

Dettagli

LE CELLULE HFR Nella coniugazione fra cellule Hfr e F -, il fattore F integrato nel cromosoma subisce un interruzione e l estremità del filamento inte

LE CELLULE HFR Nella coniugazione fra cellule Hfr e F -, il fattore F integrato nel cromosoma subisce un interruzione e l estremità del filamento inte LE CELLULE HFR La coniugazione trasferisce il materiale genetico contenuto del plasmide F dalla cellula F + alla F -, ma questo non spiega il trasferimento di geni cromosomici che abbiamo visto precedentemente.

Dettagli

La genetica batterica: Trasformazone, Coniugazione e Trasduzione

La genetica batterica: Trasformazone, Coniugazione e Trasduzione La genetica batterica: Trasformazone, Coniugazione e Trasduzione Prof. Renato Fani Lab. di Evoluzione Microbica e Molecolare Dip.to di Biologia Evoluzionistica,Via Romana 17-19, Università di Firenze,

Dettagli

1 Gli enzimi. 1.1 Definizione e caratteristiche Il sito attivo Classificazione e nomenclatura Meccanismo d azione 7

1 Gli enzimi. 1.1 Definizione e caratteristiche Il sito attivo Classificazione e nomenclatura Meccanismo d azione 7 IV Biochimicamente 0 L evoluzione dei viventi 1 Gli enzimi Perché è importante studiare la biochimica? 0 1 0.1 L organizzazione gerarchica 0 2 0.2 L origine dell Universo 0 2 La fusione nucleare 0 3 0.3

Dettagli

Autonoma valutazione delle informazioni su argomenti e problemi biologici fornite dai mezzi di comunicazione di massa

Autonoma valutazione delle informazioni su argomenti e problemi biologici fornite dai mezzi di comunicazione di massa Anno scolastico 2017-2018 Classe 5 sez I Docente Ferrari Biancamaria Disciplina SCIENZE NATURALI- BIOLOGIA MOLECOLARE FINALITA DISCIPLINARI Fornire gli strumenti per conoscere le strutture e le funzioni

Dettagli

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A

ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE CLASSE 3^A LICEO SCIENTIFICO STATALE «GALILEO GALILEI» Via Ceresina 17 - Tel. 049 8974487 Fax 049 8975750 35030 SELVAZZANO DENTRO (PD) ANNO SCOLASTICO 2013/2014 PROF. FAUSTO PITROLINO PROGRAMMA SVOLTO DI SCIENZE

Dettagli

unità 4. Dalla genetica alle biotecnologie

unità 4. Dalla genetica alle biotecnologie I virus I virus non vengono considerati esseri viventi. Ciò è dovuto al fatto che queste particelle microscopiche non sono in grado di svolgere alcuna funzione metabolica e non possono riprodursi autonomamente.

Dettagli

LE MUTAZIONI. MUTAZIONE: MODIFICAZIONE DEL MESSAGGIO GENETICO, cambiamento raro, casuale, permanente ed EREDITABILE del DNA RIMESCOLAMENTO!!

LE MUTAZIONI. MUTAZIONE: MODIFICAZIONE DEL MESSAGGIO GENETICO, cambiamento raro, casuale, permanente ed EREDITABILE del DNA RIMESCOLAMENTO!! LE MUTAZIONI MUTAZIONE: MODIFICAZIONE DEL MESSAGGIO GENETICO, cambiamento raro, casuale, permanente ed EREDITABILE del DNA RIMESCOLAMENTO!! NUOVI GENOTIPI LE MUTAZIONI POLIMORFISMO: un cambiamento presente

Dettagli

Test con punteggio 0.5

Test con punteggio 0.5 Cognome e Nome Associazione Onlus Lesina (FG) Venerdi 12 Ottobre 2007 Test con punteggio 0.5 1. Un gene è 6. La coppia di cromosomi XY potrebbe essere quella di chi? una proteina il piano di costruzione

