Corso di Elementi di Bioinformatica

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Corso di Elementi di Bioinformatica"

Transcript

1 Corso di Elementi di Bioinformatica Laurea Triennale in Informatica I dati e le banche dati in Bioinformatica Anno Accademico Docente del laboratorio: Raffaella Rizzi 1

2 Il DNA (oggetto biologico) Il DNA è una catena polinucleotidica che contiene le informazioni per la sintesi di RNA e di proteine. Il mattoncino che compone una catena di DNA prende il nome di nucleotide. D b P D: deossiribosio (zucchero pentoso) P: gruppo fosfato b: base azotata

3 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D b P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi:

4 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D A P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A)

5 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D G P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G)

6 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D C P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G) - citosina (C)

7 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D T P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G) - citosina (C) - timina (T)

8 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D T P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) purine - guanina (G) - citosina (C) - timina (T)

9 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D T P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G) - citosina (C) pirimidine - timina (T)

10 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) D T P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G) - citosina (C) - timina (T)

11 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) 3 D T 5 P D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G) - citosina (C) - timina (T)

12 Il DNA (oggetto biologico) Il nucleotide ( mattoncino del DNA) 3 5 D direzione 5 3 P T D: zucchero pentoso (deossiribosio) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G) - citosina (C) - timina (T)

13 Il DNA (oggetto biologico) 3 D T P P D D A C La sequenza delle basi azotate elencate dal 5 al 3 fornisce la sequenza primaria di una catena di DNA Nell esempio della figura si legge quindi CAT (e non TAC) 5 P

14 Il DNA (oggetto biologico) 3 D T In termini informatici è nucleotide uguale a base azotata P P D D A C La sequenza delle basi azotate elencate dal 5 al 3 fornisce la sequenza primaria di una catena di DNA Nell esempio della figura si legge quindi CAT (e non TAC) 5 P

15 Il DNA (oggetto biologico) P 5 3 D T A D P P D A T D P P D C G D 3 5 P

16 Il DNA (oggetto biologico) P 5 3 D T A D P D A T D P A è complementare a T C è complementare a G P P D C G D 3 5 P

17 Il DNA (oggetto biologico) 3 D T A D P 5 strand (reverse) P P D A T D P P strand + (forward) 5 P D C G D 3

18 Il DNA (oggetto biologico) 3 D T A D P 5 strand (reverse) P P D A T D P P Catena forward è CAT D strand + (forward) 5 P C G D 3

19 Il DNA (oggetto biologico) 3 P D T A D P P 5 strand (reverse) Catena reverse è ATG D A T D P P strand + (forward) 5 P D C G D 3

20 Il DNA (dato informatico) La sequenza primaria di un catena di DNA è dunque rappresentata tramite una stringa di simboli appartenenti all alfabeto Σ={A,C,G,T}

21 Il DNA (dato informatico) La sequenza primaria di un catena di DNA è dunque rappresentata tramite una stringa di simboli appartenenti all alfabeto Σ={A,C,G,T} Data una delle due sequenze della doppia elica del DNA ottengo la sequenza appaiata eseguendo un operazione di reverse&complement, cioé: si trasformano le basi secondo la regola (complemento): A->T, T->A, C->G, G->C si inverte la sequenza (cioé la si legge al contrario)

22 Il DNA (dato informatico) Esempio di Reverse&Complement: ACGTAGGATGGACGATGACGATGACGAT

23 Il DNA (dato informatico) Esempio di Reverse&Complement: ACGTAGGATGGACGATGACGATGACGAT complement TGCATCCTACCTGCTACTGCTACTGCTA

24 Il DNA (dato informatico) Esempio di Reverse&Complement: ACGTAGGATGGACGATGACGATGACGAT complement TGCATCCTACCTGCTACTGCTACTGCTA reverse ATCGTCATCGTCATCGTCCATCCTACGT

25 L RNA (oggetto biologico) Il nucleotide (il mattoncino dell RNA) R b P D: ribosio (zucchero pentoso) P: gruppo fosfato b: base azotata di quattro tipi: - adenina (A) - guanina (G) - citosina (C) - uracile (U) uracile al posto della timina (T)

26 L RNA (dato informatico) La sequenza primaria di un catena di RNA è rappresentata tramite una stringa simboli appartenenti all alfabeto Σ={A,C,G,U} L RNA si trova in catene singole

27 La proteina Una proteina è una sequenza di amminoacidi, e dal punto di vista informatico, la sua sequenza primaria è rappresentata come una stringa definita su un alfabeto di 20 simboli.

28 Il sequenziamento Il dato informatico viene prodotto tramite sequenziamento, che significa: è determinare la struttura primaria delle molecole biologiche (DNA/RNA e proteine) è sequenza delle basi {A,C,G,T U} per DNA e RNA è sequenza degli amminoacidi per le proteine Glu Ile Phe Thr Val His

29 Il sequenziamento Cosa si ottiene dal sequenziamento di una molecola biologica? è single-end read DNA/RNA GTTGTGCAGTGACGGA

30 Il sequenziamento Cosa si ottiene dal sequenziamento di una molecola di DNA/RNA è paired-end read (o mate-pair) insertion size DNA/RNA A B

31 Il sequenziamento Cosa si ottiene dal sequenziamento di una molecola di DNA/RNA è paired-end read (o mate-pair) insertion size DNA/RNA A B A = B

32 Il sequenziamento Cosa si ottiene dal sequenziamento di una molecola di DNA/RNA è paired-end read (o mate-pair) insertion size DNA/RNA A B A = B

33 Il sequenziamento Cosa si ottiene dal sequenziamento di una molecola di DNA/RNA è paired-end read (o mate-pair) insertion size DNA/RNA agttgcgt A aatgcctg B agttgcgt gtccgtaa A = B

34 Sanger VS Next-Generation Sequencing Metodo Sanger Metodi Next-Generation Sequencing ð Piuttosto costoso (centinaia di milioni di dollari per Human Genome Project) ð Processa pochissimi reads in un run (copertura relativamente bassa) ð Lunghezza dei reads fino a 1000 bp ð Qualità elevata ð Poco costoso (attorno al milione di dollari per sequenziare il genoma umano) ð Processa tanti reads in un run (milioni) (copertura da 10 a 100 volte superiore quella Sanger) ð Reads relativamente corti ð Qualità relativamente bassa

35 Il sequenziamento Attenzione agli errori di sequenziamento!!! Inoltre, le stringhe che rappresentano DNA e RNA sono in realtà definite su di un alfabeto esteso che prende il nome di IUPAC code

36 IUPAC code per DNA SIMBOLO DESCRIZIONE A Adenine C Cytosine G Guanine T Thymine R Purine (A or G) Y Pyrimidine (C or T) M C or A K T, or G W T, or A S C or G B C, T or G (not A) D A, T or G (not C) H A, T or C (not G) V A, C or G (not T) N any base (A, C, G, T)

37 IUPAC code per RNA SIMBOLO DESCRIZIONE A Adenine C Cytosine G Guanine U Uracil R Purine (A or G) Y Pyrimidine (C or U) M C or A K U or G W U or A S C or G B C, U or G (not A) D A, U or G (not C) H A, U or C (not G) V A, C or G (not U) N any base (A, C, G or U)

38 Cos è un gene? Un gene è una regione (locus) di DNA genomico che codifica proteine.

39 Cos è un gene? Un gene è una regione (locus) di DNA genomico che codifica proteine. La sequenza genomica di un gene è la sequenza nucleotidica del locus di DNA del gene.

