LAVORI ORIGINALI/ORIGINAL ARTICLES

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "LAVORI ORIGINALI/ORIGINAL ARTICLES"

Transcript

1 170 GIMMOC Vol. VIII N 3, 2004 Giornale Italiano di Microbiologia Medica Odontoiatrica e Clinica Vol. VIII, N 3, 2004 p Organo ufficiale della S.I.M.M.O.C. Copyright 2004 Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles M. Corrente 1, M. Totaro 1, G. Greco 1, E. Tarsitano 1, A. Madio 1, K.G. Friedrich 2, M. Campolo 1, C. Buonavoglia 1 *Autore di riferimento: M. Corrente Riassunto: Nel presente studio 22 ceppi di Salmonella del Giardino Zoologico (Bioparco) di Roma e di proprietà privata sono stati sierotipizzati e testati per la sensibilità a 15 antibiotici. Inoltre sono stati ricercati mediante PCR i geni di patogenicità fim, inva e spvc e i geni che codificano per le integrasi (int 1, 2, 3 e 4). Diciassette sierotipi sono risultati appartenere a Salmonella enterica subspecie enterica e 4 ceppi alla sottospecie IIIa, mentre 1 ceppo è risultato non tipizzabile. Diciotto ceppi sono risultati resistenti a 2 o più antibiotici. In particolare, la maggior parte dei ceppi è risultata resistente al sulfametossazolo (21 su 22) alla streptomicina (14) e alla colistina solfato (11). Per quanto concerne la PCR, è stato evidenziato che tutti i ceppi erano in possesso dei geni fim e inva e 3 ceppi, appartenenti a Salmonella subsp. IIIa, del gene spvc. Inoltre 11 ceppi sono risultati positivi per int 1, 2 stipiti per int 2, nessun ceppo per int 3 e 4. La presenza di caratteri di patogenicità nei ceppi analizzati conferma la potenzialità dei rettili a trasmettere l infezione all uomo e ribadisce la necessità di una corretta informazione sulle norme igieniche da osservare durante la manipolazione di tali animali. Inoltre la diffusione di elementi di antibiotico-resistenza sottolinea che il trattamento antibiotico degli animali, che raramente dà la sterilizzazione batteriologica, è da considerarsi dannoso. Summary: In this survey 22 Salmonella strains isolated from reptiles housed in the Bioparco in Rome or belonging to private owners were serotyped and tested for susceptibility to 15 antimicrobials. Pathogenicity and antimicrobial resistance genes such as fim, inva, spvc and int 1, 2 3 and 4 were investigated by PCR. Seventeen Salmonella enterica subsp. enterica and 4 serotypes Salmonella subsp. IIIa were found. One strain was untypeable. Eighteen strains were found to be resistant to two or more antimicrobials. Most strains were resistant to sulfamethoxazole (21 out 22 strains) to streptomycin (14) and to colistin sulfate (11). The genes fim and inv A were found in all the strains, while 3 strains were positive to the PCR for the gene spvc. Eleven strains were shown to possess int 1 gene, and 2 strains int 2. Int 3 and 4 were not found. The presence of pathogenicity genes highlights that the strains isolated from reptiles are able to transmit the infection to humans. Furthermore, as some characters of antimicrobial resistance are diffused among those strains, antibiotic treatment of Salmonella carriers should be avoided and good hygiene practices during animal handling should be recommended. INTRODUZIONE La salmonellosi è considerata uno dei più importanti problemi di salute pubblica. L uomo si infetta principalmente attraverso il consumo di alimenti di origine animale [Turnbull, 1979]; tuttavia, il contatto con i rettili sta assumendo un peso crescente nel determinismo dell infezione, in relazione alla loro diffusione come animali da compagnia [Woodward et al, 1997; Willis et al, 2002]. Gli animali a sangue freddo sono infatti reservoirs di diversi sierotipi di salmonelle [Chiodini e Sundberg, 1981]. Negli ultimi anni numerosi casi di salmonellosi correlati alla presenza di rettili nelle abitazioni dei pazienti, o legati al contatto con proprietari di rettili, sono stati segnalati dal Centers for Disease Control [CDC 1992a, 1992b, 1999, 2003]. Nei rettili allevati in cattività è molto frequente l isolamento di S. enterica subspecie enterica (I), che annovera i sierotipi più frequentemente isolati in corso di salmonellosi nell uomo [Geue e Lor- 1 Dipartimento di Sanità e Benessere animale, Facoltà di Medicina Veterinaria, Università di Bari. 2 Servizio Veterinario del Bioparco, Roma.

2 GIMMOC Vol. VIII N 3, schner, 2002]. Tuttavia, anche altri stipiti e appartenenti a S. bongori e S. enterica subsp. IIIa e IIIb, sono stati messi in relazione con episodi di malattia nell uomo [Pignato et al, 1998]. Nei rettili le salmonelle non sembrano avere un ruolo patogeno primario; solo in animali in cattive condizioni di salute possono provocare malattia, alla stregua di altri enterobatteri presenti nell intestino [Chiodini e Sundberg, 1981]. Per converso, i casi segnalati nell uomo evidenziano che i ceppi isolati dai rettili possono conservare le caratteristiche di patogenicità. Studi condotti su animali da laboratorio hanno dimostrato infatti che alcuni ceppi isolati da coccodrilli sono dotati di proprietà invasive [Madsen et al, 1998]. Queste caratteristiche sarebbero conferite da alcuni geni, organizzati nelle cosiddette isole di patogenicità delle salmonelle (SPI) [Bäumler et al, 1998]. Negli stadi iniziali dell infezione sono importanti i geni che codificano per le fimbrie, che promuovono l adesione dei batteri alla mucosa intestinale [Bäumler et al, 1998]. Tra questi si annovera il gene fim, che produce fimbrie di I tipo, racchiuso nella SPI 1. La capacità di dare infezione sistemica negli animali a sangue caldo è dovuta invece ad altri geni, come inva, appartenente alla SPI 1, che promuove l internalizzazione delle salmonelle nelle cellule e ai geni della SPI 2, tra cui spv (plasmide di virulenza in salmonella) [Bäumler, 1997]. Nel quadro evolutivo degli enterobatteri l acquisizione di tali geni si sarebbe verificata relativamente di recente, consentendo la diversificazione delle salmonelle da altri enterobatteri a partire da un progenitore comune. In particolare, l acquisizione della SPI 1 avrebbe causato la divergenza tra Salmonella bongori, che è considerata la specie ancestrale delle salmonelle, e Escherichia coli. In una seconda fase, sarebbe comparsa la SPI 2 e con essa gli altri sierotipi di Salmonella. L analisi di questi geni riveste dunque un ruolo importante nello studio della filogenesi delle salmonelle [Bäumler et al, 1998]. Un altro aspetto importante riguarda la sensibilità agli antibiotici delle salmonelle isolate dai rettili. Nel tentativo di eliminare le salmonelle dall intestino, gli animali portatori possono essere trattati con antibiotici. Questa prassi, impiegata soprattutto in passato, potrebbe aver favorito l insorgenza di caratteri di antibiotico-resistenza [Johnson-Delaney, 1996]. Sono note infatti le capacità delle salmonelle di rispondere alla pressione selettiva degli antibiotici con la selezione di ceppi resistenti, e la facilità con cui questi batteri scambiano materiale genetico. Questa prerogativa, condivisa da altri batteri Gram negativi, è legata anche all esistenza di frammenti mobili del genoma, definiti integroni, specializzati nel veicolare caratteri di resistenza agli antibiotici. E stato stimato che questi segmenti possono contenere sino a 60 geni diversi che codificano per tali resistenze [Carattoli, 2001]. Sono state descritte 4 classi di integroni, ma i più diffusi sono gli integroni di classe 1 [Goldstein et al, 2001]. La presenza di questi geni è un indicatore della potenzialità delle salmonelle ad acquisire caratteri di antibiotico-resistenza, soprattutto in virtù della loro permanenza nell intestino dei rettili come flora saprofitica. Sulla scorta di queste considerazioni, alcuni sierotipi di Salmonella spp. isolati da diverse specie di rettili allevati presso un giardino zoologico e di proprietà privata sono stati analizzati per quanto concerne alcuni caratteri di patogenicità. I ceppi sono stati inoltre saggiati per la sensibilità in vitro ad alcuni antibiotici e per la presenza di geni relativi agli integroni. MATERIALI E METODI Ceppi: Sono stati esaminati 18 ceppi isolati da diverse specie di rettili del Giardino Zoologico di Roma (Bioparco) e 4 stipiti appartenenti a privati (Tabella I). L isolamento è stato effettuato dalle feci utilizzando il protocollo standard per l isolamento di salmonelle da matrici alimentari [ISO 6579, Anon 1993] con qualche modifica [Corrente et al, 2004]. I ceppi sono stati Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles

3 172 GIMMOC Vol. VIII N 3, 2004 Corrente et al. Tabella I Sierotipi di Salmonella, resistotipi e analisi mediante PCR di geni di patogenicità e antibiotico-resistenza Campione Animale Provenienza Sierotipo Resistotipo PCR fim inv A Spv C Int 1 Int 2 Int 3 Int /02 Serpente del grano Bioparco S. Newport Cs Smx a 59/02 Camaleonte S. Muenster Amp C Cs Kf S Smx Te /02 Camaleonte S. Senftenberg Cs S Smx Te /02 Camaleonte S. Gaminara Amp C Cs S Smx Te a 67/02 Pitone S. Aqua Smx b 67/02 Tartaruga S. Senftenberg Smx /02 Lucertola S. Senftenberg S Smx /02 Basilisco S. Senftenberg S Smx /02 Cervone S. Newport Smx a 72/02 Lucertola ocellata S. Give S Na Smx b 72/02 Tartaruga S. Poona Cs Na Smx Sxt a 72/02 Eloderma sospetto S. subsp. IIIa (O 48) Na S Smx /02 Varano del Nilo S. Senftenberg Cs a 72/02 Tartaruga S. subsp. IIIa (O 48 ) S Smx Sxt a 72/02 Camaleonte S. Gbadago S Smx a 101/02 Lucertola S. Minnesota Amp Na Smx Te b 101/02 Lucertola ocellata S. Minnesota Amp Cs Na Smx Te /02 Camaleonte S. Oldenburg Amp C Cs S Smx Te /03 Iguana Privato S. subsp. IIIa (O 17 ) S Smx /03 Iguana Non tipizzabile Cs Na S Smx /02 Lucertola S. Havana Cs Na S Smx /02 Pitone S. subsp. IIIa RF Cs S Smx Antibiotici saggiati: Acido nalidixico (Na), ampicillina (Amp), amoxicillina+ clavulanico (Aug), cefalotina (Kf), ceftazidime (Caz), ciprofloxacin (Cip), cloramfenicolo (C), colistina solfato (Cs), cotrimossazolo (Sxt), gentamicina (Gn), neomicina (N), norfloxacin (Nor), streptomicina (S), sulfametossazolo (Smx), tetraciclina (Te).

4 GIMMOC Vol. VIII N 3, quindi identificati con il sistema api 20E (Biomérieux, Mercy l Etoile, Francia), mediante agglutinazione rapida su vetrino con sieri polivalenti O e H ( Biotech Laboratories, Ipswich Suffolk, UK) e tipizzati con lo schema di Kauffmann- White [Zavanella 2001], presso l Istituto Zooprofilattico di Brescia. Ceppi di referenza: per standardizzare le tecniche sono stati utilizzati 2 ceppi ATCC: S. typhimurium e S. arizonae 13314, acquistati presso la Biogenetics (Padova). Prove di sensibilità in vitro: i ceppi sono stati testati con la tecnica della diffusione in agar, seguendo le direttive del National Committee on Clinical Laboratory Standard [NCCLS 1999] per la sensibilità verso i seguenti antibiotici (concentrazione dei dischetti in µg, Liofilchem, Roseto degli Abruzzi, Te): acido nalidixico (30), ampicillina (10), amoxicillina +acido clavulanico (30), cefalotina (30), ceftazidime (30), ciprofloxacin (5), cloramfenicolo (30), colistina sulfato (10), co-trimossazolo (25), gentamicina (10), neomicina (30), norfloxacin (10), streptomicina (10), sulfametossazolo (50), tetraciclina (30). Estrazione del DNA: I ceppi sono stati seminati in Brain Heart Infusion (Oxoid, Milano) e incubati overnight a 37 C. Un millilitro di brodocoltura di ciascun ceppo è stato sottoposto al protocollo di estrazione del kit QIAmp Tissue (QIAGEN GmbH, Germania). Pcr: Le tecniche di PCR sono state effettuate utilizzando il DNA Thermal Cycler Gene Amp 9600 (Perkin Elmer Cetus, Norwalk, CT, USA). I campioni sono stati saggiati con i primers indicati nella tabella II [Cohen et al, 1996; Khan et al, 2000; Goldstein et al, 2001]. Cinque microlitri di DNA di ogni campione sono Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles Tabella II Primers utilizzati nelle reazioni di PCR. Primers Sequenza Temperatura di Riferimento (Forward e Reverse) annealing ( C) bibliografico Fim Inv A Spv C Int 1 Int 2 Int 3 Int 4 F:CCTTTCTCCATCGTCCTG R: TGGTGTTATCTGCCTGACCA 58 Cohen et al. (1996) F: CGCGGCCCGATTTTCTCTGGA R:AATGCGGGGATCTGGGCGACAAG 67 Khan et al F:GGGGCGGAAATACCATCTACA R:GCGCCCAGGCTAACACG 60 Khan et al F:CCTCCCGCACGATGATC R:TCCACGCATCGTCAGGC 65 Goldstein et al F.TTATTGCTGGGATTAGGC R:ACGGCTACCCTCTGTTATC 60 Goldstein et al F:AGTGGGTGGCGAATGAGTG R:TGTTCTTGTATCGGCAGGTG 60 Goldstein et al F:CGGTATGTCTAATTGCTCTTG R: TGGCCACAAAGACTCAATCAC 60 Goldstein et al. 2001

5 174 GIMMOC Vol. VIII N 3, 2004 Corrente et al. stati aggiunti alla miscela di reazione così costituita: PCR buffer (10X), 1.5 mm Mg Cl 2, 200 µm di ogni nucleotide trifosfato, 0.1 mm di ogni primer, 2.5 U di Amplitaq Gold Polymerase (Perkin Elmer Cetus Norwalk, USA) e H 2 O distillata sino a raggiungere un volume finale di 50 µl. Le miscele di reazione sono state sottoposte a 1 ciclo iniziale di denaturazione a 94 C per 8 minuti, seguite da 35 cicli di amplificazione, ciascuno di 1 minuto di denaturazione a 94 C, 1 minuto di annealing, a temperature diverse per ogni coppia di primers ( tabella II), 2 minuti di estensione a 72 C, 1 ciclo finale di 8 minuti a 72 C. I prodotti di PCR sono stati visualizzati mediante corsa elettroforetica su gel di agarosio al 2 % colorato con etidio bromuro, con l ausilio del CHEMIDOC (Bio-rad, Milano). RISULTATI I risultati sono riassunti nella tabella I. La sierotipizzazione ha messo in evidenza 21 stipiti appartenenti alla specie S. enterica, di cui 17 appartenenti a S. enterica subspecie I e 4 a S. enterica subspecie IIIa. La tipizzazione non è stata possibile per 1 ceppo, isolato da un iguana. Le prove di sensibilità in vitro hanno permesso di evidenziare la resistenza ad alcuni antibiotici nei sierotipi di Salmonella saggiati. La maggior parte dei ceppi è risultata resistente al sulfametossazolo (21 su 22 ceppi), alla streptomicina (14) alla colistina solfato (11). Sette ceppi sono risultati resistenti all acido nalidixico, 6 alla tetraciclina, 5 all ampicillina, 3 al cloramfenicolo e 2 al cotrimossazolo. Solo 1 stipite è risultato resistente alla cefalotina. Per converso, nessuno dei ceppi è risultato resistente a norfloxacin, ciprofloxacin, amoxicillina +clavulanico, ceftazidime, gentamicina, neomicina. Secondo la definizione adottata da Dargatz et al [2003], 18 ceppi sono risultati multiresistenti, cioè resistenti a due o più antibiotici. In particolare 9 ceppi sono risultati resistenti a 4 o più antibiotici. Per quanto concerne l analisi dei caratteri di patogenicità, tutti i ceppi saggiati sono risultati positivi alla PCR per i geni fim e inva, mentre in 3 ceppi appartenenti a Salmonella subsp. III A, è stato messo in evidenza il gene spvc. Le reazioni di amplificazione dei tratti relativi alle integrasi hanno dato i seguenti risultati: 11 ceppi sono risultati positivi per il frammento int 1 e 2 ceppi positivi per int 2. Nessun campione è risultato positivo alla PCR per i frammenti int 3 e int 4. DISCUSSIONE Precedenti indagini svolte in USA e in Europa hanno messo in evidenza che l isolamento di salmonelle dai rettili è molto frequente [Johnson-Delaney, 1996; Pasmans et al. 2000; Geue and Lorschner 2002; Pasmans et al. 2002]. In una recente indagine effettuata sugli animali del rettilario del Bioparco di Roma è stata riscontrata una prevalenza del 50.5% [Corrente et al, 2004]. La sierotipizzazione dei ceppi analizzati nel presente studio ha messo in evidenza che non sempre i rettili albergano sierotipi esotici, soprattutto se mantenuti in cattività. Inoltre in alcuni animali è stato isolato S. Senfentberg, un sierotipo particolarmente termoresistente [Murphy et al, 1999]. A tale proposito, occorre ricordare che si sono verificati casi di salmonellosi anche in individui che non avevano avuto un contatto diretto con il rettile portatore. Nel 1996, durante una esibizione a scopo didattico in uno zoo, un rettile utilizzato per un esibizione ha trasmesso la salmonellosi a 39 bambini, sebbene nessuno di questi avesse toccato l animale [Friedman et al. 1998]. Nel tentativo di spiegare come mai le salmonelle non siano patogene per i rettili, alcuni autori hanno sottolineato che questi animali hanno un sistema immunitario più rudimentale rispetto agli animali a sangue caldo. In particolare, l assenza di stazioni linfatiche periferiche organizzate come le placche del Peyer, o di linfonodi veri e propri, innescherebbe una sorta di tolleranza del sistema immunitario verso gli stimoli antigenici a livello intestinale, consentendo alle salmonelle di diventare batteri commensali [Bäumler et al, 1998]. Tuttavia, è stato evidenziato anche nella nostra in-

6 GIMMOC Vol. VIII N 3, dagine che a fronte della varietà di sierotipi isolati, un denominatore comune di tali ceppi è la presenza di geni che codificano per alcuni caratteri di patogenicità. Come in altri studi, il gene spvc è stato evidenziato solo nei sierotipi di Salmonella subsp. IIIa, mentre i geni inva e fim si sono dimostrati ubiquitari [Chiu e Jonathan, 1996; Hudson et al, 2000; Khan et al, 2000]. La presenza di tali geni ribadisce la necessità di considerare questi animali come potenziale fonte di salmonellosi. Inquadrate in tale ottica, appaiono pienamente giustificate le raccomandazioni dei CDC, che consiglia di adottare norme igieniche scrupolose durante la manipolazione di tali animali, e invita a non entrare in possesso di rettili se in casa ci sono bambini di età inferiore a 5 anni, anziani o individui immunocompromessi [CDC 2003]. Infatti in queste categorie la salmonellosi provocata da rettili può essere letale [Weinstein et al, 1995]. Presso il Bioparco è in atto dal 1998 un programma di prevenzione che, per ridurre il rischio d infezione da Salmonella, preconizza il controllo sanitario del personale e degli animali, una procedura dettagliata da seguire durante la manipolazione dei rettili, e il divieto d impiego di tali animali nell ambito di attività didattiche (Friedrich et al, 2000). I ceppi isolati hanno mostrato un elevata percentuale di antibiotico-resistenza, non soltanto verso i presidi terapeutici che di solito sono utilizzati in queste specie animali. E interessante notare che molti ceppi sono risultati multiresistenti, con pattern di resistenza parzialmente sovrapponibili a quelli dei ceppi isolati dall uomo in Europa [Threlfall et al, 1998], facendo ipotizzare che la coabitazione con l uomo o con altre specie animali può favorire lo scambio di ceppi. Inoltre è stata messa in evidenza la presenza di geni relativi agli integroni anche in ceppi che non esprimevano un fenotipo antibiotico-resistente. In particolare molti ceppi veicolavano il gene Int 1, relativo agli integroni di classe 1. Questo frammento mobile, che veicola tra gli altri i geni per la resistenza ai sulfamidici e ad alcuni disinfettanti, risulta essere largamente diffuso nei Gram negativi [Guerra et al 2000; Goldstein et al 2001]. Nel genere Salmonella, come in altri Enterobatteri, i meccanismi di trasferimento genetico intra e inter specifico sono molto frequenti. Gli integroni, saltando da un batterio all altro causano la resistenza multipla, fenomeno caratterizzato dalla comparsa di resistenze verso diversi antibiotici, non necessariamente utilizzati nella terapia o nella chemioprofilassi [Carattoli, 2001]. La somministrazione di antibiotici a scopo profilattico è da considerarsi inutile per diversi motivi: i) è raro ottenere la sterilizzazione batteriologica dei soggetti [Johnson-Delaney, 1996]; ii) essendo i rettili eliminatori intermittenti, risulta difficile evidenziare tramite l esame batteriologico se c è stata l effettiva eliminazione di tali germi dall intestino; iii) la potenzialità dei ceppi di Salmonella ad acquisire caratteri di antibiotico-resistenza fa ritenere che questi trattamenti sono non solo inutili ma anche dannosi. Per minimizzare il rischio di trasmissione di salmonelle dai rettili all uomo, i medici veterinari devono: a) formare in maniera adeguata il personale addetto alla manipolazione dei rettili; b) fornire una corretta informazione sui rischi sanitari ai proprietari privati; c) garantire l osservanza di norme di profilassi sanitaria (Bradley et al, 1998). BIBLIOGRAFIA Anon. ISO Microbiology-General guidance on methods for the Detection of Salmonella, 3 rd edn Case Postale 56, CH Genève 20, Switzerland Bäumler A.J. The record of horizontal gene transfer in Salmonella. Trends Microbiol., 5 (8): , Bäumler A.J., Tsolis R.M., Ficht T.A., Adams L.G. Evolution of Host Adaptation in Salmonella enterica. Infect. Immun., 66: , Bradley T., Angulo F.J., Raiti P. Association of reptilian and amphibian veterinarians guidelines for reducing risk of transmission of Salmonella spp. from reptiles to humans. J. Am. Vet. Med. Assoc., 213: 51-52, Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles

7 176 GIMMOC Vol. VIII N 3, 2004 Corrente et al. Carattoli A. Importance of integrons in the diffusion of resistance. Vet. Res Centers for Disease Control Iguana-associated salmonellosis. Morbid. Mortal. Weekly. Rep., 41: 38-39, 1992a. Centers for Disease Control Lizard-associated salmonellosis. Morbid. Mortal. Weekly. Rep., 41: , 1992b. Centers for Disease Control. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 48: , Centers for Disease Control. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 52: , Chiodini R.J., Sundberg J.P. Salmonellosis in reptiles: a review. Am. J. Epidemiol., 113: , Chiu C.-H., Jonathan T.O. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, inva and spvc, by an enrichment broth culture-multiplex PCR combination assay. J. Clin. Microbiol., 34 (10): , Cohen H.J., Mechanda S.M., Lin W. PCR amplification of the fima gene sequence of Salmonella typhimurium, a specific method for detection of Salmonella spp. Appl. Environ. Microbiol., 62 (12): , Corrente M., Madio A., Friedrich K.G., et al. Isolation of Salmonella strains from reptile faeces and comparison of different culture media. J. Appl. Microbiol., 96: , Dargatz D.A., Fedorka-Cray P.J., Ladely S.R., et al. Prevalence and antimicrobial susceptibility of Salmonella spp. isolates from US cattle in feedlots in 1999 and J. Appl. Microbiol., 95: , Friedman C.R., Torigian C., Shillam P.J., et al. An outbreak of salmonellosis among children attending a reptile exhibit at a zoo. J. Pediatr., 132: , Friedrich K.G., Magrini L., Puppini F. Rischi sanitari nei lavoratori dei Giardini Zoologici e Parchi Naturali. G. Med. Mil. 150: 1-6, Geue L., Löschner U. Salmonella enterica in reptiles of German and Austrian origin. Vet. Microbiol., 84: 79-91, Goldstein C., Lee M.D., Sanchez S., Hudson C., et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob. Agents Chemother., 45 (3): , Guerra B., Soto S., Cal S., Mendoza C. Antimicrobial resistance and spread of class 1 integrons among Salmonella serotypes. Antimicrob. Agents Chemother., 44 (8): , Hudson C.R., Quist C., Lee M.D., et al. Genetic relatedness of Salmonella isolates from nondomestic birds in Southeastern United States. J. Clin. Microbiol., 38 (5): , Johnson-Delaney C.A. Reptiles zoonoses and Threats to Public Health. In Reptile Medicine and Surgery ed. Mader, D.R. pp Philadelphia: WB Saunders Company Khan A.A., Nawaz M.S., Khan S.A., Cerniglia C.E. Detection of multidrug-resistant Salmonella Typhimurium DT104 by multiplex polymerase chain reaction. FEMS Microbiol. Lett., 182: , Madsen M., Hangartner P., West K., Kelly P. Recovery rates, serotypes and antimicrobial susceptibility patterns of salmonellae isolated from cloacal swabs of wild Nile crocodiles (Crocodylus niloticus) in Zimbabwe. J. Zoo Wildl. Med., 29: 31-34, Murphy R.Y., Marks B.P., Johnson E.R., Johnson M.G. Inactivation of Salmonella and Listeria in ground chicken breast meat during thermal processing. J. Food Prot., 62: , National Committee on Clinical Laboratory Standards (NCCLS) Performance Standards for Antimicrobial Susceptibility Tests for bacteria isolated from Animals. Approved standard. NC- CLS document M31-A. Wayne, P.A.: National Committee on Clinical Laboratory Standards Pasmans F., De Herdt P., Chasseur-Libotte M.L., Ballasina D. L. Ph., Haesebrouck F. Occurrence of Salmonella in tortoises in a rescue centre in Italy. Vet. Rec.,146: , Pasmans F., De Herdt P., Haesebrouck F. Presence of Salmonella infection in Freshwater turtles. Vet. Rec., 150: , Pignato S., Giammanco G., Santangelo C., Giammanco G.M. Endemic presence of Salmonella bongori 48: z35:- causing enteritis in children in Sicily. Res. Microbiol., 149: , Threlfall E.J., Fischer I.S.T., Berghold C., et al. Antimicrobial drug resistance in isolates of Salmonella enterica from cases of salmonellosis in humans in Europe: results of international multi-centre surveillance. Eurosurveillance. 8: 41-45, Weinstein J.W., Seltzer E.G., Nelson R.S. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 44: , Turnbull P.C.B. Food poisoning with special reference to Salmonella-its epidemiology, pathogenesis and control. Clin. Gastroenterol. 8: , Willis C., Wilson T., Greenwood M., Ward L. Pet reptiles associated with a case of salmonellosis in an infant were carrying multiple strains of Salmonella. J. Clin. Microbiol., 40: , Woodward D.L., Khakhria R., Johnson W.M. Human salmonellosis associated with exotic pets. J. Clin. Microbiol., 35: , Zavanella M. Schema di Kaufmann-White aggiornato. In Tipizzare le Salmonelle. pp Brescia (Italy): Fondazione iniziative Zooprofilattiche e Zootecniche

Polymerase Chain Reaction - PCR

Polymerase Chain Reaction - PCR Polymerase Chain Reaction - PCR Real-Time PCR Saggio Saggio di PCR monitorato di continuo Tubi Tubi chiusi Nessuna analisi post PCR Nessuna elettroforesi Caratterizzazione del prodotto Possibilità di quantificare

Dettagli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona

Dettagli

Aggiornamento relativo a recenti e prossime modifiche della norma ISO 6579

Aggiornamento relativo a recenti e prossime modifiche della norma ISO 6579 I Riunione ENTER-VET Legnaro, 17 dicembre 2014 Aggiornamento relativo a recenti e prossime modifiche della norma ISO 6579 Progressi nella revisione della ISO 6579 Microbiology of the food chain Horizontal

Dettagli

FATTORI DI VIRULENZA E ANTIBIOTICO-RESISTENZA IN CEPPI DI ENTEROCOCCUS FAECALIS DI ORIGINE CASEARIA

FATTORI DI VIRULENZA E ANTIBIOTICO-RESISTENZA IN CEPPI DI ENTEROCOCCUS FAECALIS DI ORIGINE CASEARIA FATTORI DI VIRULENZA E ANTIBIOTICO-RESISTENZA IN CEPPI DI ENTEROCOCCUS FAECALIS DI ORIGINE CASEARIA Tiziana SILVETTI 1 *, Stefano MORANDI 1, Milena BRASCA 1 RIASSUNTO - Enterococcus faecalis rappresenta

Dettagli

Metodiche tradizionali

Metodiche tradizionali Diagnostica microbiologica innovativa INTRODUZIONE Attualmente, per la rilevazione dei microrganismi patogeni accanto alle metodiche tradizionali rappresentate: dall esame colturale, l esame diretto al

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

Controllo e monitoraggio della sicurezza e qualità

Controllo e monitoraggio della sicurezza e qualità Strategie innovative rispondenti ai bisogni delle imprese nel comparto degli ortofrutticoli della IV gamma STAYFRESH Controllo e monitoraggio della sicurezza e qualità Chiara Gorni, Donatella Allemand,

Dettagli

Controllo e monitoraggio della sicurezza e qualità

Controllo e monitoraggio della sicurezza e qualità Strategie innovative rispondenti ai bisogni delle imprese nel comparto degli ortofrutticoli della IV gamma - STAYFRESH Controllo e monitoraggio della sicurezza e qualità Chiara Gorni, Donatella Allemand,

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

Campylobacter: ancora un patogeno emergente?

Campylobacter: ancora un patogeno emergente? Campylobacter: ancora un patogeno emergente? Ludovico DIPINETO Dipartimento di Medicina Veterinaria e Produzioni Animali Università degli Studi di Napoli Federico II Campylobacter Batteri appartenenti

Dettagli

Metodi di laboratorio nel controllo microbiologico degli alimenti: classici ed innovativi

Metodi di laboratorio nel controllo microbiologico degli alimenti: classici ed innovativi Metodi di laboratorio nel controllo microbiologico degli alimenti: classici ed innovativi Torino, 10-11 Giugno 2013 S.S. Laboratorio Controllo Alimenti fabio.zuccon@izsto.it 1 Aspetti normativi Cosa tratteremo

Dettagli

L ESPERIENZA DELLE REGIONE LAZIO NELLA GESTIONE DELLE INFEZIONI CORRELATE ALL ASSISTENZA. Antonio Silvestri Risk Manager

L ESPERIENZA DELLE REGIONE LAZIO NELLA GESTIONE DELLE INFEZIONI CORRELATE ALL ASSISTENZA. Antonio Silvestri Risk Manager L ESPERIENZA DELLE REGIONE LAZIO NELLA GESTIONE DELLE INFEZIONI CORRELATE ALL ASSISTENZA Antonio Silvestri Risk Manager 1982 I RAPPORTO ISTISAN 1982 Indagine conoscitiva sulle infezioni ospedaliere negli

Dettagli

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B Diagnosi e tipizzazione di IPD in biologia molecolare direttamente da campione clinico in pazienti con terapia antibiotica in atto Cristina Massai Clinica Pediatrica II Ospedale Meyer Università di Firenze

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE. Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino

I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE. Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino Sorveglianza delle malattie batteriche invasive Diagnosi di laboratorio

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Attuale spazio terapeutico per le cefalosporine orali in pediatria. N. Principi

Attuale spazio terapeutico per le cefalosporine orali in pediatria. N. Principi Attuale spazio terapeutico per le cefalosporine orali in pediatria N. Principi Attuale spazio terapeutico per le cefalosporine orali in pediatria Nicola Principi Principali cefalosporine orali Farmaco

Dettagli

Risultati dell 11 test inter-laboratorio (PT11) per l identificazione. e la tipizzazione di ceppi di Escherichia coli produttori di

Risultati dell 11 test inter-laboratorio (PT11) per l identificazione. e la tipizzazione di ceppi di Escherichia coli produttori di EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Risultati dell 11 test inter-laboratorio (PT11) per l

Dettagli

BOZZA INDICE 1. INTRODUZIONE... 3 2. PREPARAZIONE DEGLI INOCULI... 4 3. PREPARAZIONE DELLE UNITA DI PROVA E RACCOLTA... 4

BOZZA INDICE 1. INTRODUZIONE... 3 2. PREPARAZIONE DEGLI INOCULI... 4 3. PREPARAZIONE DELLE UNITA DI PROVA E RACCOLTA... 4 Determinazione dell attività sanificante del sistema SUNOX (Pure Health ) indotta dal TiO 2 su superfici contaminate da Listeria monocytogenes, Staphylococcus aureus e Pseudomonas aeruginosa. RELAZIONE

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

METROLOGIKA PRESENTAZIONE DEL SISTEMA. ML BIOTECH Via Preie 38, 10080 TORRE CANAVESE (TO) TEL. 0124 372220 www.mlbiotech.com www.metrologika.