Dettagli

Corso di Genetica aa 17/18 (Prof. Anna Poma) per LT Scienze Biologiche e Biotecnologie

Corso di Genetica aa 17/18 (Prof. Anna Poma) per LT Scienze Biologiche e Biotecnologie Corso di Genetica aa 17/18 (Prof. Anna Poma) per LT Scienze Biologiche e Biotecnologie ARGOMENTI scritto I e II parziale 17/18 e scritto totale Riproduzione cellulare e cromosomi Cellula eucariotica e

Dettagli

LA REPLICAZIONE DEL DNA

LA REPLICAZIONE DEL DNA www.fisiokinesiterapia.biz LA REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA Durante il processo di replicazione la doppia elica del DNA si srotola e ciascuno dei due filamenti funziona da stampo per un nuovo

Dettagli

METABOLISMO E CRESCITA MICROBICA

METABOLISMO E CRESCITA MICROBICA METABOLISMO E CRESCITA MICROBICA CRESCITA MICROBICA Riproduzione dei Microrganismi a- Scissione b-crescita apicale c- Gemmazione Scissione Batteri Alghe alcuni Lieviti CRESCITA MICROBICA Crescita apicale

Dettagli

Microbiologia. virus procarioti eucarioti (funghi, alghe)

Microbiologia. virus procarioti eucarioti (funghi, alghe) Microbiologia virus procarioti eucarioti (funghi, alghe) 10 9 anni fa eubatteri archebatteri Caratteristiche dei batteri Piccole dimensioni Mobili Semplici dal punto di vista strutturale Un unico cromosoma

Dettagli

Biochimica: le biomolecole. 1 I carboidrati B2. Per saperne di più. Anomeria e mutarotazione. Per saperne di più. I diastereoisomeri

Biochimica: le biomolecole. 1 I carboidrati B2. Per saperne di più. Anomeria e mutarotazione. Per saperne di più. I diastereoisomeri Indice B1 B2 le biomolecole l energia e gli enzimi 1 I carboidrati B2 Anomeria e mutarotazione I diastereoisomeri Green Chemistry Da rifiuti a risorse: le biomasse B6 B11 B12 2 I lipidi B13 Le vitamine

Dettagli

ANTIBIOTICORESISTENZA E' la capacità dei batteri di essere o divenire resistenti nei confronti dell'azione degli antibiotici E' una proprietà genetica

ANTIBIOTICORESISTENZA E' la capacità dei batteri di essere o divenire resistenti nei confronti dell'azione degli antibiotici E' una proprietà genetica ANTIBIOTICORESISTENZA L antibioticoresistenza è un fenomeno biologico naturale che si verifica per l emergenza e la propagazione di fattori di resistenza batterica agli antibiotici ed è innescata ed amplificata

Dettagli

Anche i batteri fanno. (cioe si scambiano geni!)

Anche i batteri fanno. (cioe si scambiano geni!) LA GENETICA DEI MICRORGANISMI ovvero Anche i batteri fanno sesso (cioe si scambiano geni!) La coltivazione dei batteri Una colonia è formata da circa 10 7 cellule. Clone = discendenti di un unica cellula.

Dettagli

Vettori derivati dal fago λ: batteriofagi filamentosi M13

Vettori derivati dal fago λ: batteriofagi filamentosi M13 Vettori derivati dal fago λ: batteriofagi filamentosi M13 A. Phage display: esibizione della proteina clonata in M13 ed esposta sulla superficie del batteriofago (facile screening dei ricombinanti) mediante

Dettagli

GLI ANTIBATTERICI I BATTERI

GLI ANTIBATTERICI I BATTERI I BATTERI I batteri sono degli microrganismi unicellulari. Essi possiedono una parete cellulare, che è una struttura caratteristica della cellula procariotica, al di sotto della parete è presente la membrana