40 Cos è un gene? Un gene è una regione (locus) di DNA genomico che codifica proteine. La sequenza genomica di un gene è la sequenza nucleotidica del locus di DNA del gene. La sequenza genomica di un gene è una sottostringa di DNA genomico

41 Cos è un gene? Un gene è una regione (locus) di DNA genomico che codifica proteine. La sequenza genomica di un gene è la sequenza nucleotidica del locus di DNA del gene; in genere viene messa a disposizione in formato FASTA che: è un formato di puro testo nato all interno del software di allineamento FASTA è pensato per memorizzare una sequenza e qualche informazione aggiuntiva è un formato standard di input di molti tools di analisi di sequenze ha estensione *.fa oppure *.fasta

42 Formato FASTA (esempio) >X dna:chromosome chromosome:grch38:x: : :1 GGGGGCAACGGTCACCTGATCTGCGGCTGTCGAGGCCGCTGAGGCAGTGGAGGCTGAGGC TATGATGGCGGCCATGGCGACGGCTCGAGTGCGGATGGGGCCGCGGTGCGCCCAGGCGCT CTGGCGCATGCCGTGGCTGCCGGTGTTTTTGTCGTTGGCGGCGGCGGCGGCGGCGGCAGC GGCGGAGCAGCAGGTCCCGCTGGTGCTGTGGTCGAGTGACCGGTGAGCGGGCCGGGGTGG GATGCGCTGTGGCGGCTGAGGCGCCCTCGCCCGACTCCGGCGCTGTCCTAGGCGAGGGGT GGTGAGGCCCGGAGGTGGACTGTTCCTTGCTCGGGGGCTCGCAGCGAATCTGCCGGCGAC AGAGCTCCAGTCCACATGCGCCCCCGTCTGACAGCACCTCTTCTGTGCCCTGCCAGGGAC TTGTGGGCTCCTGCGGCCGACACTCATGAAGGCCACATCACCAGCGACTTGCAGCTCTCT ACCTACTTAGATCCCGCCCTGGAGCTGGGTCCCAGGAATGTGCTGCTGTTCCTGCAGGAC AAGGTGCGCCCGCCCCAGCCCACTCTCCCCCGGTCATCGGGAGGCAGCCAGGCCCCCTCC CCCCATGACACTGACGCCCATTCCCCAAGGGAAGCTTCAGTGACCTTGTCCCAACTGTAG GGAGGTGTGGGTCGTCTCATGGGAAGGCCTGTAGTAAACGCTTCAGTGGGCATGGCGACA GCCTCGGAAATGGCACCAACTTGATTGGAGGAAGCGACGGACCAGAGGCCAGGTACCTAC TGAGTACCAAGCACTTTGGATATCTGACTTAGTCCAATATGGTGGGTGGGGATTATCGTC [ ]

43 Cos è un gene? Un gene è una regione (locus) di DNA genomico che codifica proteine. Un gene viene identificato tramite il suo HUGO NAME ( Esempio di HUGO NAME: ATP6AP1 (ATPase, H+ transporting, lysosomal accessory protein 1)

44 Cos è un gene? Un gene è una regione (locus) di DNA genomico che codifica proteine. Entrambe le catene di DNA genomico contengono geni. 5 strand + (forward) 3 3 strand - (reverse) 5

45 Cos è un gene? Un gene è una regione (locus) di DNA genomico che codifica proteine. Entrambe le catene di DNA genomico contengono geni. 5 strand + (forward) 3 3 strand - (reverse) 5 direzione di trascrizione

46 Espressione di un gene DNA

47 Espressione di un gene DNA La barra verde rappresenta la stringa di DNA del locus genomico del gene (sequenza genomica)

48 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon

49 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon splice site (confine esone-introne) 3 splice site (confine introne-esone) Esone = regione codificante Introne = regione non-codificante

50 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon TRASCRIZIONE pre-mrna 5 exon 1 intron1 exon 2 intron2 exon 3 3

51 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon TRASCRIZIONE pre-mrna 5 exon 1 intron1 exon 2 intron2 exon 3 3 Il pre-mrna è una copia della sequenza di DNA del gene (a meno della sostituzione di T con U)

52 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon TRASCRIZIONE pre-mrna 5 exon 1 intron1 exon 2 intron2 exon 3 3 SPLICING mrna exon 1 exon 2 exon 3 (trascritto)

53 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon TRASCRIZIONE pre-mrna 5 exon 1 intron1 exon 2 intron2 exon 3 3 SPLICING mrna (trascritto)

54 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon TRASCRIZIONE pre-mrna 5 exon 1 intron1 exon 2 intron2 exon 3 3 SPLICING mrna (trascritto) CDS (coding sequence) AUG [stop] [stop] UAG UAA UGA

55 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon TRASCRIZIONE pre-mrna 5 exon 1 intron1 exon 2 intron2 exon 3 3 SPLICING mrna (trascritto) CDS (coding sequence) AUG [stop] [stop] start codon stop codon UAG UAA UGA

56 Espressione di un gene DNA 5 exon 1 intron1 exon 2 intron2 exon TRASCRIZIONE pre-mrna 5 exon 1 intron1 exon 2 intron2 exon 3 3 SPLICING mrna (trascritto) CDS (coding sequence) AUG [stop] [stop] 5 UTR 3 UTR UAG UAA UGA

57 Espressione di un gene mrna (trascritto) CDS (coding sequence) AUGCCAAGCGAUUAG Codice genetico da Wikipedia

58 Espressione di un gene mrna (trascritto) CDS (coding sequence) AUGCCAAGCGAUUAG Proteina: Met Codice genetico da Wikipedia

59 Espressione di un gene mrna (trascritto) CDS (coding sequence) AUGCCAAGCGAUUAG Proteina: Met Pro Codice genetico da Wikipedia

60 Espressione di un gene mrna (trascritto) CDS (coding sequence) AUGCCAAGCGAUUAG Proteina: Met Pro Ser Codice genetico da Wikipedia

61 Espressione di un gene mrna (trascritto) CDS (coding sequence) AUGCCAAGCGAUUAG Proteina: Met Pro Ser Asp Codice genetico da Wikipedia

62 Espressione di un gene mrna (trascritto) CDS (coding sequence) AUGCCAAGCGAUUAG Met Pro Ser Asp [stop] Codice genetico da Wikipedia

63 Pattern di un introne 5 exon 1 exon 2 exon 3 3 Introne canonico % GT AG Introni non canonici GC 0.69 % AG AT 0.05 % AC ALTRO 0.02 % Burset et al., Nucleic Acids Res. 2000, 28:

64 Alternative Splicing (AS) Gene1 5 exon 1 exon 2 exon 3 3 exon 1 exon 2 exon 3 mrna ref

65 Alternative Splicing (AS) Gene1 5 exon 1 exon 2 exon 3 3 exon 1 exon 2 exon 3 mrna ref mrna1 exon 1 exon 1 intron retention exon 2 exon 3

66 Alternative Splicing (AS) Gene1 5 exon 1 exon 2 exon 3 3 exon 1 exon 2 exon 3 mrna ref mrna1 exon 1 exon 1 exon 2 exon 3 mrna2 exon 1 exon skipping exon 3

67 Alternative Splicing (AS) Gene1 5 exon 1 exon 2 exon 3 3 exon 1 exon 2 exon 3 mrna ref mrna1 exon 1 exon 1 exon 2 exon 3 mrna2 exon 1 exon 3 mrna3 exon 1 5 competing exon 2 exon 3

68 Alternative Splicing (AS) Gene1 5 exon 1 exon 2 exon 3 3 exon 1 exon 2 exon 3 mrna ref mrna1 exon 1 exon 1 exon 2 exon 3 mrna2 exon 1 exon 3 mrna3 exon 1 exon 2 exon 3 mrna4 exon 1 exon 2 exon 3 3 competing

69 Alternative Splicing (AS) Gene2 5 exon 1 exon 2 exon 3 exon 4 3 mrna ref exon 1 exon 2 exon 3 exon 4

70 Alternative Splicing (AS) Gene2 exon 1 5 exon 2 exon 3 exon 4 3 exon 1 exon 2 exon 3 exon 4 mrna ref mrna1 exon 1 exon 3 exon 4 mrna2 exon 1 exon 2 exon 4

71 Alternative Splicing (AS) Gene2 exon 1 5 exon 2 exon 3 exon 4 3 exon 1 exon 2 exon 3 exon 4 mrna ref mrna1 exon 1 exon 3 exon 4 mrna2 exon 1 exon 2 exon 4 mutually exclusive exons

72 Alternative Splicing (AS) Gene2 exon 1 exon 2 exon 3 exon mrna ref exon 1 exon 2 exon 3 exon 4 mrna1 exon 1 exon 3 exon 4 mrna2 exon 1 exon 2 exon 4 exon 1 exon 2 exon 3 exon 4 mrna3 multiple poly(a) sites

73 Alternative Splicing (AS) Gene2 5 exon 1 exon 2 exon 3 exon 4 3 mrna ref exon 1 exon 2 exon 3 exon 4 mrna1 exon 1 exon 3 exon 4 mrna2 exon 1 exon 2 exon 4 exon 1 exon 2 exon 3 exon 4 mrna3 exon 1 exon 2 exon 3 exon 4 mrna4 multiple promoters

74 Alternative Splicing (AS) Gene2 5 exon 1 exon 2 exon 3 exon 4 3 mrna ref exon 1 exon 2 exon 3 exon 4 mrna1 exon 1 exon 3 exon 4 Isoforma = uno dei trascritti (mrna) che il gene è in grado di trascrivere (oppure una delle proteine che il gene è in grado di esprimere) mrna2 exon 1 exon 2 exon 4 exon 1 exon 2 exon 3 exon 4 mrna3 exon 1 exon 2 exon 3 exon 4 mrna4 multiple promoters

75 Dati importanti Dati fondamentali in Bioinformatica sono i dati ottenuti dal sequenziamento di trascritto (frammenti di trascritto) che prendono il nome di: q EST (Expressed Sequence Tag) se ottenuti con metodo Sanger q RNA-seq se ottenuti tramite una delle tecnologie NGS

76 EST vs RNA-seq Metodo Sanger ð Piuttosto costoso (centinaia di milioni di dollari per Human Genome Project) ð Processa pochissimi reads in un run (copertura relativamente bassa) ð Lunghezza dei reads fino a 1000 bp ð Qualità elevata Metodi NGS ð Poco costoso (attorno al milione di dollari per sequenziare il genoma umano) ð Processa tanti reads in un run (milioni) (copertura da 10 a 100 volte superiore quella Sanger) ð Reads relativamente corti ð Qualità relativamente bassa

77 EST vs RNA-seq Metodo Sanger ð Piuttosto costoso (centinaia di milioni di dollari per Human Genome Project) Expressed Sequence Tag (EST) ð Processa pochissimi reads in un run (copertura relativamente bassa) ð Lunghezza dei reads fino a 1000 bp ð Qualità elevata Metodi NGS ð Poco costoso (attorno al milione di dollari per sequenziare il genoma umano) ð Processa tanti reads in un run (milioni) (copertura da 10 a 100 RNA-seq volte superiore quella Sanger) ð Reads relativamente corti ð Qualità relativamente bassa

78 Risorse WEB in Bioinformatica Quali risorse il WEB ci mette a disposizione? Banche dati genomiche Sistemi integrati Browser Genomici Tools

79 Risorse WEB in Bioinformatica Quali risorse il WEB ci mette a disposizione? Banche dati genomiche Sistemi integrati Browser Genomici Tools

80 Banche dati genomiche Scopo? archiviare e diffondere i dati ottenuti da esperimenti biologici Quali oggetti sono contenuti? Sequenze nucleotidiche (DNA, RNA) Geni Trascritti Expressed Sequence Tag (EST) Proteine SNPs (Single Nucleotide Polymorphism) strutture proteiche 3D e altro ancora

81 Banche dati genomiche come risorsa di dati, hanno la necessità di: correlare dati diversi ridurre la ridondanza dei dati ridurre la non uniformità stesso ID per lo stesso oggetto stesso livello di qualità In una parola: (necessità di) integrazione

82 Banche dati genomiche Non è detto che siano DB relazionali Oggetto contenuto = entry identificata univocamente da un ID entry = text file in un formato che sia: human-readable facile da trattare (parsing con Perl, Phyton, Ruby, etc.) flessibile Due tipi principali di banche: primarie oggetti di tipo eterogeneo archiviati con un minimo di informazione (ad esempio sequenze nucleotidiche) specializzate: oggetti omogenei per tassonomia, funzione, etc. (ad esempio frammenti di trascritto)

83 Banche dati genomiche Le storiche banche primarie di sequenze nucleotidiche sono: EMBL Data Bank sviluppata da EMBL-EBI (European Bioinformatics Institute, parte dell European Molecular Biology Laboratory, EMBL) formato entry file: EMBL

84 Banche dati genomiche Le storiche banche primarie di sequenze nucleotidiche sono: EMBL Data Bank sviluppata da EMBL-EBI (European Bioinformatics Institute, parte dell European Molecular Biology Laboratory, EMBL) GenBank formato entry file: EMBL sviluppata da NCBI (National Center for Biotechnology Information, USA) formato entry file: GenBank

85 Banche dati genomiche Le storiche banche primarie di sequenze nucleotidiche sono: DDBJ DNA Data Bank of Japan sviluppata dal National Institute of Genetics in Mishima formato entry file: GenBank

86 Banche dati genomiche Le storiche banche primarie di sequenze nucleotidiche sono: DDBJ DNA Data Bank of Japan sviluppata dal National Institute of Genetics in Mishima formato entry file: GenBank L ID univoco che identifica le sequenze all interno di queste banche prende il nome di Accession Number

87 Banche dati genomiche Le storiche banche primarie di sequenze nucleotidiche sono: DDBJ DNA Data Bank of Japan sviluppata dal National Institute of Genetics in Mishima formato entry file: GenBank

88 Banche dati genomiche Esercizio q Recuperare la sequenza con Accession Number M10051 da EMBL ( scaricarla sia in formato EMBL che in formato FASTA

89 Banche dati genomiche Esercizio þ q Recuperare la sequenza con Accession Number M10051 da EMBL ( scaricarla sia in formato EMBL che in formato FASTA Recuperare la sequenza con Accession Number M10051 da GenBank (

90 Banche dati genomiche Esercizio q þ q Recuperare la sequenza con Accession Number M10051 da EMBL ( scaricarla sia in formato EMBL che in formato FASTA Recuperare la sequenza con Accession Number M10051 da GenBank ( Recuperare la sequenza con Accession Number M10051 da DDBJ (

91 Banche dati genomiche Una delle banche principali di sequenze proteiche è: UniProt fusione di SwissProt + TrEMBL + PIR sviluppata da un consorzio di: EMBL-EBI PIR (Protein Information Resource) SIB (Swiss Institute of Bioinformatics)

92 Banche dati genomiche Una delle banche principali di sequenze proteiche è: UniProt fusione di SwissProt + TrEMBL + PIR sviluppata da un consorzio di: EMBL-EBI PIR (Protein Information Resource) SIB (Swiss Institute of Bioinformatics) L ID univoco che identifica le sequenze all interno di queste banche prende il nome di Accession Number

93 Banche dati genomiche Esercizio q q Recuperare da UniProt la proteina con Accession Number P63104 ( Individuare lo HUGO NAME del gene che codifica tale proteina

94 Banche dati genomiche Esercizio q q Recuperare da UniProt la proteina con Accession Number P63104 ( Individuare lo HUGO NAME del gene che codifica tale proteina Il gene è YWHAZ

95 Banche dati genomiche Esercizio þ þ q q Recuperare da UniProt la proteina con Accession Number P63104 ( Individuare lo HUGO NAME del gene che codifica tale proteina Individuare le isoforme del gene e scaricare la loro sequenza di amminoacidi in formato FASTA Usare BLAST (Basic Local Alignment Search Tool) per cercare in UniProt le proteine simili

96 Banche dati genomiche Banche specializzate: UniGene banca di trascritti (EST e mrna) mette a disposizione i trascritti raggruppati per gene e per organismo (cluster) sviluppata da NCBI (National Center for Biotechnology Information, USA) formato entry file: FASTA

97 Banche dati genomiche Banche specializzate: dbest banca di sequenze EST sviluppata da NCBI (National Center for Biotechnology Information, USA)

98 Banche dati genomiche Banche specializzate: dbest banca di sequenze EST sviluppata da NCBI (National Center for Biotechnology Information, USA) RefSeq banca di sequenze annotate (genomi, cromosomi, mrna e proteine) sviluppata da NCBI (National Center for Biotechnology Information, USA)

99 Banche dati genomiche Esercizio q Cercare i clusters UniGene associati al gene con HUGO NAME ATP6AP1 e scaricare il cluster relativo all uomo ( NB: I clusters UniGene hanno un identificatore univoco del tipo [org]. [dd], dove [org] è un codice a due lettere che specifica l organismo (ad esempio, Hs per uomo, Mm per topo, Rn per ratto, etc.), e [dd] è una stringa di cifre 0-9. Ad esempio Hs è l identificatore del cluster relativo al gene umano INSR

100 Banche dati genomiche Esercizio þ q Cercare i clusters UniGene associati al gene con HUGO NAME ATP6AP1 e scaricare il cluster relativo all uomo ( Estrarre l identificatore gb (GenBank ID), la lunghezza e l orientamento della prima sequenza EST presente in tale cluster NB: Il GenBank ID di una sequenza in un cluster UniGene è ricavabile dall header FASTA nel campo /gb=xxxxx La lunghezza L di una sequenza in un cluster UniGene è ricavabile dall header FASTA nel campo /len=l L orientamento di una sequenza in un cluster UniGene è ricavabile dall header FASTA nel campo /clone_end=[5 3 ] (5 significa che la sequenza è orientata 3 5, e 3 significa che la sequenza è orientata 5 3.

101 Banche dati genomiche Esercizio þ þ q Cercare i clusters UniGene associati al gene con HUGO NAME ATP6AP1 e scaricare il cluster relativo all uomo ( Estrarre l identificatore gb (GenBank ID), la lunghezza e l orientamento della prima sequenza EST presente in tale cluster Eseguire una nuova interrogazione di UniGene, inserendo il GenBank ID dell EST trovato al punto precedente

102 Banche dati genomiche Esercizio þ þ q q Cercare i clusters UniGene associati al gene con HUGO NAME ATP6AP1 e scaricare il cluster relativo all uomo ( Estrarre l identificatore gb (GenBank ID), la lunghezza e l orientamento della prima sequenza EST presente in tale cluster Eseguire una nuova interrogazione di UniGene, inserendo il GenBank ID dell EST trovato al punto precedente Cercare lo stesso GenBank ID nella banca dati dbest (

103 Banche dati genomiche Esercizio þ þ q þ q Cercare i clusters UniGene associati al gene con HUGO NAME ATP6AP1 e scaricare il cluster relativo all uomo ( Estrarre l identificatore gb (GenBank ID), la lunghezza e l orientamento della prima sequenza EST presente in tale cluster Eseguire una nuova interrogazione di UniGene, inserendo il GenBank ID dell EST trovato al punto precedente Cercare lo stesso GenBank ID nella banca dati dbest ( Cercare nel cluster UniGene appena scaricato, gli mrna che appartengono anche alla banca RefSeq ( NB: Il GenBank ID di sequenze che sono mrna provenienti dalla banca RefSeq, inizia con NM_

104 Banche dati genomiche Esercizio þ þ q þ þ q Cercare i clusters UniGene associati al gene con HUGO NAME ATP6AP1 e scaricare il cluster relativo all uomo ( Estrarre l identificatore gb (GenBank ID), la lunghezza e l orientamento della prima sequenza EST presente in tale cluster Eseguire una nuova interrogazione di UniGene, inserendo il GenBank ID dell EST trovato al punto precedente Cercare lo stesso GenBank ID nella banca dati dbest ( Cercare nel cluster UniGene appena scaricato, gli mrna che appartengono anche alla banca RefSeq ( Cercare uno di tali mrna sia in dbest che in RefSeq

105 Banche Dati Biologiche Altre banche specializzate: Entrez Gene banca di geni sviluppata da NCBI (National Center for Biotechnology Information, USA) dbsnp banca di SNPs (Single Polymorphism Nucleotide) sviluppata da NCBI (National Center for Biotechnology Information, USA)

106 Banche Dati Biologiche Altre banche specializzate: UTRdb banca di regioni UTR in mrna di organismi eucarioti sviluppata da ITB-CNR di Bari (Istituto di Tecnologie Biomediche del CNR)

107 Banche Dati Biologiche Altre banche specializzate: PubMed banca di riferimenti bibliografici sviluppata da NCBI (National Center for Biotechnology Information, USA) PDB (Protein Data Bank) banca di strutture proteiche 3D

108 Sistemi integrati Sistemi per interrogare contemporaneamente più banche dati. SRS Entrez sviluppato EMBL-EBI (European Bioinformatics Institute) sviluppato da NCBI (National Center for Biotechnology Information, USA)

109 Sistemi integrati Esercizio q Usare Entrez per ottenere la sequenza nucleotidica con Accession Number M10051 ( Usare Entrez per ottenere tutte le risorse in cui presente l mrna con GenBank ID NM_ (del gene umano ABCB10) e l EST con GenBank ID AW

Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2016/2017 I dati in Bioinformatica Docente del laboratorio: Raffaella Rizzi 1 Il DNA (oggetto biologico)

Dettagli

Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2016/2017 Formato GTF per annotare un gene Docente del laboratorio: Raffaella Rizzi 1 GTF (Gene Transfer

Dettagli

Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E3101Q116) AA 2015/2016 Parsing di un file in formato EMBL (parte I) Docente del laboratorio: Raffaella Rizzi 1 Esercizio

Dettagli

Corso di Elementi di Bionformatica

Corso di Elementi di Bionformatica Corso di Elementi di Bionformatica Laurea Triennale in Informatica Il formato FASTQ per la qualità delle sequenze Anno Accademico 2015-2016 Docente del laboratorio: Raffaella Rizzi 1 La qualità delle sequenze

Dettagli

Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA.

Il progetto Genoma Umano è iniziato nel E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Il progetto Genoma Umano è iniziato nel 1990. E stato possibile perchè nel 1986 era stato sviluppato il sequenziamento automatizzato del DNA. Progetto internazionale finanziato da vari paesi, affidato

Dettagli

Bioinformatica. Analisi del genoma

Bioinformatica. Analisi del genoma Bioinformatica Analisi del genoma GABRIELLA TRUCCO CREMA, 5 APRILE 2017 Cosa è il genoma? Insieme delle informazioni biologiche, depositate nella sequenza di DNA, necessarie alla costruzione e mantenimento

Dettagli

Introduzione alla Genomica

Introduzione alla Genomica Laboratorio di Bioinformatica I Introduzione alla Genomica Dott. Sergio Marin Vargas (2014 / 2015) Il Genoma umano Gene codificanti proteine Gene non codificanti proteine Geni codificanti proteine 3 Il

Dettagli

Laboratorio di Elementi di Bioinformatica

Laboratorio di Elementi di Bioinformatica Laboratorio di Elementi di Bioinformatica Laurea Triennale in Informatica (codice: E30Q6) AA 205/206 Esempio di workflow Docente del laboratorio: Raffaella Rizzi Scopo del workflow Scopo: dato un insieme

Dettagli

CELLULA PROCARIOTICA PROCARIOTE

CELLULA PROCARIOTICA PROCARIOTE CELLULA PROCARIOTICA O PROCARIOTE CELLULA EUCARIOTICA O EUCARIOTE Sany0196.jpg IL NUCLEO Provvisto di due membrane (interna ed esterna) che congiungendosi in alcuni punti formano i pori nucleari attraverso

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO:

LA SINTESI PROTEICA LE MOLECOLE CHE INTERVENGONO IN TALE PROCESSO SONO: LA SINTESI PROTEICA La sintesi proteica è il processo che porta alla formazione delle proteine utilizzando le informazioni contenute nel DNA. Nelle sue linee fondamentali questo processo è identico in

Dettagli

Provate rispondere alle domande, se ci riuscirete, sarete pronti a superare l esame per quanto riguarda la parte di bioinformatica.

Provate rispondere alle domande, se ci riuscirete, sarete pronti a superare l esame per quanto riguarda la parte di bioinformatica. Per aiutarvi ho elaborato (frettolosamente) questi quesiti che dovrebbero aiutarvi ad individuare gli argomenti importanti del corso ed a darvi un idea delle domande che potrebbero esservi poste all esame.

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi

COME È FATTO? Ogni filamento corrisponde ad una catena di nucleotidi Il DNA Il DNA è una sostanza che si trova in ogni cellula e contiene tutte le informazioni sulla forma e sulle funzioni di ogni essere vivente: eppure è una molecola incredibilmente semplice. COME È FATTO?

Dettagli

Bioinformatica ed applicazioni di bioinformatica strutturale!

Bioinformatica ed applicazioni di bioinformatica strutturale! Bioinformatica ed applicazioni di bioinformatica strutturale! Bioinformatica! Le banche dati! Programmi per estrarre ed analizzare i dati! I numeri! Cellule nell uomo! Geni nell uomo! Genoma umano Il dogma

Dettagli

Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015)

Laboratorio di Bioinformatica I. Parte 2. Dott. Sergio Marin Vargas (2014 / 2015) Laboratorio di Bioinformatica I Banche dati Parte 2 Dott. Sergio Marin Vargas (2014 / 2015) Google Scholar https://scholar.google.it/ E un motore di ricerca di Google, specializzato nella ricerca di articoli

Dettagli

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE?

DNA E PROTEINE IL DNA E RACCHIUSO NEL NUCLEO, MENTRE LA SINTESI PROTEICA SI SVOLGE NEL CITOPLASMA: COME VIENE TRASPORTATA L INFORMAZIONE? DNA E PROTEINE NUMEROSI DATI SUGGERISCONO CHE IL DNA SVOLGA IL SUO RUOLO GENETICO CONTROLLANDO LA SINTESI DELLE PROTEINE, IN PARTICOLARE DETERMINANDONE LA SEQUENZA IN AMINOACIDI E NECESSARIO RISPONDERE

Dettagli

Laboratorio di Bioinformatica I. Parte 1. Dott. Sergio Marin Vargas (2014 / 2015)

Laboratorio di Bioinformatica I. Parte 1. Dott. Sergio Marin Vargas (2014 / 2015) Laboratorio di Bioinformatica I Banche dati Parte 1 Dott. Sergio Marin Vargas (2014 / 2015) Introduzione a NCBI National Center for Biotechnology Information (NCBI) http://www.ncbi.nlm.nih.gov/ NCBI Databases

Dettagli

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi

GENOMA. Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine CONTENUTO FUNZIONE. Progetti genoma in centinaia di organismi GENOMA EVOLUZIONE CONTENUTO FUNZIONE STRUTTURA Analisi di sequenze -- Analisi di espressione -- Funzione delle proteine Progetti genoma in centinaia di organismi Importante la sintenia tra i genomi The

Dettagli

Dal gene alla proteina

Dal gene alla proteina Dal gene alla proteina Il collegamento tra geni e proteine La trascrizione e la traduzione sono i due principali processi che legano il gene alla proteina: uno sguardo panoramico Le informazioni genetiche

Dettagli

Codice Genetico (segue)

Codice Genetico (segue) CODICE GENETICO Nucleotidi, acidi nucleici CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. Consiste

Dettagli

Nozioni base di Biologia

Nozioni base di Biologia Nozioni base di Biologia Ripercorriamo velocemente i principali concetti di biologia indispensabili per capire la Bioinformatica: verranno approfonditi in altri corsi. Gli organismi viventi possiedono

Dettagli

Struttura ed espressione del Gene

Struttura ed espressione del Gene Struttura ed espressione del Gene PowerPoint Lectures for Essential Biology, Third Edition Neil Campbell, Jane Reece, and Eric Simon Essential Biology with Physiology, Second Edition Neil Campbell, Jane

Dettagli

IPOTESI UN GENE-UN ENZIMA

IPOTESI UN GENE-UN ENZIMA IPOTESI UN GENE-UN ENZIMA DNA: contiene tutte le informazioni per definire lo sviluppo e la fisiologia della cellula: ma come svolge questa funzione? Beadle e Tatum (1941): studiando mutanti della comune

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Biologia Molecolare. CDLM in CTF La riparazione del DNA

Biologia Molecolare. CDLM in CTF La riparazione del DNA Biologia Molecolare CDLM in CTF 2010-2011 La riparazione del DNA I tipi di mutazione e le conseguenze Le classi di danno al DNA Meccanismi di riparazione La necessità di codificare l informazione L informazione

Dettagli

Banche Dati. Docente: Dr. Antinisca DI MARCO

Banche Dati. Docente: Dr. Antinisca DI MARCO Docente: Dr. Antinisca DI MARCO Email: antinisca.dimarco@di.univaq.it La biologia molecolare produce una grande mole di dati che può essere memorizzata in database general-purpose o specialized (es. immunological):

Dettagli

Informatica e Bioinformatica A. A

Informatica e Bioinformatica A. A GQuery (http://www.ncbi.nlm.nih.gov/gquery/) è il punto di partenza per eseguire query su tutti o parte dei database dell NCBI: si basa sul sistema di interrogazione ENTREZ Informatica e Bioinformatica

Dettagli

Il DNA conserva l informazione genetica

Il DNA conserva l informazione genetica Il DNA conserva l informazione genetica Gli esperimenti di Frederick Griffith (1928) Gli esperimenti di Oswald Avery (1944) + Estratti dal ceppo IIIS ucciso al calore di Polisaccaridi Lipidi Proteine Acidi

Dettagli

Informatica e biotecnologie I parte

Informatica e biotecnologie I parte Informatica e biotecnologie I parte Banche dati biologiche Bioinformatica La Bioinformatica è una disciplina che affronta con metodiche proprie delle Scienze dell'informazione problemi propri della Biologia.

Dettagli

Gli Acidi Nucleici DNA RNA

Gli Acidi Nucleici DNA RNA Gli Acidi Nucleici DNA RNA Gli Acidi nucleici Gli acidi nucleici sono il: DNA (acido desossiribonucleico) RNA (acido ribonucleico) Essi sono formati dai polimeri (molecole molto grosse) i cui monomeri

Dettagli

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La

Dettagli

LE BASI AZOTATE PIRIMIDINE PURINE

LE BASI AZOTATE PIRIMIDINE PURINE LE BASI AZTATE PURIE PIRIMIDIE Le basi azotate sono composti eterociclici aromatici con azoti portanti doppietti basici. Possono avere un solo anello (pirimidine) o due (purine). Le basi adenina, guanina

Dettagli

La genetica molecolare

La genetica molecolare La genetica molecolare 1 Il materiale genetico Varia di quantità da specie a specie. Regola lo sviluppo della cellula. Ha la capacità di duplicarsi. Nome comune Numero di coppie di cromosomi zanzara 3

Dettagli

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente)

07/01/2015. Come si ferma una macchina in corsa? Il terminatore. Terminazione intrinseca (rho-indipendente) Come si ferma una macchina in corsa? Il terminatore Terminazione intrinseca (rho-indipendente) Terminazione dipendente dal fattore Rho (r) 1 Operoni: gruppi di geni parte di una unica unità trascrizionale

Dettagli

Banche dati molti dati sulle proteine derivano dalle banche dati primarie

Banche dati molti dati sulle proteine derivano dalle banche dati primarie Banche dati Banche dati Si possono raggruppare in varie categorie in base al tipo di dato biologico che raccolgono e organizzano, ma ce ne sono alcune che sono da considerarsi fondamentali: - banche dati

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

SINTESI E MATURAZIONE DEGLI RNA CELLULARI

SINTESI E MATURAZIONE DEGLI RNA CELLULARI SINTESI E MATURAZIONE DEGLI RNA CELLULARI PER TRASCRIZIONE SI INTENDE LA SINTESI DI UNA MOLECOLA DI RNA COMPLEMENTARE AD UNO STAMPO DI DNA. GLI RNA CELLULARI SONO DISTINTI IN TRE PRINCIPALI CATEGORIE:

Dettagli

GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto.

GENE. Fattore trasformante? Riproduzione del ceppo S. Preparazione del fattore trasformante. Trasformazione del ceppo R. ceppo S. deceduto. ceppo S 1 Griffith and Avery 1930 deceduto ceppo R 2 vivo ceppo S ucciso al calore 3 ceppo R 4 vivo ceppo S ucciso al calore deceduto Riproduzione del ceppo S Preparazione del fattore trasformante lisi

Dettagli

Modulo Laboratorio A.A. 2014/2015

Modulo Laboratorio A.A. 2014/2015 Biochimica - Laboratorio di Bioinformatica I (CdL. Bioinformatica) Bioinformatica e banche dati biologiche (CdL. Biotecnologie) Modulo Laboratorio A.A. 2014/2015 Docente: Dr. Sergio Marin Vargas Mail:

Dettagli

lati esterni altamente Idrofilici

lati esterni altamente Idrofilici I due filamenti complementari del DNA sono antiparalleli: uno è in direzione 5-3 e l altro in direzione 3-5. parte interna idrofobica lati esterni altamente Idrofilici APPAIAMENTO DELLE BASI AZOTATE: 2

Dettagli

Corso di Bioinformatica e analisi dei genomi, docente Silvia Fuselli. Esercizi ricerche in banche dati

Corso di Bioinformatica e analisi dei genomi, docente Silvia Fuselli. Esercizi ricerche in banche dati Corso di Bioinformatica e analisi dei genomi, docente Silvia Fuselli Esercizi ricerche in banche dati 1) Nel romanzo fantasy Jurassic Park di Michael Crichton sulla possibilità di clonare i dinosauri,

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Vai al sito: Incolla nel box vuoto la sequenza nucleotidica

Vai al sito:  Incolla nel box vuoto la sequenza nucleotidica Identificare il gene a cui appartiene la sequenza (sonda) e la sua posizione sul cromosoma. Per raggiungere l obiettivo della prima parte dell attività devi usare il software BLAT (BLAST- Like Alignment

Dettagli

2. DUPLICAZIONE DNA. 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI

2. DUPLICAZIONE DNA. 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 2. DUPLICAZIONE DNA 1. COMPOSIZIONE e STRUTTURA 3. CROMOSOMI 1 1. COMPOSIZIONE e STRUTTURA Ma che cos è il DNA? è un contenitore di informazioni... scritte come sequenza di basi azotate 2 Acidi Nucleici:

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Il dogma centrale della biologia. molecolare

Il dogma centrale della biologia. molecolare Il dogma centrale della biologia Cell molecolare Transcription Translation Ribosome DNA mrna Polypeptide (protein) L informazione per la sintesi delle proteine è contenuta nel DNA. La trascrizione e la

Dettagli

Introduzione alla biologia della cellula. Lezione 3 Le biomolecole DNA e RNA

Introduzione alla biologia della cellula. Lezione 3 Le biomolecole DNA e RNA Introduzione alla biologia della cellula Lezione 3 Le biomolecole DNA e RNA Acidi nucleici DNA (acido desossiribonucleico) RNA (acido ribonucleico) Sono polimeri di monomeri detti NUCLEOTIDI Un nucleotide

Dettagli

Modello computazionale per la predizione di siti di legame per fattori di trascrizione

Modello computazionale per la predizione di siti di legame per fattori di trascrizione Modello computazionale per la predizione di siti di legame per fattori di trascrizione Attività di tirocinio svolto presso il Telethon Institute of Genetics and Medicine Relatori Prof. Giuseppe Trautteur

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli fss@unife.it Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,

Dettagli

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

IL MATERIALE EREDITARIO. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene IL MATERIALE EREDITARIO Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene Caratteristiche del materiale ereditario 1 Replicarsi accuratamente durante crescita e divisione

Dettagli

SDD Seconde Gli acidi nucleici. Gli acidi nucleici

SDD Seconde Gli acidi nucleici. Gli acidi nucleici 1 Capire come le informazioni genetiche sono immagazzinate nelle cellule e come avviene la trasformazione di queste informazioni nei meccanismi metabolici delle cellule. Quattro mattoncini La cellula ha

Dettagli

Riarrangiamento genico

Riarrangiamento genico Riarrangiamento genico 1 3 quesiti per la comprensione Ø l esistenza nello stesso anticorpo di una parte variabile ed una costante; Ø l esistenza della enorme variabilità (diversità) del sito combinatorio;

Dettagli

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA

Nucleotidi e Acidi Nucleici. Struttura di DNA e RNA Nucleotidi e Acidi Nucleici Nucleosidi Nucleotidi Funzioni biologiche dei nucleotidi Struttura di DNA e RNA Concatenazione e appaiamento dei nucleotidi Lo scheletro degli acidi nucleici Componenti degli

Dettagli

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO

Codice Genetico (segue) 04/11/2015. «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO «Wobble base pairs» (appaiamento tentennante di basi) CODICE GENETICO http://www.atdbio.com/img/articles/rna wobble base pairs large.png CODICE GENETICO Codice mediante il quale la sequenza nucleotidica

Dettagli

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI

LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI CONCETTI DI BASE LA BIOLOGIA MOLECOLARE E UNA BRANCA DELLA BIOLOGIA CHE STUDIA LE BASI MOLECOLARI DELLE FUNZIONI BIOLOGICHE, PONENDO UNA PARTICOLARE ATTENZIONE A QUEI PROCESSI CHE COINVOLGONO GLI ACIDI

Dettagli

L ACQUA E LE SUE PROPRIETÀ

L ACQUA E LE SUE PROPRIETÀ L ACQUA E LE SUE PROPRIETÀ L acqua è una sostanza indispensabile per tutte le forme di vita. Ogni molecola di acqua (H2O) è formata da due atomi di idrogeno e un atomo di ossigeno, uniti tramite due legami

Dettagli

ACIDI NUCLEICI ESPERIMENTI

ACIDI NUCLEICI ESPERIMENTI ACIDI NUCLEICI ESPERIMENTI 1869 FRIEDRICK MIESCHER Isolò per la prima volta una sostanza zuccherina leggermente acida contenente fosforo Questa sostanza venne chiamata: acido nucleico perché scoperta nel

Dettagli

Acidi Nucleici: DNA = acido deossiribonucleico

Acidi Nucleici: DNA = acido deossiribonucleico Acidi Nucleici: DNA = acido deossiribonucleico depositario dell informazione genetica RNA: acido ribonucleico trascrizione e traduzione dell informazione genetica dogma centrale della biologia molecolare

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

LA TRASCRIZIONE NEGLI EUCARIOTI

LA TRASCRIZIONE NEGLI EUCARIOTI LA TRASCRIZIONE NEGLI EUCARIOTI NEGLI EUCARIOTI TRASCRIZIONE E TRADUZIONE SONO DUE EVENTI SEPARATI CHE AVVENGONO IN DUE DIVERSI COMPARTIMENTI CELLULARI: NUCLEO E CITOPLASMA. INOLTRE, A DIFFERENZA DEI

Dettagli

UNIVERSITÀ DEGLI STUDI DI MILANO. Bioinformatica. A.A semestre I. Allineamento veloce (euristiche)

UNIVERSITÀ DEGLI STUDI DI MILANO. Bioinformatica. A.A semestre I. Allineamento veloce (euristiche) Docente: Matteo Re UNIVERSITÀ DEGLI STUDI DI MILANO C.d.l. Informatica Bioinformatica A.A. 2013-2014 semestre I 3 Allineamento veloce (euristiche) Banche dati primarie e secondarie Esistono due categorie

Dettagli

DNA DNA DNA Legge di complementarietà delle basi Se in un filamento è presente una T nell altro filamento deve essere presente una A. Se è presente una C nell altro ci dovrà essere una G. E possibile

Dettagli

Acidi nucleici ed informazione genetica

Acidi nucleici ed informazione genetica cidi nucleici ed informazione genetica Flavia Frabetti ecnici di laboratorio 2010/2011 IDI NULEII DN acido desossiribonucleico RN acido ribonucleico nel DN sono codificate le istruzioni che programmano

Dettagli

Sommario. Presentazione dell opera Ringraziamenti

Sommario. Presentazione dell opera Ringraziamenti Sommario Presentazione dell opera Ringraziamenti XI XII Capitolo 1 Introduzione alla bioinformatica 1 1.1 Cenni introduttivi 1 1.2 Pietre miliari della bioinformatica 2 1.3 Infrastrutture bioinformatiche

Dettagli

Genomica, proteomica, genomica strutturale, banche dati.

Genomica, proteomica, genomica strutturale, banche dati. Genomica, proteomica, genomica strutturale, banche dati. Alcune pietre miliari della biologia anno risultato 1866 Mendel scopre i geni 1944 il DNA è il materiale genetico 1951 prima sequenza di una proteina

Dettagli

Le molecole di RNA possono assumere particolari strutture che conferiscono loro particolari funzioni.

Le molecole di RNA possono assumere particolari strutture che conferiscono loro particolari funzioni. Traduzione: t-rna Le molecole di RNA possono assumere particolari strutture che conferiscono loro particolari funzioni. Singola catena alta flessibilità ripiegamento su stessa legami deboli con se stessa

Dettagli

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina

Sequenze nucleotidiche del DNA definite loci costituiscono i geni. Ogni gene codifica per una specifica proteina sintesi proteica La sintesi proteica è il processo che porta alla formazione delle proteine da sequenze del DN definite geni. Si tratta di un processo a più fasi Nelle sue linee fondamentali questo processo

Dettagli

Relazione DNA. Giulia Carbonara classe 3 A

Relazione DNA. Giulia Carbonara classe 3 A Giulia Carbonara classe 3 A Relazione DNA Il DNA (la sigla dell'acido desossiribonucleico ) è una macromolecola biologica sede delle informazioni genetiche e dell'unicità di un organismo che appartiene

Dettagli

Allineamenti a coppie

Allineamenti a coppie Laboratorio di Bioinformatica I Allineamenti a coppie Dott. Sergio Marin Vargas (2014 / 2015) ExPASy Bioinformatics Resource Portal (SIB) http://www.expasy.org/ Il sito http://myhits.isb-sib.ch/cgi-bin/dotlet

Dettagli

Corso di Genetica -Lezione 12- Cenci

Corso di Genetica -Lezione 12- Cenci Corso di Genetica -Lezione 12- Cenci Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza

Dettagli

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA

STRUTTURE DEGLI ACIDI NUCLEICI, CODICE GENETICO E REPLICAZIONE DEL DNA IL LABORATORIO DI BIOLOGIA MOLECOLARE: Introduzione alle tecniche e alle loro applicazioni STRUTTURE DEGLI ACIDI NUCLEICI, Il DNA nell arte: Susan Rankaitis 2002, DNA2 CODICE GENETICO E REPLICAZIONE DEL

Dettagli

Acidi nucleici basi puriniche basi pirimidiniche

Acidi nucleici basi puriniche basi pirimidiniche basi puriniche basi pirimidiniche La sequenza dei nucleotidi in una catena di acido nucleico viene descritta partendo dall estremità 5 e identifica l ordine di successione delle basi utilizzando le abbreviazioni

Dettagli

1) Un gene-un enzima 2) Un gene- una catena polipeptidica

1) Un gene-un enzima 2) Un gene- una catena polipeptidica 1) Un gene-un enzima 2) Un gene- una catena polipeptidica 3) Un gene è una unità funzionale di DNA che codifica per la sequenza amminoacidica di uno o più polipeptidi o alternativamente per uno o più tipi

Dettagli

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Basi di dati biologiche

Basi di dati biologiche Basi di dati biologiche Seminario per il corso di Basi di Dati II Luana Rinaldi luana.rinaldi@gmail.com AGENDA: Introduzione alla bioinformatica; Concetti Biologici; Banche dati biologiche; Collaborazioni

Dettagli

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene

LA TRASCRIZIONE. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene LA TRASCRIZIONE Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Giovanna Attene GLI ACIDI RIBONUCLEICI Nelle cellule nucleate la sintesi proteica avviene nel citoplasma, mentre il DNA si

Dettagli

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido

Nel codice genetico, una tripletta di nucleotidi codifica per un aminoacido Il codice genetico: Come triplette dei quattro nucleotidi specificano 20 aminoacidi, rendendo possibile la traduzione dell informazione da catena nucleotidica a sequenza di aminoacidi. Come le mutazioni

Dettagli

Concetti Biologici basilari Per approfondire (in inglese)

Concetti Biologici basilari Per approfondire  (in inglese) Le prossime lezioni saranno incentrate sulla struttura delle principali macromolecole della cellula (DNA, RNA e proteine) e sul processo di traduzione della sequenza di DNA in proteine. Lo scopo è quello

Dettagli

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè

CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE. Dott.ssa A. Fiarè CORSO DI LAUREA IN SCIENZE DELLA FORMAZIONE PRIMARIA LEZIONE PRIMA PARTE Dott.ssa A. Fiarè IL DNA (ACIDO DESOSSIRIBONUCLEICO) E UN ACIDO NUCLEICO DEFINITO POLINUCLEOTIDE, IN QUANTO E UNA MOLECOLA FORMATA

Dettagli

Basi Teoriche e Applicazioni delle Nuove Tecnologie Genomiche

Basi Teoriche e Applicazioni delle Nuove Tecnologie Genomiche Corsi di laurea magistrale in: Biotecnologie agrarie e ambientali (LM-7) Biologia cellulare e molecolare (LM-6) Sicurezza e qualitàagroalimentare (LM-69 & LM-70) insegnamento di Basi Teoriche e Applicazioni

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Gli acidi nucleici, DNA (acido deossiribonucleico) e RNA (acido. ribonucleico), sono polimeri biologicamente importanti in quanto

Gli acidi nucleici, DNA (acido deossiribonucleico) e RNA (acido. ribonucleico), sono polimeri biologicamente importanti in quanto Gli acidi nucleici, DA (acido deossiribonucleico) e RA (acido ribonucleico), sono polimeri biologicamente importanti in quanto svolgono ruoli fondamentali nell ereditarietà e nella sintesi proteica. Sono

Dettagli

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione

Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione Espressione ed utilizzo della informazione genetica II Trascrizione e Traduzione CdL Tecnici di Lab Biomedico AA. 2011-12 - Prof.ssa Frabetti Come si esprime l informazione? Per i geni classici vedremo:

Dettagli

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA...

Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE DEL DNA... ACIDI NUCLEICI...2 FUNZIONI DEL DNA...5 FUNZIONI DELL RNA...5 I NUCLEOTIDI...6 Struttura dei nucleotidi...6 Modello di Watson e Crick...10 Organizzazione strutturale superiore del DNA...13 DUPLICAZIONE

Dettagli

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà

Bioinformatica (3) Banche dati biologiche. Dott. Alessandro Laganà Bioinformatica (3) Banche dati biologiche Dott. Alessandro Laganà Banche dati biologiche Organismi e sequenze biologiche Rappresentazione digitale dei dati biologici e formati Banche dati generiche: NCBI,

Dettagli

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia

Il flusso e la regolazione dell informazione genica. Lezione nr. 8 Psicobiologia Il flusso e la regolazione dell informazione genica Lezione nr. 8 Psicobiologia L informazione che viene trascritta non riguarda tutto il DNA ma solo delle particolari sequenze definite GENI. Tipologie

Dettagli

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE:

GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi 8. Funzionamento dei genomi Il genoma dei procarioti Modificazioni della cromatina e l espressione del Il genoma degli eucarioti genoma

Dettagli

Codice Genetico (segue) 29/10/2014 CODICE GENETICO

Codice Genetico (segue) 29/10/2014 CODICE GENETICO CODICE GENETICO Codice mediante il quale la sequenza nucleotidica di una molecola di DNA o di RNA specifica la sequenza amminoacidica di un polipeptide. CODICE GENETICO Consiste di codoni a tre nucleotidi

Dettagli

Lezione 1. Le molecole di base che costituiscono la vita

Lezione 1. Le molecole di base che costituiscono la vita Lezione 1 Le molecole di base che costituiscono la vita Le molecole dell ereditarietà 5 3 L informazione ereditaria di tutti gli organismi viventi, con l eccezione di alcuni virus, è a carico della molecola

Dettagli

Codice genetico CODICE GENETICO [1]

Codice genetico CODICE GENETICO [1] Codice genetico CODICE GENETICO [1] Codice mediante il quale la sequenza nucleotidica di una molecola di DNA, tramite un mrna, specifica la sequenza amminoacidica di un polipeptide. Consiste di codoni

Dettagli

RELAZIONE di BIOLOGIA MOLECOLARE

RELAZIONE di BIOLOGIA MOLECOLARE NOME: Marini Selena MATRICOLA: 592330 RELAZIONE di BIOLOGIA MOLECOLARE CHE ORGANISMO MODELLO È DICTYOSTELIUM? CHE RISORSE BIOINFORMATICHE AGEVOLANO I RICERCATORI CHE LO STUDIANO? Dictyostelium è un genere

Dettagli

Allineamento dei 2 RNA

Allineamento dei 2 RNA La traduzione 2 codone Allineamento dei 2 RNA anticodone Studi Molecolari hanno dimostrato che: 3 residui nucleotidici del mrna sono necessari per codificare ciascun amminoacido Il linguaggio contenuto

Dettagli

Il DNA, acido desossiribonucleico, è la molecola che

Il DNA, acido desossiribonucleico, è la molecola che Il DNA, acido desossiribonucleico, è la molecola che contiene le informazioni necessarie per il funzionamento di ogni essere vivente: le informazioni genetiche, che ciascuno di noi eredita dai propri genitori.

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT2. POMERIGGIO DI AGGIORNAMENTO PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT2 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 IL MATERIALE GENETICO 2 2 Per svolgere il proprio ruolo, il materiale genetico

Dettagli