# $% $& '()&*!!" Il cancro e una malattia genica, ovvero insorge in conseguenza dell accumulo nella stessa cellula di alterazioni di geni di diverse categorie (oncogeni ed oncosoppressori) %' %! " # $$ % &! # $$ % & * % $( )) Modello di rogressione del Tumore Colorettale p53 + %$%,' ( %( -$ +, -+-, -$+& -, 1
Nel 5-8% dei casi il cancro e anche una malattia genetica (una prima alterazione genica e presente nella linea germinale dell individuo) '( '%)'). % / '( % )))/ $-+, 4 3 /. '( % ))( ( ) ' 1$ - & - - %. -- - / - - - - - '(.))) 0 $ -$- +0 #,+ $ -,. -- -/ $ - Familial tous olyposis (FA) 5 6 78 ( 5 97: 7- ( 5 ;7-< " 7= 8( 5 ;9! = 5 5 <!= 6 9 77* 1 Gene Chromosome Linked families Gene roduct Cellular Localization Function (clonato nel 1991) 5q1 > 90% cytoplasm cell adhesion normal cell GSK-3β axin The -β-catenin pathway E-cadherin proteasome Mutant, β-catenin, axin axin E-cadherin GSK-3β tumoral cell Modello di rogressione del Tumore Colorettale degradation CB groucho CB groucho Tcf Tcf myc repressed myc activated
Modello di rogressione del Tumore Colorettale % )).(. ( MYH )) $( '0% ) ( 1))( '' % /0/" 3 )''1'. ' '' ( ( ' " 3) ( ')) % (. (. 4(..#5.%( )6& %7)) % 8(. #5.( )%6& ) '9/4 (..%( ).( )%! ( %)'% AMSTERDAM CRITERIA (AC I) 1) ) At least three relatives with CRC, one of whom must be a first-degree relative of the other two. FA must be excluded. ) At least two generations must be affected. 3) At least one individual must be less than 50 years old at diagnosis. Vasen et al., Dis Colon Rectum 1991 )- >!!7 MECHANISM OF DNA-MISMATCH REAIR IN E. COLI Hereditary Non olyposis Colorectal Cancer (HNCC) Gene Chromosome Linked families MSH p1-60% MSH1 3p1-3 30% Gene roduct Cellular Localization Function nucleus repair of DNA replication errors 3
Mismatch Repair Genes (MMR) ICG Definition of HNCC Familial clustering of CRC and/or endometrial ca. Associated cancer: ca. of the stomach, ovary, ureter/renal pelvis, brain, small bowel, hepatobiliary tract and skin hmsh on chromosome p hmlh1 on chromosome 3p hms1 on chromosome q hms on chromosome 7q hmsh6 on chromosome p Development of cancer at an early stage Development of multiple cancers High history of MSI (MSI-H) Immunohistochemistry: loss of MLH1, MSH or MSH6 protein expression Germline mutation in MMR genes (MSH, MLH1, MSH6, MS1, MS) Modello del Tumore Colorettale Sporadico p53 Modello di Tumore Colorettale Ereditario Mutazione germinale in p53 Modello di rogressione del Tumore Colorettale Growth factor The RAS-RAF-MAK signalling pathway Tyrosine Kinase receptor GRB SOS RAS BRAF MEK ERK1 ERK OUT Cyclic AM Adenylate cyclase G-protein G-proteincoupled receptor Growth factor Cytoplasm Changes in gene expression Nucleus 4
ANALISI DI ER CR-RFL Modello di rogressione del Tumore Colorettale ttggagctggtggcgtaggca sequenza wt K-ras esone 1 5' 3' ttggagctgatggcgtaggca sequenza mutata ttggacctggtggcgtaggca Un primer modificato introduce un sito di restrizione BstN I (in rosso) CR 5' 3' ttggacctgatggcgtaggca Il sito di restrizione BstN I non si crea a causa della mutazione preesistente Digestione con l enzima di restrizione BstN I e separazione su gel di poliacrilammide al 7%. wt mut 140bp 111bp Modello di rogressione del Tumore Colorettale p53 5
D1 0 A $ -7: 4 // 50% C B= " = / 9 = @ 7?"!= -- 9 50% -- " 50% -- -- -- 7 : )7+; $ %%% % ')( < G.7: GD1 G.7: - - &$ +, 4 (#!! E**F*B:B9 +, 1!!B!FB!7 (' ; H $ 0 - +, "= (= = #. +, 9= 9= := /β/% )7+ ; ' T 53 mut 9 % T53 mut 9 % T 53 mut, 19 % 1 % no mut 10 % 1!!B!FB!7 T53 mut, C h18 lo ss 18 % K- RAS mut 14 % 9 % * T 53 mut 7% T 53 mut 11% /β/% )7+ ; ' C h 18 lo ss, T 53 mut 16 % 1 % COLON no mut % / $ // & /( 7% K- RAS mut 16 % 11% C h 18 lo ss, T53 mut 0 % 7" K- RA S mut, T53 mut 1!!B!FB!7 10 % T53 mut 7% Frattini et al, Clin Cancer Res, 004 C h 18 loss, T 53 mut 8 % RECTUM 14 % no mut 17% K- RAS mut 14 % K- R AS mut, C h 18 lo ss, T53 mut 10 % * 0 % 6
! 5 ) :1/F1 / 1 >1 / - (! 5 - >1 6 1 - ( 5 >16 ( 5 )!/ >1 -- ( 5 - >16 : F1/ E1 E1: ( 5 ; @ 6 // 7*9.! ( 5-6 C7**)+?*!=, 7( 5 >16 +"7=,.+B7=, +B=, + =,! >1 G +:!B!=, $ +-!=, >1 / 0 # - >1 $ G $ - /0 4& / 7/!/* )7+;.$ D - 41> 3 1 >1 )D )1D )1D 3 H. $ I $ $ 4- G-proteincoupled receptor 4& / >1 % G $ - # %- "! )% '.D.D $ - D1 >1 $ % 1J- #!! EB9F*:B( 7
"! "! & 4/ 7 I) 41 ) 41 %- 7!= / )41%- & - ) 41 1# - D$' ) '!! :9F 79 B 4 ( 1!!:*F "9 9 ( "! % % - & # - / 9A*- & - / )41 $-$. -I ) 41 / A # / H 7A79 # / ' - - & - / ) 41 & / :! $ # )'!!BE:7!F *:*!!BE:!BFB*"7!! % //$ % $ - & & )41%-+!!BE!!B,. - & /)41%- $ 0 % - +!!BE!!B, 7= /)41 + $ 0,- / / % - +!!7, )41 $ 0 - F+ I!!BE!!BED!!, $- //% / $- /- $ $ / $ $ A )41 $ 0 - % - +!!7E6!!, D1 / % +6!!, =* D:( & / % - / (. - / & & / / & (!!BE:!BF77B 8