Dettagli

Individuazione ed analisi delle mutazioni

Individuazione ed analisi delle mutazioni Individuazione ed analisi delle mutazioni La mutazione è un cambiamento ereditabile del materiale genetico Somatica Ereditata solo dai discendenti di una cellula Germinale trasmessa attraverso le generazioni

Dettagli

07/01/2015 Pseudomonas putida l m 0,1 Ampicillina f u Acqua Streptomicina tempo duplicazione: 0, Tempo Micrococcus luteus

07/01/2015 Pseudomonas putida l m 0,1 Ampicillina f u Acqua Streptomicina tempo duplicazione: 0, Tempo Micrococcus luteus ufc/ml 07/01/2015 1 Pseudomonas putida 0,1 Ampicillina Acqua Streptomicina tempo duplicazione: 42 minuti 0,01 0 30 60 90 120 150 180 Tempo Micrococcus luteus 1,000 0,100 Series1 Series2 Series3 0,010 0

Dettagli

Strumenti della Genetica Molecolare Umana (2) Capitoli 6-7-8

Strumenti della Genetica Molecolare Umana (2) Capitoli 6-7-8 Strumenti della Genetica Molecolare Umana (2) Capitoli 6-7-8 Nota pero che Il vettore si potrebbe richiudere su se stesso per questo motivo si puo minimizzare la ricircolarizzazione: 1. trattando il vettore

Dettagli

Tecnologia del DNA ricombinante

Tecnologia del DNA ricombinante Tecnologia del DNA ricombinante Scoperte rivoluzionarie che hanno permesso lo studio del genoma e della funzione dei singoli geni Implicazioni enormi nel progresso della medicina: comprensione malattie

Dettagli

DNA batterico. Nei batteri le mutazioni possono essere indotte e/o spontanee

DNA batterico. Nei batteri le mutazioni possono essere indotte e/o spontanee DNA batterico Il DNA batterico si replica in modo semiconservativo, utilizzando entrambi i filamenti come stampo e richiede l intervento di numerosi enzimi. Nei batteri le mutazioni possono essere indotte

Dettagli

Genetica batterica. Giovanni Di Bonaventura, PhD, B.Sc.

Genetica batterica. Giovanni Di Bonaventura, PhD, B.Sc. Genetica batterica Giovanni Di Bonaventura, PhD, B.Sc. Centro Scienze dell Invecchiamento (Ce.S.I.) Fondazione Università G. d Annunzio 0871 54 15 19 (lab) 333 169 65 59 (cell) gdibonaventura@unich.it

Dettagli

La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici

Dettagli

Dato un individuo eterozigote AaBbCc per tre loci come possono distribuirsi i gameti?

Dato un individuo eterozigote AaBbCc per tre loci come possono distribuirsi i gameti? Dato un individuo eterozigote AaBbCc per tre loci come possono distribuirsi i gameti? tre geni indipendenti due geni associati ed uno indipendente ABC 1/4 abc 1/4 ABc 1/4 abc 1/4 Abc 1/4 abc 1/4 AbC 1/4

Dettagli

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL.

INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. FLAGELLI PILI RIBOSOMI STRUTTURE CELLULARI INCLUSIONI MEMBRANA, CAPSULA, PARETE CELL. ANALISI ELEMENTARE Elemento % peso Funzione Origine secco Carbonio 50 Costituente principale del materiale cellulare Composti organici; CO2 Ossigeno 20 Costituente dei composti organici e dell'acqua cellulare

Dettagli

ULSS 2 INCONTRA I mercoledì della Salute

ULSS 2 INCONTRA I mercoledì della Salute ULSS 2 INCONTRA I mercoledì della Salute Antibiotici: servono sempre? Relatore: Dr. Vincenzo Catena 05 febbraio 2014 sala Piccolotto Struttura Complessa di Anestesia e Rianimazione U.L.S.S.2 Feltre Direttore