METROLOGIKA PRESENTAZIONE DEL SISTEMA. ML BIOTECH Via Preie 38, 10080 TORRE CANAVESE (TO) TEL. 0124 372220 www.mlbiotech.com www.metrologika. METROLOGIKA PRESENTAZIONE DEL SISTEMA SOMMARIO PRESENTAZIONE DEL SISTEMA METROLOGIKA - Introduzione - Il carico socio economico delle infezioni ospedaliere - Stime dei tassi di infezioni (ICA) correlate

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

Tecniche per la valutazione della attività in vitro degli antibiotici: Antibiogramma

Tecniche per la valutazione della attività in vitro degli antibiotici: Antibiogramma C.L. Medicina e Chirurgia Università di Chieti-Pescara Anno Accademico 2015-2016 Tecniche per la valutazione della attività in vitro degli antibiotici: Antibiogramma Giovanni DI BONAVENTURA, PhD Dipartimento

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo

Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo EPATITE B: DIAGNOSI. Il Laboratorio GA Niro, A Andriulli Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo La descrizione del meccanismo replicativo del virus

Dettagli

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO

SERVIZIO DI SEQUENZIAMENTO AUTOMATICO REPARTO GENOMICA LABORATORIO ANALISI GENOMICHE SERVIZIO DI SEQUENZIAMENTO AUTOMATICO DOCUMENTO ILLUSTRATIVO DEL SERVIZIO DI SEQUENZIAMENTO ACIDI NUCLEICI ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA LOMBARDIA

Dettagli

Indagine sulla diffusione delle nuove varianti del parvovirus canino tipo 2 in Abruzzo

Indagine sulla diffusione delle nuove varianti del parvovirus canino tipo 2 in Abruzzo Indagine sulla diffusione delle nuove varianti del parvovirus canino tipo 2 in Abruzzo RIASSUNTO Obiettivi - In questo studio vengono riportati i risultati delle indagini diagnostiche condotte in cani

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

Allegato 1 Controllo delle infezioni correlate all assistenza: proposta di attività in Toscana per il biennio 2015 2016

Allegato 1 Controllo delle infezioni correlate all assistenza: proposta di attività in Toscana per il biennio 2015 2016 Allegato 1 Controllo delle infezioni correlate all assistenza: proposta di attività in Toscana per il biennio 2015 2016 a cura del 'Comitato di coordinamento regionale per la prevenzione e la lotta alle

Dettagli

Ricerca Corrente anno finanziario 2007

Ricerca Corrente anno finanziario 2007 Ricerca Corrente anno finanziario 2007 Gestione del rischio biologico nell allevamento equino: elaborazione di linee guida per la prevenzione ed il controllo delle infezioni diffusive Responsabile Scientifico:

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti

Dettagli

Biolife Italiana S.r.l.

Biolife Italiana S.r.l. N 401605-13 B I-13 04-2010 Pagina 1 di 5 ALOA AGAR LISTERIA ACC. TO OTTAVIANI & AGOSTI ALOA ENRICHMENT-SELECTIVE SUPPLEMENTS Terreno in polvere, supplemento selettivo, arricchimento e piastre pronte all

Dettagli

Presentazione. Infezioni correlate all assistenza sanitaria (I.C.A.)

Presentazione. Infezioni correlate all assistenza sanitaria (I.C.A.) Presentazione Infezioni correlate all assistenza sanitaria e resistenza antimicrobica costituiscono due speciali problematiche sanitarie sulle quali importanti istituzioni internazionali, quali l OMS,

Dettagli

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico

immagine Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello Materiale Didattico Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Metodologie e applicazioni della biologia molecolare e cellulare Dott.ssa Giorgia Borriello

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).

Dettagli

Gruppo Fides. Dr Giuliano Grillo

Gruppo Fides. Dr Giuliano Grillo Gruppo Fides Dr Giuliano Grillo Medio di assistenza medica, infermieristica e riabilitativa Alto di assistenza tutelare e alberghiera Completamento cicli riabilitativi Trattamenti socio sanitari di mantenimento

Dettagli

Un confronto IMPARI. Le ICA. Una sfida in era di patogeni Multi-Drug-Resistant. Cianobatteri: 3.500.000.000 anni ni. Homo sapiens: < 200.

Un confronto IMPARI. Le ICA. Una sfida in era di patogeni Multi-Drug-Resistant. Cianobatteri: 3.500.000.000 anni ni. Homo sapiens: < 200. 18 settembre 2015 Le ICA. Una sfida in era di patogeni Multi-Drug-Resistant Matteo Un confronto IMPARI Cianobatteri: 3.500.000.000 anni ni Homo sapiens: < 200.000 anni Antibiotici: 85 anni Chi siamo noi?

Dettagli

Aspetti microbiologici della sorveglianza nazionale della malattia invasiva da H. Influenzae

Aspetti microbiologici della sorveglianza nazionale della malattia invasiva da H. Influenzae Roma, 26-27 Novembre 2014 Roma, 28-29 Febbraio 2012 Aspetti microbiologici della sorveglianza nazionale della malattia invasiva da H. Influenzae MARINA CERQUETTI Marina Cerquetti Dipartimento di Malattie

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona

Dettagli

ATI POZZALI FRATELLI SCHEDE TECNICHE INTERVENTI CONCLUSI

ATI POZZALI FRATELLI SCHEDE TECNICHE INTERVENTI CONCLUSI SCHEDE TECNICHE INTERVENTI CONCLUSI ATI POZZALI FRATELLI - POZZALI FRATELLI Srl Casaletto Ceredano CR - STELLA BIANCA Spa Ossago Lodigiano LO - MOLINO BRESCIANO Snc Azzano Mella BS - CRAM-BIOLAB Srl Brescia

Dettagli

Aspetti analitici nel Controllo ambientale di Legionella. D.ssa Leonarda Chetti Arpa Sezione di Bologna

Aspetti analitici nel Controllo ambientale di Legionella. D.ssa Leonarda Chetti Arpa Sezione di Bologna Aspetti analitici nel Controllo ambientale di Legionella D.ssa Leonarda Chetti Arpa Sezione di Bologna Procedure analitiche La ricerca di Legionella è tecnicamente difficile. Richiede Laboratori specialistici

Dettagli

La sfida di salute pubblica per la Salmonella non tifoidea antibiotico-resistente

La sfida di salute pubblica per la Salmonella non tifoidea antibiotico-resistente Tauxe #11 La sfida di salute pubblica per la Salmonella non tifoidea antibiotico-resistente Robert V Tauxe, M.D., M.P.H. Centers for Disease Control and Prevention, Atlanta, GA March 29, 2006 ISS, Roma

Dettagli

Piano nazionale di controllo di Salmonella Enteritidis e Typhimurium nei polli da carne della specie Gallus gallus anno 2013

Piano nazionale di controllo di Salmonella Enteritidis e Typhimurium nei polli da carne della specie Gallus gallus anno 2013 Piano nazionale di controllo di Salmonella Enteritidis e Typhimurium nei polli da carne della specie Gallus gallus 2013 Approvato con Decisione 2012/761/UE 1 PARTE A DESCRIZIONE DEL PROGRAMMA E OBIETTIVI

Dettagli

RD-100i. OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario

RD-100i. OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario RD-1i OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario RD-1i OSNA la nuova generazione nell analisi del linfonodo sentinella nel carcinoma mammario La biopsia del

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

ASL 1 - Torino Corso teorico-pratico Parliamo ancora di vaccini Il vaccino per lo pneumococco: il punto di vista dell igienista

ASL 1 - Torino Corso teorico-pratico Parliamo ancora di vaccini Il vaccino per lo pneumococco: il punto di vista dell igienista ASL 1 - Torino Corso teorico-pratico Parliamo ancora di vaccini Il vaccino per lo pneumococco: il punto di vista dell igienista Franco Giovanetti Dipartimento di Prevenzione ASL 18 Alba Bra Torino, 25

Dettagli

Come prevenire e gestire l infezione da Clostridium difficile nelle strutture sanitarie

Come prevenire e gestire l infezione da Clostridium difficile nelle strutture sanitarie Agenzia Sanitaria Regionale Area Rischio infettivo Unità Gestione Rischio e Sicurezza Come prevenire e gestire l infezione da Clostridium difficile nelle strutture sanitarie Pietro Ragni Reggio Emilia,

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

La sindrome dell intestino irritabile post-infettiva

La sindrome dell intestino irritabile post-infettiva La sindrome dell intestino irritabile post-infettiva Dr.ssa Chiara Ricci Università di Brescia Spedali Civili, Brescia Definizione La sindrome dell intestino irritabile Disordine funzionale dell intestino

Dettagli

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine Università degli Studi del Piemonte Orientale A. Avogadro CORSO DI ALTA FORMAZIONE IN LEGISLAZIONE ALIMENTARE Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

CURRICULUM VITAE. - Abilitato all'esercizio della professione di Medico Veterinario con la votazione di 120/120.

CURRICULUM VITAE. - Abilitato all'esercizio della professione di Medico Veterinario con la votazione di 120/120. CURRICULUM VITAE NORMANNO GIOVANNI GIUSEPPE Professore Universitario di seconda fascia SSD VET/04 Ispezione degli alimenti Nato a Foggia il 2/01/1967 Già in servizio presso la facoltà di Medicina Veterinaria

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: PCR e Immunosensori per la determinazione dei batteri patogeni

Applicazione dei metodi rapidi alla microbiologia alimentare: PCR e Immunosensori per la determinazione dei batteri patogeni Applicazione dei metodi rapidi alla microbiologia alimentare: PCR e Immunosensori per la determinazione dei batteri patogeni Elisabetta Delibato Reparto Pericoli microbiologici connessi agli alimenti METODICHE

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

La prevenzione primaria e secondaria delle malattie allergiche

La prevenzione primaria e secondaria delle malattie allergiche La prevenzione primaria e secondaria delle malattie allergiche Negli ultimi decenni la frequenza delle malattie allergiche in Italia e nel mondo ha subìto un continuo aumento, dando luogo a quella che

Dettagli

STUDIO RETROSPETTIVO SULL ENDOCARDITE ULCERO-POLIPOSA DEL BOVINO

STUDIO RETROSPETTIVO SULL ENDOCARDITE ULCERO-POLIPOSA DEL BOVINO STUDIO RETROSPETTIVO SULL ENDOCARDITE ULCERO-POLIPOSA DEL BOVINO Bianco Paolo, Capucchio Maria Teresa*, Catalano Deborah*, Saracco Mauro, Dondo Alessandro**, Grattarola Carla**, Guarda Franco*. Azienda

Dettagli

SEDE: Istituto di Igiene e Medicina Preventiva, Università degli Studi di Sassari Via Padre Manzella, 4 07100 - SASSARI

SEDE: Istituto di Igiene e Medicina Preventiva, Università degli Studi di Sassari Via Padre Manzella, 4 07100 - SASSARI UNITÀ DI RICERCA DI SASSARI SEDE: Istituto di Igiene e Medicina Preventiva, Università degli Studi di Sassari Via Padre Manzella, 4 07100 - SASSARI RESPONSABILE SCIENTIFICO: Elena Muresu Tel: 079 228467

Dettagli

DSSD per Therapeutic Drug Monitoring e Farmacogenetica.

DSSD per Therapeutic Drug Monitoring e Farmacogenetica. Via Lessolo, 19-10153 TORINO Tel.011.8129005 - fax.011.5364575 e-mail : info@biomicron.it DSSD Dried Sample Spots Device for Low Cost Shipping (Laboratori Biomicron srl in collaborazione con Laboratorio

Dettagli

Controllo microbiologico degli alimenti: metodi a confronto

Controllo microbiologico degli alimenti: metodi a confronto Fiera di Cremona, venerdì 17 aprile 2009 Controllo microbiologico degli alimenti: metodi a confronto Valerio Giaccone Facoltà di Medicina veterinaria Università di Padova Dal 1 gennaio 2006 è entrata in

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

Gian Maria Rossolini. Università di Siena. Dip. Medicina Sperimentale e Clinica. Dip. Biotecnologie Mediche

Gian Maria Rossolini. Università di Siena. Dip. Medicina Sperimentale e Clinica. Dip. Biotecnologie Mediche Automazione in microbiologia: nuovi flussi organizzativi Gian Maria Rossolini Dip. Medicina Sperimentale e Clinica Università di Firenze Dip. Biotecnologie Mediche Università di Siena SODc Microbiologia

Dettagli

ULSS 2 INCONTRA I mercoledì della Salute

ULSS 2 INCONTRA I mercoledì della Salute ULSS 2 INCONTRA I mercoledì della Salute Antibiotici: servono sempre? Relatore: Dr. Del Monte 05 febbraio 2014 sala Piccolotto ANTIBIOTICI: servono sempre? Dott.ssa Daniela Signori Dott. Vincenzo Catena

Dettagli

fluorochinoloni in ceppi di Escherichia coli resistenti

fluorochinoloni in ceppi di Escherichia coli resistenti Veterinaria Italiana, 45 (4), 513 520 Indagine preliminare sulla resistenza ai fluorochinoloni in ceppi di Escherichia coli resistenti all acido nalidixico isolati da feci animali Alessandra Alessiani

Dettagli

Le Nuove Sfide Scientifiche, Tecniche ed Organizzative in Medicina di Laboratorio

Le Nuove Sfide Scientifiche, Tecniche ed Organizzative in Medicina di Laboratorio Le Nuove Sfide Scientifiche, Tecniche ed Organizzative in Medicina di Laboratorio Roma, 6 Novembre 2012 HHV-7 ASSOCIATED MENINGOENCEPHALITIS: AN UNFORGETTABLE CLINICAL CASE Relatore: D.ssa Loria Bianchi

Dettagli

RT-PCR PER RICERCA DI VIRUS IFLUENZALI A

RT-PCR PER RICERCA DI VIRUS IFLUENZALI A METODO NAZIONALE STANDARD RT-PCR PER RICERCA DI VIRUS IFLUENZALI A VSOP 42 Emesso da Standards Unit, Department for Evaluations, Standards and Training Centre for Infections Revisione no: 1.2 Data di revisione

Dettagli

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni Corso di: GESTIONE FAUNISTICA Prof. Bernardino Ragni Università degli Studi di Perugia Facoltà di Scienze Matematiche Fisiche Naturali Corso di laurea in Scienze Naturali LAUREA MAGISTRALE Caso di studio:

Dettagli

Misure di prevenzione e controllo delle infezioni da CPE Indicazioni del Ministero della Salute

Misure di prevenzione e controllo delle infezioni da CPE Indicazioni del Ministero della Salute Klebsiella pneumoniae resistente ai carbapenemi: un problema emergente di sanità pubblica Roma, 5 giugno 2012 - ISTITUTO SUPERIORE DI SANITA' Misure di prevenzione e controllo delle infezioni da CPE Indicazioni

Dettagli

La maggior percentuale di Listeria spp. Per singola specie di alimento è stata riscontrata nella categoria dei derivati del latte. (Fig.2).

La maggior percentuale di Listeria spp. Per singola specie di alimento è stata riscontrata nella categoria dei derivati del latte. (Fig.2). Importanza della ricerca della Listeria monocytogenes nelle produzioni alimentari Alcune esperienze di un laboratorio di controllo ufficiale A.R.P.A.C.: Colacurci B., Tucci C., d Alessio A., Ciampi B.,

Dettagli

ONCOLOGIA OGGI Animali e Uomo Alleati Contro i Tumori

ONCOLOGIA OGGI Animali e Uomo Alleati Contro i Tumori ONCOLOGIA OGGI Animali e Uomo Alleati Contro i Tumori Venerdì 12 giugno 2009 ore 08.30 14.00 COMUNE DI ROMA Palazzo Senatorio- Aula Giulio Cesare P.zza del Campidoglio - Roma LE BIOBANCHE IN MEDICINA VETERINARIA

Dettagli

Linee guida. REGIONE PIEMONTE DIREZIONE REGIONALE SANITA PUBBLICA Mario Valpreda

Linee guida. REGIONE PIEMONTE DIREZIONE REGIONALE SANITA PUBBLICA Mario Valpreda Linee guida REGIONE PIEMONTE DIREZIONE REGIONALE SANITA PUBBLICA Mario Valpreda GRUPPO DI LAVORO PER LA SORVEGLIANZA E CONTROLLO DELLE INFEZIONI OSPEDALIERE Oggetto: orientamenti in tema di controllo microbiologico

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

Geni che codificano per il CCR5

Geni che codificano per il CCR5 Geni che codificano per il CCR5 Gli individui con due copie normali del gene CCR5 sono predominanti nella popolazione generale e sono suscettibili d infezione da parte di HIV-1. 3,9 Gli eterozigoti Δ 32

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici

Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Approcci metodologici nella microbiologia delle acque e criticità dei metodi analitici Istituto Superiore di Sanità Roma 30 ottobre 2007 Rossella Briancesco Metodi tradizionali spesso poco sensibili Metodi

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO

GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO GRUPPO DI STUDIO TUMORI CUTANEI LINEE GUIDA PER ANALISI GENETICO MOLECOLARI IN PAZIENTI AFFETTI DA MELANOMA METASTICO Documento redatto da: Dott.ssa T.Venesio, Dr.ssa A. Balsamo - Laboratorio di Patologia

Dettagli

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA CLM Biotecnologie per l Alimentazione CLM in Biotecnologie Sanitarie Corso di Chimica e certificazione degli alimenti DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA VIRUS ENTERICI virus escreti tramite

Dettagli

F O R M A T O E U R O P E O

F O R M A T O E U R O P E O F O R M A T O E U R O P E O P E R I L C U R R I C U L U M V I T A E INFORMAZIONI PERSONALI Nome Cellulare 3209709494 E-mail alessia_caracci@libero.it Nazionalità Italiana Data di nascita 11.12.1982 Velletri

Dettagli

Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155

Finanziato dalla Unione Europea. Contratto No. FP6-RII3-026155 Finanziato dalla Unione Europea Contratto No. FP6-RII3-026155 Visione d insieme della struttura di FP6 2 Finanziato dalla Unione Europea EUPRIM-NET European Primate Network: Infrastrutture Specializzate

Dettagli

INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT

INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT INFEZIONE DA HIV ED AIDS HIV 1 ed HIV 2 appartengono alla famiglia dei Retroviridae, genere lentovirus. L infezione da HIV provoca nell ospite una progressiva compromissione delle difese immunitarie, soprattutto

Dettagli

Profili di utilizzo della terapia antibiotica: esperienza dell Azienda ospedaliera S. Maria Nuova / IRCCS di Reggio Emilia

Profili di utilizzo della terapia antibiotica: esperienza dell Azienda ospedaliera S. Maria Nuova / IRCCS di Reggio Emilia Esperienze di successo di antimicrobial stewardship Bologna 18 novembre 2014 Profili di utilizzo della terapia antibiotica: esperienza dell Azienda ospedaliera S. Maria Nuova / IRCCS di Reggio Emilia Annamaria

Dettagli

Analisi mutazionale di K-RAS metodiche a confronto

Analisi mutazionale di K-RAS metodiche a confronto Analisi mutazionale di K-RAS metodiche a confronto Aula Magna Villa Sironi Gallarate 16 ottobre Dott. Carmelo Lupo Coordinatore Tecnico Anatomia Patologica e Patologia Molecolare Oncologica PERCHÉ K-RAS

Dettagli

PROFILASSI delle MALATTIE INFETTIVE. MISURE di ISOLAMENTO. 13/06/2012 Dr. Ettore Paolantonio

PROFILASSI delle MALATTIE INFETTIVE. MISURE di ISOLAMENTO. 13/06/2012 Dr. Ettore Paolantonio PROFILASSI delle MALATTIE INFETTIVE MISURE di ISOLAMENTO 13/06/2012 Dr. Ettore Paolantonio 1 PROFILASSI MALATTIE INFETTIVE La Profilassi mira ad impedire l insorgenza e la diffusione delle malattie infettive

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli