LAVORI ORIGINALI/ORIGINAL ARTICLES

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "LAVORI ORIGINALI/ORIGINAL ARTICLES"

Transcript

1 170 GIMMOC Vol. VIII N 3, 2004 Giornale Italiano di Microbiologia Medica Odontoiatrica e Clinica Vol. VIII, N 3, 2004 p Organo ufficiale della S.I.M.M.O.C. Copyright 2004 Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles M. Corrente 1, M. Totaro 1, G. Greco 1, E. Tarsitano 1, A. Madio 1, K.G. Friedrich 2, M. Campolo 1, C. Buonavoglia 1 *Autore di riferimento: M. Corrente Riassunto: Nel presente studio 22 ceppi di Salmonella del Giardino Zoologico (Bioparco) di Roma e di proprietà privata sono stati sierotipizzati e testati per la sensibilità a 15 antibiotici. Inoltre sono stati ricercati mediante PCR i geni di patogenicità fim, inva e spvc e i geni che codificano per le integrasi (int 1, 2, 3 e 4). Diciassette sierotipi sono risultati appartenere a Salmonella enterica subspecie enterica e 4 ceppi alla sottospecie IIIa, mentre 1 ceppo è risultato non tipizzabile. Diciotto ceppi sono risultati resistenti a 2 o più antibiotici. In particolare, la maggior parte dei ceppi è risultata resistente al sulfametossazolo (21 su 22) alla streptomicina (14) e alla colistina solfato (11). Per quanto concerne la PCR, è stato evidenziato che tutti i ceppi erano in possesso dei geni fim e inva e 3 ceppi, appartenenti a Salmonella subsp. IIIa, del gene spvc. Inoltre 11 ceppi sono risultati positivi per int 1, 2 stipiti per int 2, nessun ceppo per int 3 e 4. La presenza di caratteri di patogenicità nei ceppi analizzati conferma la potenzialità dei rettili a trasmettere l infezione all uomo e ribadisce la necessità di una corretta informazione sulle norme igieniche da osservare durante la manipolazione di tali animali. Inoltre la diffusione di elementi di antibiotico-resistenza sottolinea che il trattamento antibiotico degli animali, che raramente dà la sterilizzazione batteriologica, è da considerarsi dannoso. Summary: In this survey 22 Salmonella strains isolated from reptiles housed in the Bioparco in Rome or belonging to private owners were serotyped and tested for susceptibility to 15 antimicrobials. Pathogenicity and antimicrobial resistance genes such as fim, inva, spvc and int 1, 2 3 and 4 were investigated by PCR. Seventeen Salmonella enterica subsp. enterica and 4 serotypes Salmonella subsp. IIIa were found. One strain was untypeable. Eighteen strains were found to be resistant to two or more antimicrobials. Most strains were resistant to sulfamethoxazole (21 out 22 strains) to streptomycin (14) and to colistin sulfate (11). The genes fim and inv A were found in all the strains, while 3 strains were positive to the PCR for the gene spvc. Eleven strains were shown to possess int 1 gene, and 2 strains int 2. Int 3 and 4 were not found. The presence of pathogenicity genes highlights that the strains isolated from reptiles are able to transmit the infection to humans. Furthermore, as some characters of antimicrobial resistance are diffused among those strains, antibiotic treatment of Salmonella carriers should be avoided and good hygiene practices during animal handling should be recommended. INTRODUZIONE La salmonellosi è considerata uno dei più importanti problemi di salute pubblica. L uomo si infetta principalmente attraverso il consumo di alimenti di origine animale [Turnbull, 1979]; tuttavia, il contatto con i rettili sta assumendo un peso crescente nel determinismo dell infezione, in relazione alla loro diffusione come animali da compagnia [Woodward et al, 1997; Willis et al, 2002]. Gli animali a sangue freddo sono infatti reservoirs di diversi sierotipi di salmonelle [Chiodini e Sundberg, 1981]. Negli ultimi anni numerosi casi di salmonellosi correlati alla presenza di rettili nelle abitazioni dei pazienti, o legati al contatto con proprietari di rettili, sono stati segnalati dal Centers for Disease Control [CDC 1992a, 1992b, 1999, 2003]. Nei rettili allevati in cattività è molto frequente l isolamento di S. enterica subspecie enterica (I), che annovera i sierotipi più frequentemente isolati in corso di salmonellosi nell uomo [Geue e Lor- 1 Dipartimento di Sanità e Benessere animale, Facoltà di Medicina Veterinaria, Università di Bari. 2 Servizio Veterinario del Bioparco, Roma.

2 GIMMOC Vol. VIII N 3, schner, 2002]. Tuttavia, anche altri stipiti e appartenenti a S. bongori e S. enterica subsp. IIIa e IIIb, sono stati messi in relazione con episodi di malattia nell uomo [Pignato et al, 1998]. Nei rettili le salmonelle non sembrano avere un ruolo patogeno primario; solo in animali in cattive condizioni di salute possono provocare malattia, alla stregua di altri enterobatteri presenti nell intestino [Chiodini e Sundberg, 1981]. Per converso, i casi segnalati nell uomo evidenziano che i ceppi isolati dai rettili possono conservare le caratteristiche di patogenicità. Studi condotti su animali da laboratorio hanno dimostrato infatti che alcuni ceppi isolati da coccodrilli sono dotati di proprietà invasive [Madsen et al, 1998]. Queste caratteristiche sarebbero conferite da alcuni geni, organizzati nelle cosiddette isole di patogenicità delle salmonelle (SPI) [Bäumler et al, 1998]. Negli stadi iniziali dell infezione sono importanti i geni che codificano per le fimbrie, che promuovono l adesione dei batteri alla mucosa intestinale [Bäumler et al, 1998]. Tra questi si annovera il gene fim, che produce fimbrie di I tipo, racchiuso nella SPI 1. La capacità di dare infezione sistemica negli animali a sangue caldo è dovuta invece ad altri geni, come inva, appartenente alla SPI 1, che promuove l internalizzazione delle salmonelle nelle cellule e ai geni della SPI 2, tra cui spv (plasmide di virulenza in salmonella) [Bäumler, 1997]. Nel quadro evolutivo degli enterobatteri l acquisizione di tali geni si sarebbe verificata relativamente di recente, consentendo la diversificazione delle salmonelle da altri enterobatteri a partire da un progenitore comune. In particolare, l acquisizione della SPI 1 avrebbe causato la divergenza tra Salmonella bongori, che è considerata la specie ancestrale delle salmonelle, e Escherichia coli. In una seconda fase, sarebbe comparsa la SPI 2 e con essa gli altri sierotipi di Salmonella. L analisi di questi geni riveste dunque un ruolo importante nello studio della filogenesi delle salmonelle [Bäumler et al, 1998]. Un altro aspetto importante riguarda la sensibilità agli antibiotici delle salmonelle isolate dai rettili. Nel tentativo di eliminare le salmonelle dall intestino, gli animali portatori possono essere trattati con antibiotici. Questa prassi, impiegata soprattutto in passato, potrebbe aver favorito l insorgenza di caratteri di antibiotico-resistenza [Johnson-Delaney, 1996]. Sono note infatti le capacità delle salmonelle di rispondere alla pressione selettiva degli antibiotici con la selezione di ceppi resistenti, e la facilità con cui questi batteri scambiano materiale genetico. Questa prerogativa, condivisa da altri batteri Gram negativi, è legata anche all esistenza di frammenti mobili del genoma, definiti integroni, specializzati nel veicolare caratteri di resistenza agli antibiotici. E stato stimato che questi segmenti possono contenere sino a 60 geni diversi che codificano per tali resistenze [Carattoli, 2001]. Sono state descritte 4 classi di integroni, ma i più diffusi sono gli integroni di classe 1 [Goldstein et al, 2001]. La presenza di questi geni è un indicatore della potenzialità delle salmonelle ad acquisire caratteri di antibiotico-resistenza, soprattutto in virtù della loro permanenza nell intestino dei rettili come flora saprofitica. Sulla scorta di queste considerazioni, alcuni sierotipi di Salmonella spp. isolati da diverse specie di rettili allevati presso un giardino zoologico e di proprietà privata sono stati analizzati per quanto concerne alcuni caratteri di patogenicità. I ceppi sono stati inoltre saggiati per la sensibilità in vitro ad alcuni antibiotici e per la presenza di geni relativi agli integroni. MATERIALI E METODI Ceppi: Sono stati esaminati 18 ceppi isolati da diverse specie di rettili del Giardino Zoologico di Roma (Bioparco) e 4 stipiti appartenenti a privati (Tabella I). L isolamento è stato effettuato dalle feci utilizzando il protocollo standard per l isolamento di salmonelle da matrici alimentari [ISO 6579, Anon 1993] con qualche modifica [Corrente et al, 2004]. I ceppi sono stati Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles

3 172 GIMMOC Vol. VIII N 3, 2004 Corrente et al. Tabella I Sierotipi di Salmonella, resistotipi e analisi mediante PCR di geni di patogenicità e antibiotico-resistenza Campione Animale Provenienza Sierotipo Resistotipo PCR fim inv A Spv C Int 1 Int 2 Int 3 Int /02 Serpente del grano Bioparco S. Newport Cs Smx a 59/02 Camaleonte S. Muenster Amp C Cs Kf S Smx Te /02 Camaleonte S. Senftenberg Cs S Smx Te /02 Camaleonte S. Gaminara Amp C Cs S Smx Te a 67/02 Pitone S. Aqua Smx b 67/02 Tartaruga S. Senftenberg Smx /02 Lucertola S. Senftenberg S Smx /02 Basilisco S. Senftenberg S Smx /02 Cervone S. Newport Smx a 72/02 Lucertola ocellata S. Give S Na Smx b 72/02 Tartaruga S. Poona Cs Na Smx Sxt a 72/02 Eloderma sospetto S. subsp. IIIa (O 48) Na S Smx /02 Varano del Nilo S. Senftenberg Cs a 72/02 Tartaruga S. subsp. IIIa (O 48 ) S Smx Sxt a 72/02 Camaleonte S. Gbadago S Smx a 101/02 Lucertola S. Minnesota Amp Na Smx Te b 101/02 Lucertola ocellata S. Minnesota Amp Cs Na Smx Te /02 Camaleonte S. Oldenburg Amp C Cs S Smx Te /03 Iguana Privato S. subsp. IIIa (O 17 ) S Smx /03 Iguana Non tipizzabile Cs Na S Smx /02 Lucertola S. Havana Cs Na S Smx /02 Pitone S. subsp. IIIa RF Cs S Smx Antibiotici saggiati: Acido nalidixico (Na), ampicillina (Amp), amoxicillina+ clavulanico (Aug), cefalotina (Kf), ceftazidime (Caz), ciprofloxacin (Cip), cloramfenicolo (C), colistina solfato (Cs), cotrimossazolo (Sxt), gentamicina (Gn), neomicina (N), norfloxacin (Nor), streptomicina (S), sulfametossazolo (Smx), tetraciclina (Te).

4 GIMMOC Vol. VIII N 3, quindi identificati con il sistema api 20E (Biomérieux, Mercy l Etoile, Francia), mediante agglutinazione rapida su vetrino con sieri polivalenti O e H ( Biotech Laboratories, Ipswich Suffolk, UK) e tipizzati con lo schema di Kauffmann- White [Zavanella 2001], presso l Istituto Zooprofilattico di Brescia. Ceppi di referenza: per standardizzare le tecniche sono stati utilizzati 2 ceppi ATCC: S. typhimurium e S. arizonae 13314, acquistati presso la Biogenetics (Padova). Prove di sensibilità in vitro: i ceppi sono stati testati con la tecnica della diffusione in agar, seguendo le direttive del National Committee on Clinical Laboratory Standard [NCCLS 1999] per la sensibilità verso i seguenti antibiotici (concentrazione dei dischetti in µg, Liofilchem, Roseto degli Abruzzi, Te): acido nalidixico (30), ampicillina (10), amoxicillina +acido clavulanico (30), cefalotina (30), ceftazidime (30), ciprofloxacin (5), cloramfenicolo (30), colistina sulfato (10), co-trimossazolo (25), gentamicina (10), neomicina (30), norfloxacin (10), streptomicina (10), sulfametossazolo (50), tetraciclina (30). Estrazione del DNA: I ceppi sono stati seminati in Brain Heart Infusion (Oxoid, Milano) e incubati overnight a 37 C. Un millilitro di brodocoltura di ciascun ceppo è stato sottoposto al protocollo di estrazione del kit QIAmp Tissue (QIAGEN GmbH, Germania). Pcr: Le tecniche di PCR sono state effettuate utilizzando il DNA Thermal Cycler Gene Amp 9600 (Perkin Elmer Cetus, Norwalk, CT, USA). I campioni sono stati saggiati con i primers indicati nella tabella II [Cohen et al, 1996; Khan et al, 2000; Goldstein et al, 2001]. Cinque microlitri di DNA di ogni campione sono Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles Tabella II Primers utilizzati nelle reazioni di PCR. Primers Sequenza Temperatura di Riferimento (Forward e Reverse) annealing ( C) bibliografico Fim Inv A Spv C Int 1 Int 2 Int 3 Int 4 F:CCTTTCTCCATCGTCCTG R: TGGTGTTATCTGCCTGACCA 58 Cohen et al. (1996) F: CGCGGCCCGATTTTCTCTGGA R:AATGCGGGGATCTGGGCGACAAG 67 Khan et al F:GGGGCGGAAATACCATCTACA R:GCGCCCAGGCTAACACG 60 Khan et al F:CCTCCCGCACGATGATC R:TCCACGCATCGTCAGGC 65 Goldstein et al F.TTATTGCTGGGATTAGGC R:ACGGCTACCCTCTGTTATC 60 Goldstein et al F:AGTGGGTGGCGAATGAGTG R:TGTTCTTGTATCGGCAGGTG 60 Goldstein et al F:CGGTATGTCTAATTGCTCTTG R: TGGCCACAAAGACTCAATCAC 60 Goldstein et al. 2001

5 174 GIMMOC Vol. VIII N 3, 2004 Corrente et al. stati aggiunti alla miscela di reazione così costituita: PCR buffer (10X), 1.5 mm Mg Cl 2, 200 µm di ogni nucleotide trifosfato, 0.1 mm di ogni primer, 2.5 U di Amplitaq Gold Polymerase (Perkin Elmer Cetus Norwalk, USA) e H 2 O distillata sino a raggiungere un volume finale di 50 µl. Le miscele di reazione sono state sottoposte a 1 ciclo iniziale di denaturazione a 94 C per 8 minuti, seguite da 35 cicli di amplificazione, ciascuno di 1 minuto di denaturazione a 94 C, 1 minuto di annealing, a temperature diverse per ogni coppia di primers ( tabella II), 2 minuti di estensione a 72 C, 1 ciclo finale di 8 minuti a 72 C. I prodotti di PCR sono stati visualizzati mediante corsa elettroforetica su gel di agarosio al 2 % colorato con etidio bromuro, con l ausilio del CHEMIDOC (Bio-rad, Milano). RISULTATI I risultati sono riassunti nella tabella I. La sierotipizzazione ha messo in evidenza 21 stipiti appartenenti alla specie S. enterica, di cui 17 appartenenti a S. enterica subspecie I e 4 a S. enterica subspecie IIIa. La tipizzazione non è stata possibile per 1 ceppo, isolato da un iguana. Le prove di sensibilità in vitro hanno permesso di evidenziare la resistenza ad alcuni antibiotici nei sierotipi di Salmonella saggiati. La maggior parte dei ceppi è risultata resistente al sulfametossazolo (21 su 22 ceppi), alla streptomicina (14) alla colistina solfato (11). Sette ceppi sono risultati resistenti all acido nalidixico, 6 alla tetraciclina, 5 all ampicillina, 3 al cloramfenicolo e 2 al cotrimossazolo. Solo 1 stipite è risultato resistente alla cefalotina. Per converso, nessuno dei ceppi è risultato resistente a norfloxacin, ciprofloxacin, amoxicillina +clavulanico, ceftazidime, gentamicina, neomicina. Secondo la definizione adottata da Dargatz et al [2003], 18 ceppi sono risultati multiresistenti, cioè resistenti a due o più antibiotici. In particolare 9 ceppi sono risultati resistenti a 4 o più antibiotici. Per quanto concerne l analisi dei caratteri di patogenicità, tutti i ceppi saggiati sono risultati positivi alla PCR per i geni fim e inva, mentre in 3 ceppi appartenenti a Salmonella subsp. III A, è stato messo in evidenza il gene spvc. Le reazioni di amplificazione dei tratti relativi alle integrasi hanno dato i seguenti risultati: 11 ceppi sono risultati positivi per il frammento int 1 e 2 ceppi positivi per int 2. Nessun campione è risultato positivo alla PCR per i frammenti int 3 e int 4. DISCUSSIONE Precedenti indagini svolte in USA e in Europa hanno messo in evidenza che l isolamento di salmonelle dai rettili è molto frequente [Johnson-Delaney, 1996; Pasmans et al. 2000; Geue and Lorschner 2002; Pasmans et al. 2002]. In una recente indagine effettuata sugli animali del rettilario del Bioparco di Roma è stata riscontrata una prevalenza del 50.5% [Corrente et al, 2004]. La sierotipizzazione dei ceppi analizzati nel presente studio ha messo in evidenza che non sempre i rettili albergano sierotipi esotici, soprattutto se mantenuti in cattività. Inoltre in alcuni animali è stato isolato S. Senfentberg, un sierotipo particolarmente termoresistente [Murphy et al, 1999]. A tale proposito, occorre ricordare che si sono verificati casi di salmonellosi anche in individui che non avevano avuto un contatto diretto con il rettile portatore. Nel 1996, durante una esibizione a scopo didattico in uno zoo, un rettile utilizzato per un esibizione ha trasmesso la salmonellosi a 39 bambini, sebbene nessuno di questi avesse toccato l animale [Friedman et al. 1998]. Nel tentativo di spiegare come mai le salmonelle non siano patogene per i rettili, alcuni autori hanno sottolineato che questi animali hanno un sistema immunitario più rudimentale rispetto agli animali a sangue caldo. In particolare, l assenza di stazioni linfatiche periferiche organizzate come le placche del Peyer, o di linfonodi veri e propri, innescherebbe una sorta di tolleranza del sistema immunitario verso gli stimoli antigenici a livello intestinale, consentendo alle salmonelle di diventare batteri commensali [Bäumler et al, 1998]. Tuttavia, è stato evidenziato anche nella nostra in-

6 GIMMOC Vol. VIII N 3, dagine che a fronte della varietà di sierotipi isolati, un denominatore comune di tali ceppi è la presenza di geni che codificano per alcuni caratteri di patogenicità. Come in altri studi, il gene spvc è stato evidenziato solo nei sierotipi di Salmonella subsp. IIIa, mentre i geni inva e fim si sono dimostrati ubiquitari [Chiu e Jonathan, 1996; Hudson et al, 2000; Khan et al, 2000]. La presenza di tali geni ribadisce la necessità di considerare questi animali come potenziale fonte di salmonellosi. Inquadrate in tale ottica, appaiono pienamente giustificate le raccomandazioni dei CDC, che consiglia di adottare norme igieniche scrupolose durante la manipolazione di tali animali, e invita a non entrare in possesso di rettili se in casa ci sono bambini di età inferiore a 5 anni, anziani o individui immunocompromessi [CDC 2003]. Infatti in queste categorie la salmonellosi provocata da rettili può essere letale [Weinstein et al, 1995]. Presso il Bioparco è in atto dal 1998 un programma di prevenzione che, per ridurre il rischio d infezione da Salmonella, preconizza il controllo sanitario del personale e degli animali, una procedura dettagliata da seguire durante la manipolazione dei rettili, e il divieto d impiego di tali animali nell ambito di attività didattiche (Friedrich et al, 2000). I ceppi isolati hanno mostrato un elevata percentuale di antibiotico-resistenza, non soltanto verso i presidi terapeutici che di solito sono utilizzati in queste specie animali. E interessante notare che molti ceppi sono risultati multiresistenti, con pattern di resistenza parzialmente sovrapponibili a quelli dei ceppi isolati dall uomo in Europa [Threlfall et al, 1998], facendo ipotizzare che la coabitazione con l uomo o con altre specie animali può favorire lo scambio di ceppi. Inoltre è stata messa in evidenza la presenza di geni relativi agli integroni anche in ceppi che non esprimevano un fenotipo antibiotico-resistente. In particolare molti ceppi veicolavano il gene Int 1, relativo agli integroni di classe 1. Questo frammento mobile, che veicola tra gli altri i geni per la resistenza ai sulfamidici e ad alcuni disinfettanti, risulta essere largamente diffuso nei Gram negativi [Guerra et al 2000; Goldstein et al 2001]. Nel genere Salmonella, come in altri Enterobatteri, i meccanismi di trasferimento genetico intra e inter specifico sono molto frequenti. Gli integroni, saltando da un batterio all altro causano la resistenza multipla, fenomeno caratterizzato dalla comparsa di resistenze verso diversi antibiotici, non necessariamente utilizzati nella terapia o nella chemioprofilassi [Carattoli, 2001]. La somministrazione di antibiotici a scopo profilattico è da considerarsi inutile per diversi motivi: i) è raro ottenere la sterilizzazione batteriologica dei soggetti [Johnson-Delaney, 1996]; ii) essendo i rettili eliminatori intermittenti, risulta difficile evidenziare tramite l esame batteriologico se c è stata l effettiva eliminazione di tali germi dall intestino; iii) la potenzialità dei ceppi di Salmonella ad acquisire caratteri di antibiotico-resistenza fa ritenere che questi trattamenti sono non solo inutili ma anche dannosi. Per minimizzare il rischio di trasmissione di salmonelle dai rettili all uomo, i medici veterinari devono: a) formare in maniera adeguata il personale addetto alla manipolazione dei rettili; b) fornire una corretta informazione sui rischi sanitari ai proprietari privati; c) garantire l osservanza di norme di profilassi sanitaria (Bradley et al, 1998). BIBLIOGRAFIA Anon. ISO Microbiology-General guidance on methods for the Detection of Salmonella, 3 rd edn Case Postale 56, CH Genève 20, Switzerland Bäumler A.J. The record of horizontal gene transfer in Salmonella. Trends Microbiol., 5 (8): , Bäumler A.J., Tsolis R.M., Ficht T.A., Adams L.G. Evolution of Host Adaptation in Salmonella enterica. Infect. Immun., 66: , Bradley T., Angulo F.J., Raiti P. Association of reptilian and amphibian veterinarians guidelines for reducing risk of transmission of Salmonella spp. from reptiles to humans. J. Am. Vet. Med. Assoc., 213: 51-52, Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles

7 176 GIMMOC Vol. VIII N 3, 2004 Corrente et al. Carattoli A. Importance of integrons in the diffusion of resistance. Vet. Res Centers for Disease Control Iguana-associated salmonellosis. Morbid. Mortal. Weekly. Rep., 41: 38-39, 1992a. Centers for Disease Control Lizard-associated salmonellosis. Morbid. Mortal. Weekly. Rep., 41: , 1992b. Centers for Disease Control. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 48: , Centers for Disease Control. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 52: , Chiodini R.J., Sundberg J.P. Salmonellosis in reptiles: a review. Am. J. Epidemiol., 113: , Chiu C.-H., Jonathan T.O. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, inva and spvc, by an enrichment broth culture-multiplex PCR combination assay. J. Clin. Microbiol., 34 (10): , Cohen H.J., Mechanda S.M., Lin W. PCR amplification of the fima gene sequence of Salmonella typhimurium, a specific method for detection of Salmonella spp. Appl. Environ. Microbiol., 62 (12): , Corrente M., Madio A., Friedrich K.G., et al. Isolation of Salmonella strains from reptile faeces and comparison of different culture media. J. Appl. Microbiol., 96: , Dargatz D.A., Fedorka-Cray P.J., Ladely S.R., et al. Prevalence and antimicrobial susceptibility of Salmonella spp. isolates from US cattle in feedlots in 1999 and J. Appl. Microbiol., 95: , Friedman C.R., Torigian C., Shillam P.J., et al. An outbreak of salmonellosis among children attending a reptile exhibit at a zoo. J. Pediatr., 132: , Friedrich K.G., Magrini L., Puppini F. Rischi sanitari nei lavoratori dei Giardini Zoologici e Parchi Naturali. G. Med. Mil. 150: 1-6, Geue L., Löschner U. Salmonella enterica in reptiles of German and Austrian origin. Vet. Microbiol., 84: 79-91, Goldstein C., Lee M.D., Sanchez S., Hudson C., et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob. Agents Chemother., 45 (3): , Guerra B., Soto S., Cal S., Mendoza C. Antimicrobial resistance and spread of class 1 integrons among Salmonella serotypes. Antimicrob. Agents Chemother., 44 (8): , Hudson C.R., Quist C., Lee M.D., et al. Genetic relatedness of Salmonella isolates from nondomestic birds in Southeastern United States. J. Clin. Microbiol., 38 (5): , Johnson-Delaney C.A. Reptiles zoonoses and Threats to Public Health. In Reptile Medicine and Surgery ed. Mader, D.R. pp Philadelphia: WB Saunders Company Khan A.A., Nawaz M.S., Khan S.A., Cerniglia C.E. Detection of multidrug-resistant Salmonella Typhimurium DT104 by multiplex polymerase chain reaction. FEMS Microbiol. Lett., 182: , Madsen M., Hangartner P., West K., Kelly P. Recovery rates, serotypes and antimicrobial susceptibility patterns of salmonellae isolated from cloacal swabs of wild Nile crocodiles (Crocodylus niloticus) in Zimbabwe. J. Zoo Wildl. Med., 29: 31-34, Murphy R.Y., Marks B.P., Johnson E.R., Johnson M.G. Inactivation of Salmonella and Listeria in ground chicken breast meat during thermal processing. J. Food Prot., 62: , National Committee on Clinical Laboratory Standards (NCCLS) Performance Standards for Antimicrobial Susceptibility Tests for bacteria isolated from Animals. Approved standard. NC- CLS document M31-A. Wayne, P.A.: National Committee on Clinical Laboratory Standards Pasmans F., De Herdt P., Chasseur-Libotte M.L., Ballasina D. L. Ph., Haesebrouck F. Occurrence of Salmonella in tortoises in a rescue centre in Italy. Vet. Rec.,146: , Pasmans F., De Herdt P., Haesebrouck F. Presence of Salmonella infection in Freshwater turtles. Vet. Rec., 150: , Pignato S., Giammanco G., Santangelo C., Giammanco G.M. Endemic presence of Salmonella bongori 48: z35:- causing enteritis in children in Sicily. Res. Microbiol., 149: , Threlfall E.J., Fischer I.S.T., Berghold C., et al. Antimicrobial drug resistance in isolates of Salmonella enterica from cases of salmonellosis in humans in Europe: results of international multi-centre surveillance. Eurosurveillance. 8: 41-45, Weinstein J.W., Seltzer E.G., Nelson R.S. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 44: , Turnbull P.C.B. Food poisoning with special reference to Salmonella-its epidemiology, pathogenesis and control. Clin. Gastroenterol. 8: , Willis C., Wilson T., Greenwood M., Ward L. Pet reptiles associated with a case of salmonellosis in an infant were carrying multiple strains of Salmonella. J. Clin. Microbiol., 40: , Woodward D.L., Khakhria R., Johnson W.M. Human salmonellosis associated with exotic pets. J. Clin. Microbiol., 35: , Zavanella M. Schema di Kaufmann-White aggiornato. In Tipizzare le Salmonelle. pp Brescia (Italy): Fondazione iniziative Zooprofilattiche e Zootecniche

Mario Sarti. Laboratorio di Microbiologia e antimicrobial stewardship nell Azienda USL di Modena

Mario Sarti. Laboratorio di Microbiologia e antimicrobial stewardship nell Azienda USL di Modena Laboratorio di Microbiologia e antimicrobial stewardship nell Azienda USL di Modena Mario Sarti Microbiologia Clinica Provinciale Azienda USL di Modena 9 STRATEGIE DI REFERTAZIONE PER FAVORIRE L USO APPROPRIATO

Dettagli

Informazioni per i pazienti e le famiglie

Informazioni per i pazienti e le famiglie Che cos è l MRSA? (What is MRSA? Italian) Reparto Prevenzione e controllo delle infezioni UHN Informazioni per i pazienti e le famiglie Patient Education Improving Health Through Education L MRSA è un

Dettagli

COSTITUZIONE COMITATO PER IL CONTROLLO DELLE INFEZIONI OSPEDALIERE

COSTITUZIONE COMITATO PER IL CONTROLLO DELLE INFEZIONI OSPEDALIERE AZIENDA OSPEDALIERA DI COSENZA COSTITUZIONE COMITATO PER IL CONTROLLO DELLE INFEZIONI OSPEDALIERE Delibera n. 328 del 25 marzo 211 COMITATO TECNICO PREPOSTO AL CONTROLLO DELLE INFEZIONI OSPEDALIERE Dr.

Dettagli

ESPERIENZE DEL C.I.O. NELLA ASL 2

ESPERIENZE DEL C.I.O. NELLA ASL 2 Le Infezioni nosocomiali nella realtà degli Ospedali liguri: un up to date con il contributo di casistiche personali ESPERIENZE DEL C.I.O. NELLA ASL 2 Dott.. G. CALCAGNO Responsabile S.S. Prevenzione rischio

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva.

Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva. Attività di sorveglianza e controllo delle infezioni ospedaliere a livello aziendale: risultati di un indagine conoscitiva. Mario Saia CIO: Normativa Italiana Circolare Ministeriale 52/1985 Lotta contro

Dettagli

L antibiogramm Inutile,necessar ed indispensabile

L antibiogramm Inutile,necessar ed indispensabile Per la terapia DOSSIER MASTITI di una mastite in atto il ricorso a tale test L antibiogramm Inutile,necessar ed indispensabile riveste scarsa importanza. Ma fornisce preziosissime informazioni per le cure

Dettagli

PROGRAMMAZIONE. Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA

PROGRAMMAZIONE. Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA PROGRAMMAZIONE Anno Scolastico 2009-10 IGIENE ED EDUCAZIONE SANITARIA Classe: 4^ LTS/A - SALUTE Insegnante: Claudio Furioso Ore preventivo: 132 SCANSIONE MODULI N TITOLO MODULO set ott nov dic gen feb

Dettagli

Ricerca, Qualità, Sicurezza e Salute

Ricerca, Qualità, Sicurezza e Salute Ricerca, Qualità, Sicurezza e Salute Chi Siamo Hygeia Lab S.r.l. nasce nel 2011 dalla passione e dal desiderio di giovani laureati di continuare la crescita e la formazione scientifica. E una Start-Up

Dettagli

Alimentazione e salute dell intestino: siamo quello che mangiamo

Alimentazione e salute dell intestino: siamo quello che mangiamo Alimentazione e salute dell intestino: siamo quello che mangiamo La dieta, il microbiota intestinale e la salute digestiva sono intrecciati fra loro. Questi legami e il potenziale benefico dei probiotici

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? 2. Come nasce la sperimentazione clinica e che tipi di studi esistono?

STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? 2. Come nasce la sperimentazione clinica e che tipi di studi esistono? STUDI CLINICI 1. Che cosa è uno studio clinico e a cosa serve? Si definisce sperimentazione clinica, o studio clinico controllato, (in inglese: clinical trial), un esperimento scientifico che genera dati

Dettagli

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO

PRELIEVO DI TAMPONI SU SUPERFICI E CARCASSE SOMMARIO Pag. 1/7 SOMMARIO 1. SCOPO E CAMPO DI APPLICAZIONE...2 2. RIFERIMENTI BIBLIOGRAFICI...2 3. MATERIALE NECESSARIO...3 4. MODALITA OPERATIVE...4 5. REGISTRAZIONE E ARCHIVIAZIONE...7 6. RESPONSABILITA...7

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Dipartimento di Sanità Pubblica: i dati di attività del 2014

Dipartimento di Sanità Pubblica: i dati di attività del 2014 Conferenza Stampa Dipartimento di Sanità Pubblica: i dati di attività del 2014 Lunedì 6/07/2015 ore 11.00 Sala Riunioni - Direzione Generale AUSL Strada del Quartiere 2/A - Parma Alla Conferenza Stampa

Dettagli

CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE

CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE ASO S. Croce e Carle di Cuneo C.I.O. COMITATO INFEZIONI OSPEDALIERE DOCUMENTO DESCRITTIVO TITOLO CONTROLLO MICROBIOLOGICO AMBIENTALE NELLE SALE OPERATORIE Data di emissione: 20 aprile 2004 revisione n

Dettagli

La biopsia del linfonodo sentinella nel carcinoma. Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it

La biopsia del linfonodo sentinella nel carcinoma. Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it La biopsia del linfonodo sentinella nel carcinoma duttale in situ: : si,no, forse Dott. S.Folli S.C. Senologia AUSL Forlì s.folli@ausl.fo.it Definizione Il carcinoma duttale in situ della mammella è una

Dettagli

Sistema per Acuti. Ci-Ca La via per una sicura anticoagulazione con citrato

Sistema per Acuti. Ci-Ca La via per una sicura anticoagulazione con citrato Sistema per Acuti Ci-Ca La via per una sicura anticoagulazione con citrato La terapia Ci-Ca Citrato Dialisato Ci-Ca Calcio Modulo Ci-Ca Il sistema Ci-Ca con gestione integrata del citrato e calcio: La

Dettagli

Primo caso italiano di resi al larvicida ciromazina da di musca domestica

Primo caso italiano di resi al larvicida ciromazina da di musca domestica TECNICA Primo caso italiano di resi al larvicida ciromazina da di musca domestica di Davide Di Domenico ( 1 ) Luigi Ruggeri ( 1 ) Guglielmo Pampiglione ( 2 ) Il problema dell inefficacia dei prodotti utilizzati

Dettagli

4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio?

4. Quali possono essere le complicazioni dell influenza e quali sono le persone a rischio? Dipartimento federale dell'interno DFI Ufficio federale della sanità pubblica UFSP Malattie trasmissibili Stato al 05.10.2010 FAQ Influenza stagionale 1. Cos è l influenza? 2. Come si trasmette l influenza?

Dettagli

Corso di formazione Servizio sanitario regionale Regione Emilia romagna

Corso di formazione Servizio sanitario regionale Regione Emilia romagna Corso di formazione Servizio sanitario regionale Regione Emilia romagna AGGIORNAMENTI SUL CONTROLLO IGIENICO-SANITARIO DELL APICOLTURA Brisighella (RA) 13 settembre 2013 Evoluzione del controllo dell apicoltura

Dettagli

AGREE nella valutazione della qualità delle LG per la diagnosi e terapia delle cefalee in età pediatrica

AGREE nella valutazione della qualità delle LG per la diagnosi e terapia delle cefalee in età pediatrica AGREE nella valutazione della qualità delle LG per la diagnosi e terapia delle cefalee in età pediatrica Pasquale Parisi, MD PhD et. al. Outpatience Service of Paediatric Neurology Child Neurology, Chair

Dettagli

RELAZIONE SUL SISTEMA DI ALLERTA EUROPEO

RELAZIONE SUL SISTEMA DI ALLERTA EUROPEO RELAZIONE SUL SISTEMA DI ALLERTA EUROPEO M.G. PRIMO TRIMESTRE 2014 Il presente rapporto è stato realizzato dalla Direzione Generale per l'igiene e la Sicurezza degli Alimenti e la Nutrizione Direttore

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

PROTOCOLLO. Prevenzione, Sorveglianza e Controllo delle Infezioni Correlate all Assistenza: attivazione e funzionamento dei relativi organismi.

PROTOCOLLO. Prevenzione, Sorveglianza e Controllo delle Infezioni Correlate all Assistenza: attivazione e funzionamento dei relativi organismi. Pagina 1 di 14 SOMMARIO Sommario...1 Introduzione...2 1. Scopo...2 2. campo di applicazione...3 3 Riferimenti...3 3.1 Riferimenti esterni...3 3.2 Riferimenti interni...3 4. Abbreviazioni utilizzate...4

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Corretto utilizzo delle soluzioni concentrate di Potassio cloruro. ed altre soluzioni contenenti Potassio

Corretto utilizzo delle soluzioni concentrate di Potassio cloruro. ed altre soluzioni contenenti Potassio cloruro cloruro Data Revisione Redazione Approvazione Autorizzazione N archiviazione 00/00/2010 e Risk management Produzione Qualità e Risk management Direttore Sanitario 1 cloruro INDICE: 1. Premessa

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

Dati della ricerca. Quali i risultati? Jonathan Trobia

Dati della ricerca. Quali i risultati? Jonathan Trobia Dati della ricerca. Quali i risultati? Jonathan Trobia Introduzione I percorsi di Arte Terapia e Pet Therapy, trattati ampiamente negli altri contributi, sono stati oggetto di monitoraggio clinico, allo

Dettagli

DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA

DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA DEFINIZIONE DELLE SPECIFICHE TECNICHE DI SVILUPPO DELL ATTREZZATURA PROTOTIPO PER LA CONCENTRAZIONE DI BIOMASSA MICROBICA DA ESTRATTO DI CASTAGNA Premesso che nell ambito del progetto Castagna di Montella:

Dettagli

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE D r. C a r l o D e s c o v i c h U.O.C. Governo Clinico Staff Direzione Aziendale AUSL Bologna Bologna 26 Maggio 2010 INDICATORE

Dettagli

Castrazione e sterilizzazione

Castrazione e sterilizzazione Centro veterinario alla Ressiga Castrazione e sterilizzazione Indicazioni, controindicazioni, effetti collaterali ed alternative Dr. Roberto Mossi, medico veterinario 2 Castrazione e sterilizzazione Castrazione

Dettagli

La migliore assistenza nel Nuovo Ospedale Galliera per linee di attività a intensità di cura

La migliore assistenza nel Nuovo Ospedale Galliera per linee di attività a intensità di cura La migliore assistenza nel Nuovo Ospedale Galliera per linee di attività a intensità di cura INTRODUZIONE L obiettivo è fornire la migliore cura per i pazienti con il coinvolgimento di tutto il personale

Dettagli

2. Cos è una buona pratica

2. Cos è una buona pratica 2. Cos è una buona pratica Molteplici e differenti sono le accezioni di buona pratica che è possibile ritrovare in letteratura o ricavare da esperienze di osservatori nazionali e internazionali. L eterogeneità

Dettagli

I METALLI PESANTI NEL LATTE

I METALLI PESANTI NEL LATTE I METALLI PESANTI NEL LATTE di Serraino Andrea Dipartimento di Sanità Pubblica Veterinaria e Patologia Animale - Facoltà Medicina Veterinaria - Università di Bologna - Alma Mater Studiorum. I metalli sono

Dettagli

DETERMINAZIONE DI ESCHERICHIA COLI

DETERMINAZIONE DI ESCHERICHIA COLI Rapporti ISTISAN 2005 DETERMINAZIONE DI ESCHERICHIA COLI 0. Generalità e definizioni Escherichia coli è stato descritto per la prima volta nel 1885 da Theodor Escherich col nome di Bacterium coli. Il microrganismo,

Dettagli

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione PROTOCOLLO DI BIOSICUREZZA Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione Disinfezione Il ricorso a disinfettanti e disinfestanti, se unito ad altre misure tese a minimizzare

Dettagli

Come scrivere una Review

Come scrivere una Review Come scrivere una Review Federico Caobelli per AIMN Giovani Fondazione Poliambulanza - Brescia federico.caobelli@gmail.com SOMMARIO Nel precedente articolo, scritto da Laura Evangelista per AIMN Giovani,

Dettagli

Protezione da Ebola. Cos è, come si previene il contagio, quale barriera scegliere

Protezione da Ebola. Cos è, come si previene il contagio, quale barriera scegliere Protezione da Ebola Cos è, come si previene il contagio, quale barriera scegliere Ed.Ottobre 2014 Il virus Ebola: la sua natura, come si diffonde, quanto è pericoloso L ebola è un virus appartenente alla

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

Con la vaccinazione l influenza si allontana. La prevenzione dell influenza

Con la vaccinazione l influenza si allontana. La prevenzione dell influenza Con la vaccinazione l influenza si allontana La prevenzione dell influenza La vaccinazione antinfluenzale è il mezzo più efficace di protezione dalla malattia e di riduzione delle sue complicanze per le

Dettagli

Istruzioni per gli autori

Istruzioni per gli autori Istruzioni per gli autori Informazioni generali LO SCALPELLO OTODI Educational è la rivista ufficiale della Società Italiana degli Ortopedici e Traumatologi Ospedalieri d Italia (OTODI) e pubblica articoli

Dettagli

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria?

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria? DOMANDE E RISPOSTE 1. Che cos è un vaccino? Un vaccino è un prodotto la cui somministrazione è in grado di indurre una risposta immunitaria specifica contro un determinato microrganismo (virus, batterio

Dettagli

Nome INN Dosaggio Forma farmaceutica. Enrofloxacin 100 mg/ml soluzione orale Broiler, riproduttori, e tacchini

Nome INN Dosaggio Forma farmaceutica. Enrofloxacin 100 mg/ml soluzione orale Broiler, riproduttori, e tacchini Allegato I Lista dei nomi, forme farmaceutiche, dosaggi del medicinale veterinario, specie di destinazione, tempi di attesa, titolari dell autorizzazione all immissione in commercio negli Stati Membri

Dettagli

DIPARTIMENTO DELLA QUALITÀ DIREZIONE GENERALE DELLA PROGRAMMAZIONE SANITARIA, DEI LIVELLI DI ASSISTENZA E DEI PRINCIPI ETICI DI SISTEMA UFFICIO III

DIPARTIMENTO DELLA QUALITÀ DIREZIONE GENERALE DELLA PROGRAMMAZIONE SANITARIA, DEI LIVELLI DI ASSISTENZA E DEI PRINCIPI ETICI DI SISTEMA UFFICIO III Ministero della Salute DIPARTIMENTO DELLA QUALITÀ DIREZIONE GENERALE DELLA PROGRAMMAZIONE SANITARIA, DEI LIVELLI DI ASSISTENZA E DEI PRINCIPI ETICI DI SISTEMA UFFICIO III RAZIONALE Scopo di queste Raccomandazioni

Dettagli

UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE. Programmazione didattica a.a. 2014/2015

UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE. Programmazione didattica a.a. 2014/2015 UNIVERSITA DEGLI STUDI MAGNA GRAECIA DI CATANZARO DIPARTIMENTO DI SCIENZE DELLA SALUTE CORSO DI LAUREA IN BIOTECNOLOGIE Classe L2 Programmazione didattica a.a. 2014/2015 Per l anno accademico 2014-2015

Dettagli

Il test valuta la capacità di pensare?

Il test valuta la capacità di pensare? Il test valuta la capacità di pensare? Per favore compili il seguente questionario senza farsi aiutare da altri. Cognome e Nome Data di Nascita / / Quanti anni scolastici ha frequentato? Maschio Femmina

Dettagli

Efficacia dei probio-ci nelle mala1e diges-ve

Efficacia dei probio-ci nelle mala1e diges-ve Efficacia dei probio-ci nelle mala1e diges-ve Le aree di incertezza nelle Cure Primarie: Quali sono le evidenze di efficacia dei probio-ci nelle patologie del tra9o gastrointes-nale? Edoardo Benede*o 1907

Dettagli

INFLUENZA. Che cos è

INFLUENZA. Che cos è INFLUENZA Che cos è L influenza è una malattia infettiva provocata da virus del genere Othomixovirus che colpiscono le vie aeree come naso, gola e polmoni. I soggetti colpiti nel nostro Paese vanno dai

Dettagli

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità

BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza. Istituto Superiore di Sanità BANCA BIOLOGICA ISS: proposta di utilizzo per le stime di prevalenza Simona Giampaoli, Anna Rita Ciccaglione Istituto Superiore di Sanità Prevalenza e carico dell infezione cronica da virus dell epatite

Dettagli

DOPO UN CASO DI PESTE AMERICANA CHE FARE? Dr.ssa Rosanna Rossi USL7 di Siena Dr.ssa Giuliana Bondi USL7 di Siena

DOPO UN CASO DI PESTE AMERICANA CHE FARE? Dr.ssa Rosanna Rossi USL7 di Siena Dr.ssa Giuliana Bondi USL7 di Siena DOPO UN CASO DI PESTE AMERICANA CHE FARE? Dr.ssa Rosanna Rossi USL7 di Siena Dr.ssa Giuliana Bondi USL7 di Siena TUTTO IL MATERIALE CHE È ENTRATO IN CONTATTO CON LE COLONIE AMMALATE DEVE ESSER DISTRUTTO

Dettagli

infezioni da enterobacteriaceae resistenti ai carbapenemi

infezioni da enterobacteriaceae resistenti ai carbapenemi Gestione del rischio clinico indicazioni per la gestione delle infezioni da enterobacteriaceae resistenti ai carbapenemi Gestione del rischio clinico indicazioni per la gestione delle infezioni da enterobacteriaceae

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

PROGRAMMA DI STUDIO. SALUTE in AUTOGESTIONE

PROGRAMMA DI STUDIO. SALUTE in AUTOGESTIONE PROGRAMMA DI STUDIO SALUTE in AUTOGESTIONE 2013 1 This project has been funded with support from the European Commission. Indice dei contenuti 1. DESTINATARI. 3 2. CARICO DI LAVORO.3 3. ento/insegnamento

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA

La degenerazione maculare legata all età (AMD) Informazioni ai malati -Progetto EUFEMIA Che cos è la degenerazione maculare? La degenerazione maculare è una malattia che interessa la regione centrale della retina (macula), deputata alla visione distinta necessaria per la lettura, la guida

Dettagli

- Riproduzione riservata - 1

- Riproduzione riservata - 1 Principali malattie parassitarie del cane; Le malattie parassitarie che maggiormente interessano e colpiscono il cane sono molte ed alcune di queste possono colpire e provocare conseguenze anche per l

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

PROGETTO MULTIDISCIPLANARE di PROCREAZIONE MEDICALMENTE ASSISTITA (PMA) e GENITORIALITA RESPONSABILE PER le COPPIE con INFEZIONE DA HIV/HCV

PROGETTO MULTIDISCIPLANARE di PROCREAZIONE MEDICALMENTE ASSISTITA (PMA) e GENITORIALITA RESPONSABILE PER le COPPIE con INFEZIONE DA HIV/HCV Arcispedale S. Maria Nuova Dipartimento Ostetrico Ginecologico e Pediatrico Prof. Giovanni Battista La Sala - Direttore PROGETTO MULTIDISCIPLANARE di PROCREAZIONE MEDICALMENTE ASSISTITA (PMA) e GENITORIALITA

Dettagli

RELAZIONE SUL SISTEMA DI ALLERTA EUROPEO M.G.

RELAZIONE SUL SISTEMA DI ALLERTA EUROPEO M.G. Ministero della Salute RELAZIONE SUL SISTEMA DI ALLERTA EUROPEO M.G. ANNO 2014 2 Il presente rapporto è stato realizzato dalla Direzione Generale per l Igiene e la Sicurezza degli Alimenti e la Nutrizione

Dettagli

IMAGING BIO_MOLECOLARE con DaTSCAN

IMAGING BIO_MOLECOLARE con DaTSCAN IMAGING BIO_MOLECOLARE con DaTSCAN Stelvio Sestini, MD, PhD Unità di Medicina Nucleare - USL4 Prato Università degli Studi di Firenze Concetto 1. Le M. Neurodegenerative sono in aumento Concetto 2. Le

Dettagli

MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA. pertinenza dermatologica. e nei confronti di loro conviventi o contatti

MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA. pertinenza dermatologica. e nei confronti di loro conviventi o contatti MISURE DI PROFILASSI PER ESIGENZE DI SANITA PUBBLICA IN DERMATOLOGIA Fonte: Ministero della Salute Circolare n 4 del 13 marzo 1998 del MINISTERO DELLA SALUTE Provvedimenti da adottare nei confronti di

Dettagli

Definizione di Dispositivo Medico

Definizione di Dispositivo Medico Definizione di Dispositivo Medico Vs Cosmetico Vs prodotto farmaceutico Vs Biocida Vs DPI Definizione di dispositivo medico Qualsiasi strumento,apparecchio, impianto, sostanza od altro prodotto, utilizzato

Dettagli

PROTOCOLLO PER LA SORVEGLIANZA NAZIONALE DELLE MALATTIE INVASIVE DA MENINGOCOCCO, PNEUMOCOCCO ED EMOFILO E DELLE MENINGITI BATTERICHE IN ITALIA

PROTOCOLLO PER LA SORVEGLIANZA NAZIONALE DELLE MALATTIE INVASIVE DA MENINGOCOCCO, PNEUMOCOCCO ED EMOFILO E DELLE MENINGITI BATTERICHE IN ITALIA PROTOCOLLO PER LA SORVEGLIANZA NAZIONALE DELLE MALATTIE INVASIVE DA MENINGOCOCCO, PNEUMOCOCCO ED EMOFILO E DELLE MENINGITI BATTERICHE IN ITALIA Versione 19 settembre 2014 1 PROTOCOLLO 2014: IN EVIDENZA

Dettagli

Lo spessore medio-intimale come marker di rischio cardiovascolare. Qual è il suo significato clinico e come si misura

Lo spessore medio-intimale come marker di rischio cardiovascolare. Qual è il suo significato clinico e come si misura Lo spessore medio-intimale come marker di rischio cardiovascolare. Qual è il suo significato clinico e come si misura Michele Liscio Riassunto L ecocolordoppler dei vasi sovraortici (TSA) rappresenta un

Dettagli

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine

DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine DA PORTO A., NANINO E., DEL TORRE M., SECHI L.A., CAVARAPE A. CLINICA MEDICA - Azienda Ospedaliero-Universitaria S.Maria Misericordia di Udine VITAMINA D: SINTESI, METABOLISMO E CARENZA Il 40-50% della

Dettagli

Dar da mangiare agli affamati. Le eccedenze alimentari come opportunità

Dar da mangiare agli affamati. Le eccedenze alimentari come opportunità Dar da mangiare agli affamati. Le eccedenze alimentari come opportunità Paola Garrone, Marco Melacini e Alessandro Perego Politecnico di Milano Indagine realizzata da Fondazione per la Sussidiarietà e

Dettagli

Straumann Emdogain PRIMA CHE SIA TROPPO TARDI

Straumann Emdogain PRIMA CHE SIA TROPPO TARDI Straumann Emdogain PRIMA CHE SIA TROPPO TARDI CONSERVAZIONE DEL DENTE CON STRAUMANN EMDOGAIN Dal 5 al 15 % della popolazione soffre di gravi forme di parodontite, che possono portare alla caduta dei

Dettagli

Curriculum Vitae Europass

Curriculum Vitae Europass Curriculum Vitae Europass Informazioni personali Nome(i) / Cognome(i) Indirizzo(i) Roberto CARUSO Corso Mazzini, 11-87100 Cosenza, Italia Telefono(i) Tel. + 39 0984681824 Fax+ 39 0984681322 E-mail Cittadinanza

Dettagli

VET 30 6.1 03/2015-IT. Minilaparoscopia. per animali di peso inferiore ai 10 kg

VET 30 6.1 03/2015-IT. Minilaparoscopia. per animali di peso inferiore ai 10 kg VET 30 6.1 03/2015-IT Minilaparoscopia per animali di peso inferiore ai 10 kg Ristabilimento e guarigione più rapidi Un set di strumenti fondamentali per ogni veterinario operante in zoo, in laboratori

Dettagli

group HIGH CURRENT MULTIPLEX NODE

group HIGH CURRENT MULTIPLEX NODE HIGH CURRENT MULTIPLEX NODE edizione/edition 04-2010 HIGH CURRENT MULTIPLEX NODE DESCRIZIONE GENERALE GENERAL DESCRIPTION L'unità di controllo COBO è una centralina elettronica Multiplex Slave ; la sua

Dettagli

Per far sviluppare appieno la

Per far sviluppare appieno la 2008;25 (4): 30-32 30 Maria Benetton, Gian Domenico Giusti, Comitato Direttivo Aniarti Scrivere per una rivista. Suggerimenti per presentare un articolo scientifico Riassunto Obiettivo: il principale obiettivo

Dettagli

Prevenzione e controllo delle infezioni da Clostridium difficile

Prevenzione e controllo delle infezioni da Clostridium difficile GIIO DOCUMENTO DI INDIRIZZO Prevenzione e controllo delle infezioni da Clostridium difficile Il presente documento è frutto della collaborazione di molte persone ed è stato condiviso con gli organi collegiali

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

D-7537-2009. Più vicini che mai all ideale CALEO

D-7537-2009. Più vicini che mai all ideale CALEO D-7537-2009 Più vicini che mai all ideale CALEO 02 Caleo Qual è l ambiente migliore per i neonati pretermine? ARRIVI PRECOCI Quando i bambini nascono prematuri, si ritrovano ad affrontare un mondo pieno

Dettagli

Innovative Procurement Process. Consulting

Innovative Procurement Process. Consulting Creare un rapporto di partnership contribuendo al raggiungimento degli obiettivi delle Case di cura nella gestione dei DM attraverso soluzione a valore aggiunto Innovative Procurement Process Consulting

Dettagli

LE MALATTIE BATTERICHE INVASIVE: PROTOCOLLO OPERATIVO PER LA GESTIONE DI UN CASO DI MALATTIA INVASIVA DA MENINGOCOCCO

LE MALATTIE BATTERICHE INVASIVE: PROTOCOLLO OPERATIVO PER LA GESTIONE DI UN CASO DI MALATTIA INVASIVA DA MENINGOCOCCO LE MALATTIE BATTERICHE INVASIVE: PROTOCOLLO OPERATIVO PER LA GESTIONE DI UN CASO DI MALATTIA INVASIVA DA MENINGOCOCCO INTRODUZIONE Negli ultimi anni si è manifestata una crescente attenzione nei confronti

Dettagli

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM

Ministero della Salute Direzione Generale della Ricerca Scientifica e Tecnologica Bando Giovani Ricercatori - 2007 FULL PROJECT FORM ALLEGATO 2 FULL PROJECT FORM FORM 1 FORM 1 General information about the project PROJECT SCIENTIFIC COORDINATOR TITLE OF THE PROJECT (max 90 characters) TOTAL BUDGET OF THE PROJECT FUNDING REQUIRED TO

Dettagli

Date da 10/2003 a 01/2004 Lavoro o posizione ricoperti Dirigente medico ex I livello, a tempo determinato, Disciplina di Medicina Interna

Date da 10/2003 a 01/2004 Lavoro o posizione ricoperti Dirigente medico ex I livello, a tempo determinato, Disciplina di Medicina Interna Principali attività e medico presso la Medicina e Chirurgia di Accettazione ed Urgenza (MCAU) del Pronto Soccorso Generale P.O. Garibaldi Centro. Attività svolta presso gli ambulatori di Medicina del Pronto

Dettagli

Strutture sanitarie e Socio-assistenziali Autorizzazione e vigilanza

Strutture sanitarie e Socio-assistenziali Autorizzazione e vigilanza Dipartimento di Sanità Pubblica S a l u t e è S a p e r e Azioni di Prevenzione n. 2 28 Strutture sanitarie e Socio-assistenziali Indice Presentazione Strutture Sanitarie Introduzione Contesto Risultati

Dettagli

Igiene Generale ed applicata. Indice. 1 Epidemiologia generale delle malattie infettive ---------------------------------------------------- 3

Igiene Generale ed applicata. Indice. 1 Epidemiologia generale delle malattie infettive ---------------------------------------------------- 3 INSEGNAMENTO DI IGIENE GENERALE ED APPLICATA LEZIONE II EPIDEMIOLOGIA GENERALE DELLE MALATTIE INFETTIVE PROF.SSA DANIELA ANASTASI Indice 1 Epidemiologia generale delle malattie infettive ----------------------------------------------------

Dettagli

I T A L I A N J O U R N A L O F P U B L I C H E A L T H. Epidemiologia, fisiopatologia e diagnosi delle patologie da Candida spp.

I T A L I A N J O U R N A L O F P U B L I C H E A L T H. Epidemiologia, fisiopatologia e diagnosi delle patologie da Candida spp. Epidemiologia, fisiopatologia e diagnosi delle patologie da Candida spp. Chiara de Waure, Chiara Cadeddu, Maria Rosaria Gualano, Giuseppe La Torre, Walter Ricciardi Introduzione Le Candida spp. sono lieviti

Dettagli

NEUROSCIENZE EEDUCAZIONE

NEUROSCIENZE EEDUCAZIONE NEUROSCIENZE EEDUCAZIONE AUDIZIONE PRESSO UFFICIO DI PRESIDENZA 7ª COMMISSIONE (Istruzione) SULL'AFFARE ASSEGNATO DISABILITÀ NELLA SCUOLA E CONTINUITÀ DIDATTICA DEGLI INSEGNANTI DI SOSTEGNO (ATTO N. 304)

Dettagli

RETI DI CALCOLATORI E APPLICAZIONI TELEMATICHE

RETI DI CALCOLATORI E APPLICAZIONI TELEMATICHE RETI DI CALCOLATORI E APPLICAZIONI TELEMATICHE Prof. PIER LUCA MONTESSORO Facoltà di Ingegneria Università degli Studi di Udine 1999 Pier Luca Montessoro (si veda la nota a pagina 2) 1 Nota di Copyright

Dettagli

Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO

Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO Lo Spallanzani (2007) 21: 5-10 C. Beggi e Al. Editoriale VALUTAZIONE PER L E.C.M.: ANALISI DEI QUESTIONARI DI GRADIMENTO IL GRADIMENTO DEI DISCENTI, INDICATORE DI SODDISFAZIONE DELLE ATTIVITÀ FORMATIVE

Dettagli

Contesti ceramici dai Fori Imperiali

Contesti ceramici dai Fori Imperiali Contesti ceramici dai Fori Imperiali a cura di BAR International Series 2455 2013 Published by Archaeopress Publishers of British Archaeological Reports Gordon House 276 Banbury Road Oxford OX2 7ED England

Dettagli

CRITERI PER L ASSEGNAZIONE DI CREDITI ALLE ATTIVITA ECM

CRITERI PER L ASSEGNAZIONE DI CREDITI ALLE ATTIVITA ECM CRITERI PER L ASSEGNAZIONE DI CREDITI ALLE ATTIVITA ECM 1. Introduzione 2. Pianificazione dell attività formativa ECM 3. Criteri per l assegnazione dei crediti nelle diverse tipologie di formazione ECM

Dettagli

Deceduti Regione LOMBARDIA

Deceduti Regione LOMBARDIA Tumore della vescica Di maggior rilievo nei maschi (più di 3/4 dei casi), presenta variazioni geografiche di entità modestissima, minori di ogni altro tipo di carcinoma. Il 9-95% circa è costituito da

Dettagli

I l Cotto Nobile Arrotat o

I l Cotto Nobile Arrotat o I l Cotto Nobile Arrotat o RAPPORTO DI PROVA N. 227338 Data: 25062007 Denominazione campione sottoposto a prova: NOBILE ARROTATO UNI EN ISO 105454:2000 del 30/06/2000 Piastrelle di ceramica. Determinazione

Dettagli

GETINGE DA VINCI SOLUTION

GETINGE DA VINCI SOLUTION GETINGE DA VINCI SOLUTION 2 GETINGE DA VINCI SOLUTION SOLUZIONE ALL AVANGUARDIA, VALIDATA E PREDISPOSTA PER LA CHIRURGIA ROBOTICA Da oltre un secolo, Getinge fornisce costantemente prodotti a elevate prestazioni

Dettagli

Come scrivere un case report - Linee guida per gli internisti FADOI 2014

Come scrivere un case report - Linee guida per gli internisti FADOI 2014 Come scrivere un case report - Linee guida per gli internisti Un case report è una dettagliata narrazione di sintomi, segni, diagnosi, trattamento e follow up di uno o più pazienti. Sebbene nell era della

Dettagli

Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete?

Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete? Fabbisogni vitaminici: ci sono le basi per ri-valutare le specifiche delle diete? Tratto da Vitamin requirements: is there basis for re-evaluating dietary specifications? S. LEESON 1 Tradotto, adattato

Dettagli

Informazioni ai pazienti per colonoscopia

Informazioni ai pazienti per colonoscopia - 1 - Informazioni ai pazienti per colonoscopia Protocollo informativo consegnato da: Data: Cara paziente, Caro paziente, La preghiamo di leggere attentamente il foglio informativo subito dopo averlo ricevuto.

Dettagli

Altre informazioni sul virus HPV: informazioni approfondite per le utenti

Altre informazioni sul virus HPV: informazioni approfondite per le utenti Altre informazioni sul virus HPV: informazioni approfondite per le utenti Questo è un documento di approfondimento sull HPV. Prima di leggerlo consultate il documento Alcune informazioni sul virus HPV

Dettagli

www.zampadicane.it Guida alle Vaccinazioni

www.zampadicane.it Guida alle Vaccinazioni VACCINAZIONI Le vaccinazioni da fare al proprio cane sono parecchie, alcune sono obbligatorie ed alcune facoltative e possono essere consigliate dal veterinario in casi specifici. Vediamo nel dettaglio

Dettagli

Salute intestinale in avicoltura Il mondo interiore

Salute intestinale in avicoltura Il mondo interiore Agosto 2013 Salute intestinale in avicoltura Il mondo interiore Dr. Richard A. Bailey, Poultry Health Scientist Sommario Introduzione Flora Intestinale Mantenere in equilibrio la salute intestinale Conclusioni

Dettagli