Dettagli

Contenuto di DNA aploide in alcune specie

Contenuto di DNA aploide in alcune specie Contenuto di DNA aploide in alcune specie 1-10 2 kb 10 3 kb 10 4 kb 10 5-10 8 kb Dimensioni del genoma Paradosso del valore C Non c è una correlazione tra la quantità di DNA e la complessità di un organismo

Dettagli

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita

David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis. Biologia La scienza della vita 1 David Sadava, H. Craig Heller, Gordon H. Orians, William K. Purves, David M. Hillis Biologia La scienza della vita 2 B - L ereditarietà e l evoluzione La regolazione genica negli eucarioti 3 I genomi

Dettagli

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010 Le biotecnologie 1 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi viventi o da loro derivati.

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie Lezione 1 Il clonaggio 2 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi

Dettagli

Mendel aveva scoperto le regole fondamentali dell ereditarietà nel 1866, ma non aveva la minima idea riguardo la natura fisica dell informazione

Mendel aveva scoperto le regole fondamentali dell ereditarietà nel 1866, ma non aveva la minima idea riguardo la natura fisica dell informazione Mendel aveva scoperto le regole fondamentali dell ereditarietà nel 1866, ma non aveva la minima idea riguardo la natura fisica dell informazione ereditaria. Nei primi anni del Novecento i biologi giunsero

Dettagli

Mendel aveva scoperto le regole fondamentali dell ereditarietà nel 1866, ma non aveva la minima idea riguardo la natura fisica dell informazione

Mendel aveva scoperto le regole fondamentali dell ereditarietà nel 1866, ma non aveva la minima idea riguardo la natura fisica dell informazione Mendel aveva scoperto le regole fondamentali dell ereditarietà nel 1866, ma non aveva la minima idea riguardo la natura fisica dell informazione ereditaria. Nei primi anni del Novecento i biologi giunsero

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI

LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI LA TECNOLOGIA DEL DNA RICOMBINANTE RICHIEDE L USO DI ENZIMI SPECIFICI La tecnologia del DNA ricombinante è molto complessa dal punto di vista operativo, ma dal punto di vista concettuale si basa su criteri

Dettagli

un introduzione dei viventi 1 I composti organici C2 2 Gli idrocarburi saturi C6 Green Chemistry Biodiesel: un combustibile da fonti rinnovabili

un introduzione dei viventi 1 I composti organici C2 2 Gli idrocarburi saturi C6 Green Chemistry Biodiesel: un combustibile da fonti rinnovabili Indice C1 B1 Chimica Lo studio organica: un introduzione dei viventi le biomolecole 1 I composti organici C2 2 Gli idrocarburi saturi C6 Green Chemistry Biodiesel: un combustibile da fonti rinnovabili

Dettagli

Parte I I principi fondamentali della clonazione dei geni e dell analisi del DNA

Parte I I principi fondamentali della clonazione dei geni e dell analisi del DNA 6746 BROWN Iniziali I-XIV 13-04-2007 11:57 Pagina VII Indice Parte I I principi fondamentali della clonazione dei geni e dell analisi del DNA Capitolo 1 L importanza della clonazione dei geni e dell analisi

Dettagli

Produzione di Proteine Ricombinanti. pet-22b(+)

Produzione di Proteine Ricombinanti. pet-22b(+) Produzione di Proteine Ricombinanti pet-22b(+) 1 2 3 Number (and percentage values siding the bars) of recombinant proteins approved as biopharmaceuticals in different production systems, up to January

Dettagli

HP sull origine dei virus

HP sull origine dei virus HP sull origine dei virus forme di vita degenerate che hanno perso molte delle loro funzioni essenziali Porzioni di genoma cellulare che si sono affrancate Evoluzione parallela ed indipendente rispetto

Dettagli

Genetica batterica (Mappe genetiche in batteri)

Genetica batterica (Mappe genetiche in batteri) Genetica batterica (Mappe genetiche in batteri) Trasformazione - Trasferimento unidirezionale di DNA extracellulare all interno delle cellule - Osservata per la prima volta nel 1928 da Griffith e 1944

Dettagli

Corso di laurea magistrale in. Scienze per la diagnostica e conservazione dei beni culturali

Corso di laurea magistrale in. Scienze per la diagnostica e conservazione dei beni culturali Corso di laurea magistrale in Scienze per la diagnostica e conservazione dei beni culturali Insegnamento di Microbiologia applicata ai beni culturali RIEPILOGO DEI CONCETTI BASE DELLA MICROBIOLOGIA GENERALE

Dettagli

Elementi di Ingegneria Genetica Piante Geneticamente Modificate

Elementi di Ingegneria Genetica Piante Geneticamente Modificate Elementi di Ingegneria Genetica Piante Geneticamente Modificate Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene LA DEFINIZIONE LEGALE Direttiva

Dettagli

UNIVERSITA DEGLI STUDI DI PALERMO FACOLTA DI MEDICINA E CHIRURGIA

UNIVERSITA DEGLI STUDI DI PALERMO FACOLTA DI MEDICINA E CHIRURGIA UNIVERSITA DEGLI STUDI DI PALERMO FACOLTA DI MEDICINA E CHIRURGIA CDL IN TECNICHE DI LABORATORIO BIOMEDICO (abilitante all esercizio della professione di Tecnico di Laboratorio Biomedico) Presidente: Prof.

Dettagli

Trasformazione : l uccisione di una cellula non distrugge il DNA che mantiene le sue proprietà, nel caso penetri in una nuova cellula batterica.

Trasformazione : l uccisione di una cellula non distrugge il DNA che mantiene le sue proprietà, nel caso penetri in una nuova cellula batterica. LABORATORIO DI MICROBIOLOGIA DFC Genetica batterica Trasformazione : l uccisione di una cellula non distrugge il DNA che mantiene le sue proprietà, nel caso penetri in una nuova cellula batterica. Coniugazione

Dettagli

Lezione 10. Dimensioni del genoma e complessità degli organismi

Lezione 10. Dimensioni del genoma e complessità degli organismi Lezione 10 Dimensioni del genoma e complessità degli organismi Lynch: The origins of Genome Architecture Capitolo 2 I 3 paradossi del genoma K C N Paradosso del valore K: la complessità non correla con

Dettagli

Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri

Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri Progressi nel settore della cancerogenesi I passi più importanti sono ingranditi nei riquadri Agli inizi del Novecento studi condotti su modelli animali hanno indicato che alcune sostanze sono in grado

Dettagli

DNA: il materiale genetico

DNA: il materiale genetico DNA: il materiale genetico Corso di Genetica per Scienze e Tecnologie per l Ambiente e la Natura Alberto Pallavicini La ricerca del materiale genetico Il materiale responsabile dei caratteri ereditari

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

Lezione 10. Dimensioni del genoma e complessità degli organismi

Lezione 10. Dimensioni del genoma e complessità degli organismi Lezione 10 Dimensioni del genoma e complessità degli organismi Lynch: The origins of Genome Architecture Capitolo 2 Graur lecture 43c: Genome size I 3 paradossi del genoma K C N Paradosso del valore K:

Dettagli

La trasformazione. Figure per gentile concessione di Zanichelli Editore

La trasformazione. Figure per gentile concessione di Zanichelli Editore La trasformazione Gli esperimenti di Griffith dimostrarono che ci può essere un trasferimento di caratteristiche genetiche non legato alla riproduzione. I batteri del ceppo R avevano acquisito caratteristiche

Dettagli

MIGLIORAMENTO GENETICO TRADIZIONALE

MIGLIORAMENTO GENETICO TRADIZIONALE MIGLIORAMENTO GENETICO TRADIZIONALE OGM ORGANISMI GENETICAMENTE MODIFICATI PGM PIANTA GENETICAMENTE MODIFICATA PIANTA TRANSGENICA UNA PIANTA NELLA QUALE, MEDIANTE INGEGNERIA GENETICA, SONO STATE INTRODOTTE

Dettagli

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina DNA e CROMOSOMI Come il DNA si replica, si ripara e ricombina Nel 1928 venne dimostrato che il DNA è il materiale genetico dei batteri (Griffith) Alcune proprietà dei batteri S morti possono trasformare

Dettagli

Biotecnologie. Screening delle genoteche con le sonde geniche

Biotecnologie. Screening delle genoteche con le sonde geniche Biotecnologie Screening delle genoteche con le sonde geniche Giancarlo Dessì http://www.giand.it Licenza Creative Commons BY-NC-SA (BY: attribuzione, NC: uso non commerciale, SA: condividi allo stesso

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo REPLICAZIONE E COMPOSIZIONE DEL DNA CORSO DI GENETICA REPLICAZIONE E COMPOSIZIONE DEL DNA La struttura del DNA La replicazione del DNA Iduefilamenti della doppia elica parentale si srotolano generando ciascuno un filamento figlio secondo

Dettagli

Malattie genetiche. Dott. Giovanni LONGO

Malattie genetiche. Dott. Giovanni LONGO Malattie genetiche Dott. Giovanni LONGO Il ruolo della ricerca scientifica Esistono una quantità quasi infinita di rimedi o cure contro un'altrettanta quantità di malattie. La ricerca scientifica si occupa

Dettagli

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67

Basi biologiche delle malattie Genetica delle neoplasie. Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Basi biologiche delle malattie Genetica delle neoplasie Anno accademico 2016/2017 I anno, II trimestre Laurea Magistrale LM-67 Samantha Messina 2017 GENETICA DELLE NEOPLASIE Ciclo - alterazione dei meccanismi

Dettagli

Il processo di regolazione dell espressione genica è critico per tutti gli organismi.

Il processo di regolazione dell espressione genica è critico per tutti gli organismi. Il processo di regolazione dell espressione genica è critico per tutti gli organismi. Le abitudini alimentari di ciascun individuo determinano completamente i nutrienti a disposizione di E. coli: esso

Dettagli

La GENETICA DELLE POPOLAZIONI. studia con modelli matematici, a livello di gruppi di individui, variabilità genetica

La GENETICA DELLE POPOLAZIONI. studia con modelli matematici, a livello di gruppi di individui, variabilità genetica La GENETICA DELLE POPOLAZIONI studia con modelli matematici, a livello di gruppi di individui, la variabilità genetica che è l unico tipo di variabilità rilevante per l evoluzione La variabilità genetica

Dettagli

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati

CORSO BIOLOGIA MOLECOLARE I. Testi consigliati CORSO BIOLOGIA MOLECOLARE I Dott. Massimo Pancione e.mail massimo.pancione@unisannio.it Obiettivo del corso: Comprendere i meccanismi molecolari dei processi biologici fondamentali, descrivere le tecniche

Dettagli

I gameti prodotti saranno:

I gameti prodotti saranno: GENI CONCATENATI Con i principi di Mendel e con lo studio della dinamica della meiosi due geni si trasmettono ciascuno in modo indipendente rispetto all altro se sono localizzati su paia di cromosomi diversi

Dettagli

Corso di Genetica -Lezione 8- Cenci

Corso di Genetica -Lezione 8- Cenci Corso di Genetica -Lezione 8- Cenci Mappatura mediante ricombinazione corpo nero; fenotipo dominante N(ero)/N(ero) Su quale cromosoma? Y; N/N X w/w; Cy/Sco; Sb/Ser Tutti maschi occhio bianco sono normali

Dettagli

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina

DNA e CROMOSOMI. Come il DNA si replica, si ripara e ricombina DNA e CROMOSOMI Come il DNA si replica, si ripara e ricombina Nel 1928 venne dimostrato che il DNA è il materiale genetico dei batteri (Griffith) Alcune proprietà dei batteri S morti possono trasformare

Dettagli

DNA ACIDI NUCLEICI. Le coppie di basi sono distanti 0.34 nm. Un giro completo (360 ) della doppia elica richiede 3.4 nm, cioè 10 coppie di basi.

DNA ACIDI NUCLEICI. Le coppie di basi sono distanti 0.34 nm. Un giro completo (360 ) della doppia elica richiede 3.4 nm, cioè 10 coppie di basi. DNA ACIDI NUCLEICI La scoperta della struttura del DNA avvenne alla Cambridge University nel 1953, da parte dell americano James D. Watson, ed un inglese, Francis H. Crick. Il loro modello per la struttura

Dettagli

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene

ALLELI, forme alternative di un gene. Alleli, forme alternative di un gene. Alleli, forme alternative di un gene ALLELI, forme alternative di un gene Per ogni gene di un genoma possono esistere, in una popolazione di individui, una o più varianti. LE DIVERSE FORME ALTERNATIVE DI UNO STESSO GENE SI CHIAMANO ALLELI

Dettagli

MECCANISMI DI RESISTENZA AGLI ANTIBIOTICI

MECCANISMI DI RESISTENZA AGLI ANTIBIOTICI MECCANISMI DI RESISTENZA AGLI ANTIBIOTICI Dr. Nunzio Minniti La resistenza ai farmaci antimicrobici è definita come la capacità, acquisita, di un organismo, di resistere agli effetti di un agente chemioterapico

Dettagli

MICROBIOLOGIA - canale 1

MICROBIOLOGIA - canale 1 DIPARTIMENTO DI SCIENZE BIOLOGICHE, GEOLOGICHE E AMBIENTALI Corso di laurea in Scienze biologiche Anno accademico 2016/2017-2 anno MICROBIOLOGIA - canale 1 BIO/19-9 CFU - 2 semestre Docenti titolari dell'insegnamento

Dettagli

Indicazioni per l esame di bioch cellulare - parte B

Indicazioni per l esame di bioch cellulare - parte B Indicazioni per l esame di bioch cellulare - parte B Domande date in precedenti esami Descrivete in che modo ed a quale fine viene regolata l espressione di geni di virulenza nei batteri tramite sistemi

Dettagli

Anno scolastico Classe 5 sez L Docente Roascio Gabriella Disciplina SCIENZE NATURALI- BIOLOGIA MOLECOLARE

Anno scolastico Classe 5 sez L Docente Roascio Gabriella Disciplina SCIENZE NATURALI- BIOLOGIA MOLECOLARE Anno scolastico 207-208 Classe 5 sez L Docente Roascio Gabriella Disciplina SCIENZE NATURALI- BIOLOGIA MOLECOLARE FINALITA DISCIPLINARI - Fornire gli strumenti per conoscere le strutture e le funzioni

Dettagli

PROCARIOTI VS EUCARIOTI ANATOMIA CELLULARE COMPARATA ORGANIZZAZIONE DEL GENOMA E DEI CROMOSOMI REGOLAZIONE DELL ESPRESSIONE GENICA

PROCARIOTI VS EUCARIOTI ANATOMIA CELLULARE COMPARATA ORGANIZZAZIONE DEL GENOMA E DEI CROMOSOMI REGOLAZIONE DELL ESPRESSIONE GENICA PROCARIOTI VS EUCARIOTI ANATOMIA CELLULARE COMPARATA ORGANIZZAZIONE DEL GENOMA E DEI CROMOSOMI REGOLAZIONE DELL ESPRESSIONE GENICA CELLULE PROCARIOTICHE ED EUCARIOTICHE Eucariota: vero nucleo Procariota:

Dettagli

REPLICAZIONE DEL DNA 1

REPLICAZIONE DEL DNA 1 REPLICAZIONE DEL DNA 1 La replicazione del DNA è semiconservativa: ciascuno dei due filamenti parentali serve da stampo per la sintesi di un nuovo filamento e le due nuove doppie eliche sono costituite

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli