Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:



1 170 GIMMOC Vol. VIII N 3, 2004 Giornale Italiano di Microbiologia Medica Odontoiatrica e Clinica Vol. VIII, N 3, 2004 p Organo ufficiale della S.I.M.M.O.C. Copyright 2004 Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles M. Corrente 1, M. Totaro 1, G. Greco 1, E. Tarsitano 1, A. Madio 1, K.G. Friedrich 2, M. Campolo 1, C. Buonavoglia 1 *Autore di riferimento: M. Corrente Riassunto: Nel presente studio 22 ceppi di Salmonella del Giardino Zoologico (Bioparco) di Roma e di proprietà privata sono stati sierotipizzati e testati per la sensibilità a 15 antibiotici. Inoltre sono stati ricercati mediante PCR i geni di patogenicità fim, inva e spvc e i geni che codificano per le integrasi (int 1, 2, 3 e 4). Diciassette sierotipi sono risultati appartenere a Salmonella enterica subspecie enterica e 4 ceppi alla sottospecie IIIa, mentre 1 ceppo è risultato non tipizzabile. Diciotto ceppi sono risultati resistenti a 2 o più antibiotici. In particolare, la maggior parte dei ceppi è risultata resistente al sulfametossazolo (21 su 22) alla streptomicina (14) e alla colistina solfato (11). Per quanto concerne la PCR, è stato evidenziato che tutti i ceppi erano in possesso dei geni fim e inva e 3 ceppi, appartenenti a Salmonella subsp. IIIa, del gene spvc. Inoltre 11 ceppi sono risultati positivi per int 1, 2 stipiti per int 2, nessun ceppo per int 3 e 4. La presenza di caratteri di patogenicità nei ceppi analizzati conferma la potenzialità dei rettili a trasmettere l infezione all uomo e ribadisce la necessità di una corretta informazione sulle norme igieniche da osservare durante la manipolazione di tali animali. Inoltre la diffusione di elementi di antibiotico-resistenza sottolinea che il trattamento antibiotico degli animali, che raramente dà la sterilizzazione batteriologica, è da considerarsi dannoso. Summary: In this survey 22 Salmonella strains isolated from reptiles housed in the Bioparco in Rome or belonging to private owners were serotyped and tested for susceptibility to 15 antimicrobials. Pathogenicity and antimicrobial resistance genes such as fim, inva, spvc and int 1, 2 3 and 4 were investigated by PCR. Seventeen Salmonella enterica subsp. enterica and 4 serotypes Salmonella subsp. IIIa were found. One strain was untypeable. Eighteen strains were found to be resistant to two or more antimicrobials. Most strains were resistant to sulfamethoxazole (21 out 22 strains) to streptomycin (14) and to colistin sulfate (11). The genes fim and inv A were found in all the strains, while 3 strains were positive to the PCR for the gene spvc. Eleven strains were shown to possess int 1 gene, and 2 strains int 2. Int 3 and 4 were not found. The presence of pathogenicity genes highlights that the strains isolated from reptiles are able to transmit the infection to humans. Furthermore, as some characters of antimicrobial resistance are diffused among those strains, antibiotic treatment of Salmonella carriers should be avoided and good hygiene practices during animal handling should be recommended. INTRODUZIONE La salmonellosi è considerata uno dei più importanti problemi di salute pubblica. L uomo si infetta principalmente attraverso il consumo di alimenti di origine animale [Turnbull, 1979]; tuttavia, il contatto con i rettili sta assumendo un peso crescente nel determinismo dell infezione, in relazione alla loro diffusione come animali da compagnia [Woodward et al, 1997; Willis et al, 2002]. Gli animali a sangue freddo sono infatti reservoirs di diversi sierotipi di salmonelle [Chiodini e Sundberg, 1981]. Negli ultimi anni numerosi casi di salmonellosi correlati alla presenza di rettili nelle abitazioni dei pazienti, o legati al contatto con proprietari di rettili, sono stati segnalati dal Centers for Disease Control [CDC 1992a, 1992b, 1999, 2003]. Nei rettili allevati in cattività è molto frequente l isolamento di S. enterica subspecie enterica (I), che annovera i sierotipi più frequentemente isolati in corso di salmonellosi nell uomo [Geue e Lor- 1 Dipartimento di Sanità e Benessere animale, Facoltà di Medicina Veterinaria, Università di Bari. 2 Servizio Veterinario del Bioparco, Roma.

2 GIMMOC Vol. VIII N 3, schner, 2002]. Tuttavia, anche altri stipiti e appartenenti a S. bongori e S. enterica subsp. IIIa e IIIb, sono stati messi in relazione con episodi di malattia nell uomo [Pignato et al, 1998]. Nei rettili le salmonelle non sembrano avere un ruolo patogeno primario; solo in animali in cattive condizioni di salute possono provocare malattia, alla stregua di altri enterobatteri presenti nell intestino [Chiodini e Sundberg, 1981]. Per converso, i casi segnalati nell uomo evidenziano che i ceppi isolati dai rettili possono conservare le caratteristiche di patogenicità. Studi condotti su animali da laboratorio hanno dimostrato infatti che alcuni ceppi isolati da coccodrilli sono dotati di proprietà invasive [Madsen et al, 1998]. Queste caratteristiche sarebbero conferite da alcuni geni, organizzati nelle cosiddette isole di patogenicità delle salmonelle (SPI) [Bäumler et al, 1998]. Negli stadi iniziali dell infezione sono importanti i geni che codificano per le fimbrie, che promuovono l adesione dei batteri alla mucosa intestinale [Bäumler et al, 1998]. Tra questi si annovera il gene fim, che produce fimbrie di I tipo, racchiuso nella SPI 1. La capacità di dare infezione sistemica negli animali a sangue caldo è dovuta invece ad altri geni, come inva, appartenente alla SPI 1, che promuove l internalizzazione delle salmonelle nelle cellule e ai geni della SPI 2, tra cui spv (plasmide di virulenza in salmonella) [Bäumler, 1997]. Nel quadro evolutivo degli enterobatteri l acquisizione di tali geni si sarebbe verificata relativamente di recente, consentendo la diversificazione delle salmonelle da altri enterobatteri a partire da un progenitore comune. In particolare, l acquisizione della SPI 1 avrebbe causato la divergenza tra Salmonella bongori, che è considerata la specie ancestrale delle salmonelle, e Escherichia coli. In una seconda fase, sarebbe comparsa la SPI 2 e con essa gli altri sierotipi di Salmonella. L analisi di questi geni riveste dunque un ruolo importante nello studio della filogenesi delle salmonelle [Bäumler et al, 1998]. Un altro aspetto importante riguarda la sensibilità agli antibiotici delle salmonelle isolate dai rettili. Nel tentativo di eliminare le salmonelle dall intestino, gli animali portatori possono essere trattati con antibiotici. Questa prassi, impiegata soprattutto in passato, potrebbe aver favorito l insorgenza di caratteri di antibiotico-resistenza [Johnson-Delaney, 1996]. Sono note infatti le capacità delle salmonelle di rispondere alla pressione selettiva degli antibiotici con la selezione di ceppi resistenti, e la facilità con cui questi batteri scambiano materiale genetico. Questa prerogativa, condivisa da altri batteri Gram negativi, è legata anche all esistenza di frammenti mobili del genoma, definiti integroni, specializzati nel veicolare caratteri di resistenza agli antibiotici. E stato stimato che questi segmenti possono contenere sino a 60 geni diversi che codificano per tali resistenze [Carattoli, 2001]. Sono state descritte 4 classi di integroni, ma i più diffusi sono gli integroni di classe 1 [Goldstein et al, 2001]. La presenza di questi geni è un indicatore della potenzialità delle salmonelle ad acquisire caratteri di antibiotico-resistenza, soprattutto in virtù della loro permanenza nell intestino dei rettili come flora saprofitica. Sulla scorta di queste considerazioni, alcuni sierotipi di Salmonella spp. isolati da diverse specie di rettili allevati presso un giardino zoologico e di proprietà privata sono stati analizzati per quanto concerne alcuni caratteri di patogenicità. I ceppi sono stati inoltre saggiati per la sensibilità in vitro ad alcuni antibiotici e per la presenza di geni relativi agli integroni. MATERIALI E METODI Ceppi: Sono stati esaminati 18 ceppi isolati da diverse specie di rettili del Giardino Zoologico di Roma (Bioparco) e 4 stipiti appartenenti a privati (Tabella I). L isolamento è stato effettuato dalle feci utilizzando il protocollo standard per l isolamento di salmonelle da matrici alimentari [ISO 6579, Anon 1993] con qualche modifica [Corrente et al, 2004]. I ceppi sono stati Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles

3 172 GIMMOC Vol. VIII N 3, 2004 Corrente et al. Tabella I Sierotipi di Salmonella, resistotipi e analisi mediante PCR di geni di patogenicità e antibiotico-resistenza Campione Animale Provenienza Sierotipo Resistotipo PCR fim inv A Spv C Int 1 Int 2 Int 3 Int /02 Serpente del grano Bioparco S. Newport Cs Smx a 59/02 Camaleonte S. Muenster Amp C Cs Kf S Smx Te /02 Camaleonte S. Senftenberg Cs S Smx Te /02 Camaleonte S. Gaminara Amp C Cs S Smx Te a 67/02 Pitone S. Aqua Smx b 67/02 Tartaruga S. Senftenberg Smx /02 Lucertola S. Senftenberg S Smx /02 Basilisco S. Senftenberg S Smx /02 Cervone S. Newport Smx a 72/02 Lucertola ocellata S. Give S Na Smx b 72/02 Tartaruga S. Poona Cs Na Smx Sxt a 72/02 Eloderma sospetto S. subsp. IIIa (O 48) Na S Smx /02 Varano del Nilo S. Senftenberg Cs a 72/02 Tartaruga S. subsp. IIIa (O 48 ) S Smx Sxt a 72/02 Camaleonte S. Gbadago S Smx a 101/02 Lucertola S. Minnesota Amp Na Smx Te b 101/02 Lucertola ocellata S. Minnesota Amp Cs Na Smx Te /02 Camaleonte S. Oldenburg Amp C Cs S Smx Te /03 Iguana Privato S. subsp. IIIa (O 17 ) S Smx /03 Iguana Non tipizzabile Cs Na S Smx /02 Lucertola S. Havana Cs Na S Smx /02 Pitone S. subsp. IIIa RF Cs S Smx Antibiotici saggiati: Acido nalidixico (Na), ampicillina (Amp), amoxicillina+ clavulanico (Aug), cefalotina (Kf), ceftazidime (Caz), ciprofloxacin (Cip), cloramfenicolo (C), colistina solfato (Cs), cotrimossazolo (Sxt), gentamicina (Gn), neomicina (N), norfloxacin (Nor), streptomicina (S), sulfametossazolo (Smx), tetraciclina (Te).

4 GIMMOC Vol. VIII N 3, quindi identificati con il sistema api 20E (Biomérieux, Mercy l Etoile, Francia), mediante agglutinazione rapida su vetrino con sieri polivalenti O e H ( Biotech Laboratories, Ipswich Suffolk, UK) e tipizzati con lo schema di Kauffmann- White [Zavanella 2001], presso l Istituto Zooprofilattico di Brescia. Ceppi di referenza: per standardizzare le tecniche sono stati utilizzati 2 ceppi ATCC: S. typhimurium e S. arizonae 13314, acquistati presso la Biogenetics (Padova). Prove di sensibilità in vitro: i ceppi sono stati testati con la tecnica della diffusione in agar, seguendo le direttive del National Committee on Clinical Laboratory Standard [NCCLS 1999] per la sensibilità verso i seguenti antibiotici (concentrazione dei dischetti in µg, Liofilchem, Roseto degli Abruzzi, Te): acido nalidixico (30), ampicillina (10), amoxicillina +acido clavulanico (30), cefalotina (30), ceftazidime (30), ciprofloxacin (5), cloramfenicolo (30), colistina sulfato (10), co-trimossazolo (25), gentamicina (10), neomicina (30), norfloxacin (10), streptomicina (10), sulfametossazolo (50), tetraciclina (30). Estrazione del DNA: I ceppi sono stati seminati in Brain Heart Infusion (Oxoid, Milano) e incubati overnight a 37 C. Un millilitro di brodocoltura di ciascun ceppo è stato sottoposto al protocollo di estrazione del kit QIAmp Tissue (QIAGEN GmbH, Germania). Pcr: Le tecniche di PCR sono state effettuate utilizzando il DNA Thermal Cycler Gene Amp 9600 (Perkin Elmer Cetus, Norwalk, CT, USA). I campioni sono stati saggiati con i primers indicati nella tabella II [Cohen et al, 1996; Khan et al, 2000; Goldstein et al, 2001]. Cinque microlitri di DNA di ogni campione sono Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles Tabella II Primers utilizzati nelle reazioni di PCR. Primers Sequenza Temperatura di Riferimento (Forward e Reverse) annealing ( C) bibliografico Fim Inv A Spv C Int 1 Int 2 Int 3 Int 4 F:CCTTTCTCCATCGTCCTG R: TGGTGTTATCTGCCTGACCA 58 Cohen et al. (1996) F: CGCGGCCCGATTTTCTCTGGA R:AATGCGGGGATCTGGGCGACAAG 67 Khan et al F:GGGGCGGAAATACCATCTACA R:GCGCCCAGGCTAACACG 60 Khan et al F:CCTCCCGCACGATGATC R:TCCACGCATCGTCAGGC 65 Goldstein et al F.TTATTGCTGGGATTAGGC R:ACGGCTACCCTCTGTTATC 60 Goldstein et al F:AGTGGGTGGCGAATGAGTG R:TGTTCTTGTATCGGCAGGTG 60 Goldstein et al F:CGGTATGTCTAATTGCTCTTG R: TGGCCACAAAGACTCAATCAC 60 Goldstein et al. 2001

5 174 GIMMOC Vol. VIII N 3, 2004 Corrente et al. stati aggiunti alla miscela di reazione così costituita: PCR buffer (10X), 1.5 mm Mg Cl 2, 200 µm di ogni nucleotide trifosfato, 0.1 mm di ogni primer, 2.5 U di Amplitaq Gold Polymerase (Perkin Elmer Cetus Norwalk, USA) e H 2 O distillata sino a raggiungere un volume finale di 50 µl. Le miscele di reazione sono state sottoposte a 1 ciclo iniziale di denaturazione a 94 C per 8 minuti, seguite da 35 cicli di amplificazione, ciascuno di 1 minuto di denaturazione a 94 C, 1 minuto di annealing, a temperature diverse per ogni coppia di primers ( tabella II), 2 minuti di estensione a 72 C, 1 ciclo finale di 8 minuti a 72 C. I prodotti di PCR sono stati visualizzati mediante corsa elettroforetica su gel di agarosio al 2 % colorato con etidio bromuro, con l ausilio del CHEMIDOC (Bio-rad, Milano). RISULTATI I risultati sono riassunti nella tabella I. La sierotipizzazione ha messo in evidenza 21 stipiti appartenenti alla specie S. enterica, di cui 17 appartenenti a S. enterica subspecie I e 4 a S. enterica subspecie IIIa. La tipizzazione non è stata possibile per 1 ceppo, isolato da un iguana. Le prove di sensibilità in vitro hanno permesso di evidenziare la resistenza ad alcuni antibiotici nei sierotipi di Salmonella saggiati. La maggior parte dei ceppi è risultata resistente al sulfametossazolo (21 su 22 ceppi), alla streptomicina (14) alla colistina solfato (11). Sette ceppi sono risultati resistenti all acido nalidixico, 6 alla tetraciclina, 5 all ampicillina, 3 al cloramfenicolo e 2 al cotrimossazolo. Solo 1 stipite è risultato resistente alla cefalotina. Per converso, nessuno dei ceppi è risultato resistente a norfloxacin, ciprofloxacin, amoxicillina +clavulanico, ceftazidime, gentamicina, neomicina. Secondo la definizione adottata da Dargatz et al [2003], 18 ceppi sono risultati multiresistenti, cioè resistenti a due o più antibiotici. In particolare 9 ceppi sono risultati resistenti a 4 o più antibiotici. Per quanto concerne l analisi dei caratteri di patogenicità, tutti i ceppi saggiati sono risultati positivi alla PCR per i geni fim e inva, mentre in 3 ceppi appartenenti a Salmonella subsp. III A, è stato messo in evidenza il gene spvc. Le reazioni di amplificazione dei tratti relativi alle integrasi hanno dato i seguenti risultati: 11 ceppi sono risultati positivi per il frammento int 1 e 2 ceppi positivi per int 2. Nessun campione è risultato positivo alla PCR per i frammenti int 3 e int 4. DISCUSSIONE Precedenti indagini svolte in USA e in Europa hanno messo in evidenza che l isolamento di salmonelle dai rettili è molto frequente [Johnson-Delaney, 1996; Pasmans et al. 2000; Geue and Lorschner 2002; Pasmans et al. 2002]. In una recente indagine effettuata sugli animali del rettilario del Bioparco di Roma è stata riscontrata una prevalenza del 50.5% [Corrente et al, 2004]. La sierotipizzazione dei ceppi analizzati nel presente studio ha messo in evidenza che non sempre i rettili albergano sierotipi esotici, soprattutto se mantenuti in cattività. Inoltre in alcuni animali è stato isolato S. Senfentberg, un sierotipo particolarmente termoresistente [Murphy et al, 1999]. A tale proposito, occorre ricordare che si sono verificati casi di salmonellosi anche in individui che non avevano avuto un contatto diretto con il rettile portatore. Nel 1996, durante una esibizione a scopo didattico in uno zoo, un rettile utilizzato per un esibizione ha trasmesso la salmonellosi a 39 bambini, sebbene nessuno di questi avesse toccato l animale [Friedman et al. 1998]. Nel tentativo di spiegare come mai le salmonelle non siano patogene per i rettili, alcuni autori hanno sottolineato che questi animali hanno un sistema immunitario più rudimentale rispetto agli animali a sangue caldo. In particolare, l assenza di stazioni linfatiche periferiche organizzate come le placche del Peyer, o di linfonodi veri e propri, innescherebbe una sorta di tolleranza del sistema immunitario verso gli stimoli antigenici a livello intestinale, consentendo alle salmonelle di diventare batteri commensali [Bäumler et al, 1998]. Tuttavia, è stato evidenziato anche nella nostra in-

6 GIMMOC Vol. VIII N 3, dagine che a fronte della varietà di sierotipi isolati, un denominatore comune di tali ceppi è la presenza di geni che codificano per alcuni caratteri di patogenicità. Come in altri studi, il gene spvc è stato evidenziato solo nei sierotipi di Salmonella subsp. IIIa, mentre i geni inva e fim si sono dimostrati ubiquitari [Chiu e Jonathan, 1996; Hudson et al, 2000; Khan et al, 2000]. La presenza di tali geni ribadisce la necessità di considerare questi animali come potenziale fonte di salmonellosi. Inquadrate in tale ottica, appaiono pienamente giustificate le raccomandazioni dei CDC, che consiglia di adottare norme igieniche scrupolose durante la manipolazione di tali animali, e invita a non entrare in possesso di rettili se in casa ci sono bambini di età inferiore a 5 anni, anziani o individui immunocompromessi [CDC 2003]. Infatti in queste categorie la salmonellosi provocata da rettili può essere letale [Weinstein et al, 1995]. Presso il Bioparco è in atto dal 1998 un programma di prevenzione che, per ridurre il rischio d infezione da Salmonella, preconizza il controllo sanitario del personale e degli animali, una procedura dettagliata da seguire durante la manipolazione dei rettili, e il divieto d impiego di tali animali nell ambito di attività didattiche (Friedrich et al, 2000). I ceppi isolati hanno mostrato un elevata percentuale di antibiotico-resistenza, non soltanto verso i presidi terapeutici che di solito sono utilizzati in queste specie animali. E interessante notare che molti ceppi sono risultati multiresistenti, con pattern di resistenza parzialmente sovrapponibili a quelli dei ceppi isolati dall uomo in Europa [Threlfall et al, 1998], facendo ipotizzare che la coabitazione con l uomo o con altre specie animali può favorire lo scambio di ceppi. Inoltre è stata messa in evidenza la presenza di geni relativi agli integroni anche in ceppi che non esprimevano un fenotipo antibiotico-resistente. In particolare molti ceppi veicolavano il gene Int 1, relativo agli integroni di classe 1. Questo frammento mobile, che veicola tra gli altri i geni per la resistenza ai sulfamidici e ad alcuni disinfettanti, risulta essere largamente diffuso nei Gram negativi [Guerra et al 2000; Goldstein et al 2001]. Nel genere Salmonella, come in altri Enterobatteri, i meccanismi di trasferimento genetico intra e inter specifico sono molto frequenti. Gli integroni, saltando da un batterio all altro causano la resistenza multipla, fenomeno caratterizzato dalla comparsa di resistenze verso diversi antibiotici, non necessariamente utilizzati nella terapia o nella chemioprofilassi [Carattoli, 2001]. La somministrazione di antibiotici a scopo profilattico è da considerarsi inutile per diversi motivi: i) è raro ottenere la sterilizzazione batteriologica dei soggetti [Johnson-Delaney, 1996]; ii) essendo i rettili eliminatori intermittenti, risulta difficile evidenziare tramite l esame batteriologico se c è stata l effettiva eliminazione di tali germi dall intestino; iii) la potenzialità dei ceppi di Salmonella ad acquisire caratteri di antibiotico-resistenza fa ritenere che questi trattamenti sono non solo inutili ma anche dannosi. Per minimizzare il rischio di trasmissione di salmonelle dai rettili all uomo, i medici veterinari devono: a) formare in maniera adeguata il personale addetto alla manipolazione dei rettili; b) fornire una corretta informazione sui rischi sanitari ai proprietari privati; c) garantire l osservanza di norme di profilassi sanitaria (Bradley et al, 1998). BIBLIOGRAFIA Anon. ISO Microbiology-General guidance on methods for the Detection of Salmonella, 3 rd edn Case Postale 56, CH Genève 20, Switzerland Bäumler A.J. The record of horizontal gene transfer in Salmonella. Trends Microbiol., 5 (8): , Bäumler A.J., Tsolis R.M., Ficht T.A., Adams L.G. Evolution of Host Adaptation in Salmonella enterica. Infect. Immun., 66: , Bradley T., Angulo F.J., Raiti P. Association of reptilian and amphibian veterinarians guidelines for reducing risk of transmission of Salmonella spp. from reptiles to humans. J. Am. Vet. Med. Assoc., 213: 51-52, Analisi di caratteri di patogenicità e antibiotico-resistenza in ceppi di Salmonella Characters of pathogenicity and antimicrobial resistance of Salmonella strains isolated from reptiles

7 176 GIMMOC Vol. VIII N 3, 2004 Corrente et al. Carattoli A. Importance of integrons in the diffusion of resistance. Vet. Res Centers for Disease Control Iguana-associated salmonellosis. Morbid. Mortal. Weekly. Rep., 41: 38-39, 1992a. Centers for Disease Control Lizard-associated salmonellosis. Morbid. Mortal. Weekly. Rep., 41: , 1992b. Centers for Disease Control. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 48: , Centers for Disease Control. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 52: , Chiodini R.J., Sundberg J.P. Salmonellosis in reptiles: a review. Am. J. Epidemiol., 113: , Chiu C.-H., Jonathan T.O. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, inva and spvc, by an enrichment broth culture-multiplex PCR combination assay. J. Clin. Microbiol., 34 (10): , Cohen H.J., Mechanda S.M., Lin W. PCR amplification of the fima gene sequence of Salmonella typhimurium, a specific method for detection of Salmonella spp. Appl. Environ. Microbiol., 62 (12): , Corrente M., Madio A., Friedrich K.G., et al. Isolation of Salmonella strains from reptile faeces and comparison of different culture media. J. Appl. Microbiol., 96: , Dargatz D.A., Fedorka-Cray P.J., Ladely S.R., et al. Prevalence and antimicrobial susceptibility of Salmonella spp. isolates from US cattle in feedlots in 1999 and J. Appl. Microbiol., 95: , Friedman C.R., Torigian C., Shillam P.J., et al. An outbreak of salmonellosis among children attending a reptile exhibit at a zoo. J. Pediatr., 132: , Friedrich K.G., Magrini L., Puppini F. Rischi sanitari nei lavoratori dei Giardini Zoologici e Parchi Naturali. G. Med. Mil. 150: 1-6, Geue L., Löschner U. Salmonella enterica in reptiles of German and Austrian origin. Vet. Microbiol., 84: 79-91, Goldstein C., Lee M.D., Sanchez S., Hudson C., et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob. Agents Chemother., 45 (3): , Guerra B., Soto S., Cal S., Mendoza C. Antimicrobial resistance and spread of class 1 integrons among Salmonella serotypes. Antimicrob. Agents Chemother., 44 (8): , Hudson C.R., Quist C., Lee M.D., et al. Genetic relatedness of Salmonella isolates from nondomestic birds in Southeastern United States. J. Clin. Microbiol., 38 (5): , Johnson-Delaney C.A. Reptiles zoonoses and Threats to Public Health. In Reptile Medicine and Surgery ed. Mader, D.R. pp Philadelphia: WB Saunders Company Khan A.A., Nawaz M.S., Khan S.A., Cerniglia C.E. Detection of multidrug-resistant Salmonella Typhimurium DT104 by multiplex polymerase chain reaction. FEMS Microbiol. Lett., 182: , Madsen M., Hangartner P., West K., Kelly P. Recovery rates, serotypes and antimicrobial susceptibility patterns of salmonellae isolated from cloacal swabs of wild Nile crocodiles (Crocodylus niloticus) in Zimbabwe. J. Zoo Wildl. Med., 29: 31-34, Murphy R.Y., Marks B.P., Johnson E.R., Johnson M.G. Inactivation of Salmonella and Listeria in ground chicken breast meat during thermal processing. J. Food Prot., 62: , National Committee on Clinical Laboratory Standards (NCCLS) Performance Standards for Antimicrobial Susceptibility Tests for bacteria isolated from Animals. Approved standard. NC- CLS document M31-A. Wayne, P.A.: National Committee on Clinical Laboratory Standards Pasmans F., De Herdt P., Chasseur-Libotte M.L., Ballasina D. L. Ph., Haesebrouck F. Occurrence of Salmonella in tortoises in a rescue centre in Italy. Vet. Rec.,146: , Pasmans F., De Herdt P., Haesebrouck F. Presence of Salmonella infection in Freshwater turtles. Vet. Rec., 150: , Pignato S., Giammanco G., Santangelo C., Giammanco G.M. Endemic presence of Salmonella bongori 48: z35:- causing enteritis in children in Sicily. Res. Microbiol., 149: , Threlfall E.J., Fischer I.S.T., Berghold C., et al. Antimicrobial drug resistance in isolates of Salmonella enterica from cases of salmonellosis in humans in Europe: results of international multi-centre surveillance. Eurosurveillance. 8: 41-45, Weinstein J.W., Seltzer E.G., Nelson R.S. Reptile-associated salmonellosis-selected states, Morbid. Mortal. Weekly. Rep., 44: , Turnbull P.C.B. Food poisoning with special reference to Salmonella-its epidemiology, pathogenesis and control. Clin. Gastroenterol. 8: , Willis C., Wilson T., Greenwood M., Ward L. Pet reptiles associated with a case of salmonellosis in an infant were carrying multiple strains of Salmonella. J. Clin. Microbiol., 40: , Woodward D.L., Khakhria R., Johnson W.M. Human salmonellosis associated with exotic pets. J. Clin. Microbiol., 35: , Zavanella M. Schema di Kaufmann-White aggiornato. In Tipizzare le Salmonelle. pp Brescia (Italy): Fondazione iniziative Zooprofilattiche e Zootecniche

Aggiornamento relativo a recenti e prossime modifiche della norma ISO 6579

Aggiornamento relativo a recenti e prossime modifiche della norma ISO 6579 I Riunione ENTER-VET Legnaro, 17 dicembre 2014 Aggiornamento relativo a recenti e prossime modifiche della norma ISO 6579 Progressi nella revisione della ISO 6579 Microbiology of the food chain Horizontal


Tesi di Laurea. FACOLTÀ DI MEDICINA E CHIRURGIA Corso di laurea in Tecniche di Laboratorio Biomedico



PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica


Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona





Polymerase Chain Reaction - PCR

Polymerase Chain Reaction - PCR Polymerase Chain Reaction - PCR Real-Time PCR Saggio Saggio di PCR monitorato di continuo Tubi Tubi chiusi Nessuna analisi post PCR Nessuna elettroforesi Caratterizzazione del prodotto Possibilità di quantificare


Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B Diagnosi e tipizzazione di IPD in biologia molecolare direttamente da campione clinico in pazienti con terapia antibiotica in atto Cristina Massai Clinica Pediatrica II Ospedale Meyer Università di Firenze


Campylobacter spp. e Igiene degli Alimenti. Valerio Giaccone Dipartimento di Sanità pubblica, Patologia comparata e Igiene veterinaria di Padova

Campylobacter spp. e Igiene degli Alimenti. Valerio Giaccone Dipartimento di Sanità pubblica, Patologia comparata e Igiene veterinaria di Padova Campylobacter spp. e Igiene degli Alimenti Valerio Giaccone Dipartimento di Sanità pubblica, Patologia comparata e Igiene veterinaria di Padova Famiglia Campylobacteraceae tre generi: Campylobacter, Arcobacter,


Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è


Staffolani M 1, Medici L 1, Luzzi I 2, Dionisi AM. 2, Reggiani M.C 3, Fisichella S 1

Staffolani M 1, Medici L 1, Luzzi I 2, Dionisi AM. 2, Reggiani M.C 3, Fisichella S 1 4 Istituto Zooprofilattico Sperimentale dell'umbria e delle Marche Webzine Sanità Pubblica Veterinaria: Numero 56 Ottobre 2009 [] ISSN 592-58 MOLECULAR CHARACTERIZATION OF STRAINS OF


Controllo e monitoraggio della sicurezza e qualità

Controllo e monitoraggio della sicurezza e qualità Strategie innovative rispondenti ai bisogni delle imprese nel comparto degli ortofrutticoli della IV gamma - STAYFRESH Controllo e monitoraggio della sicurezza e qualità Chiara Gorni, Donatella Allemand,


IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino

IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino Torino 17 febbraio 2016 RISULTATI DI 11 ANNI DI ATTIVITÀ (2005-2015)


Aggiornamenti sulle attività svolte recentemente dal NRL Salmonella nell ambito della sorveglianza di S. 4,5,12:i:-

Aggiornamenti sulle attività svolte recentemente dal NRL Salmonella nell ambito della sorveglianza di S. 4,5,12:i:- Aggiornamenti sulle attività svolte recentemente dal NRL Salmonella nell ambito della sorveglianza di S. 4,5,12:i:- Lisa Barco Torino, 21 maggio 2014 PROGETTO: Caratterizzazione di isolati di S. Typhimurium


MISURA 215 ANNATA 2015/2016

MISURA 215 ANNATA 2015/2016 Prevenzione delle mastiti infettive degli ovini e dei caprini: Immunologia della mammella, antibiotico resistenza e ruolo della profilassi immunizzante MISURA 215 ANNATA 2015/2016 L'ANTIBIOTICO


L introduzione della biologia molecolare nei laboratori di microbiologia alimentare: l esperienza del Laboratorio di riferimento Europeo per E.

L introduzione della biologia molecolare nei laboratori di microbiologia alimentare: l esperienza del Laboratorio di riferimento Europeo per E. L introduzione della biologia molecolare nei laboratori di microbiologia alimentare: l esperienza del Laboratorio di riferimento Europeo per E. coli Stefano Morabito EU Reference Laboratory for E. coli


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA


centrale (CNS) causata dall infezione litica degli oligodendrociti da parte del Polyomavirus JC (JCPyV). Ad

centrale (CNS) causata dall infezione litica degli oligodendrociti da parte del Polyomavirus JC (JCPyV). Ad RESOCONTO ATTIVITÀ DI RICERCA ANNO 2013 Studio dell espressione di fattori virali e cellulari implicati nella replicazione del Polyomavirus umano JC Responsabile scientifico: Dr. Simone Giannecchini, Dipartimento


Controllo e monitoraggio della sicurezza e qualità

Controllo e monitoraggio della sicurezza e qualità Strategie innovative rispondenti ai bisogni delle imprese nel comparto degli ortofrutticoli della IV gamma STAYFRESH Controllo e monitoraggio della sicurezza e qualità Chiara Gorni, Donatella Allemand,



SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:



I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE. Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino I RISULTATI DELL ATTIVITÀ DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia AOU San Giovanni Battista di Torino Sorveglianza delle malattie batteriche invasive Diagnosi di laboratorio


Enter-Net Italia: La sorveglianza nazionale delle infezioni trasmesse da alimenti. Alfredo Caprioli

Enter-Net Italia: La sorveglianza nazionale delle infezioni trasmesse da alimenti. Alfredo Caprioli Contenimento e controllo delle MTA - Roma, 28 Maggio 2013 Enter-Net Italia: La sorveglianza nazionale delle infezioni trasmesse da alimenti Alfredo Caprioli EU Reference Laboratory for Escherichia coli


Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio


Metodiche tradizionali

Metodiche tradizionali Diagnostica microbiologica innovativa INTRODUZIONE Attualmente, per la rilevazione dei microrganismi patogeni accanto alle metodiche tradizionali rappresentate: dall esame colturale, l esame diretto al


Aspetti microbiologici della sorveglianza nazionale della malattia invasiva da H. Influenzae

Aspetti microbiologici della sorveglianza nazionale della malattia invasiva da H. Influenzae Roma, 26-27 Novembre 2014 Roma, 28-29 Febbraio 2012 Aspetti microbiologici della sorveglianza nazionale della malattia invasiva da H. Influenzae MARINA CERQUETTI Marina Cerquetti Dipartimento di Malattie



PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA


Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine


PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in


Metodi di laboratorio nel controllo microbiologico degli alimenti: classici ed innovativi

Metodi di laboratorio nel controllo microbiologico degli alimenti: classici ed innovativi Metodi di laboratorio nel controllo microbiologico degli alimenti: classici ed innovativi Torino, 10-11 Giugno 2013 S.S. Laboratorio Controllo Alimenti 1 Aspetti normativi Cosa tratteremo



TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi


BEN - Notiziario ISS - Vol.14 - n.11 Novembre 2001

BEN - Notiziario ISS - Vol.14 - n.11 Novembre 2001 BEN - Notiziario ISS - Vol.14 - n.11 Novembre 2001 L allontanamento dalla frequenza scolastica come misura di controllo delle malattie infettive. revisione dell evidenza. La sorveglianza delle infezioni


Misure di prevenzione e controllo delle infezioni da CPE Indicazioni del Ministero della Salute

Misure di prevenzione e controllo delle infezioni da CPE Indicazioni del Ministero della Salute Klebsiella pneumoniae resistente ai carbapenemi: un problema emergente di sanità pubblica Roma, 5 giugno 2012 - ISTITUTO SUPERIORE DI SANITA' Misure di prevenzione e controllo delle infezioni da CPE Indicazioni


ONCOLOGIA OGGI Animali e Uomo Alleati Contro i Tumori

ONCOLOGIA OGGI Animali e Uomo Alleati Contro i Tumori ONCOLOGIA OGGI Animali e Uomo Alleati Contro i Tumori Venerdì 12 giugno 2009 ore 08.30 14.00 COMUNE DI ROMA Palazzo Senatorio- Aula Giulio Cesare P.zza del Campidoglio - Roma LE BIOBANCHE IN MEDICINA VETERINARIA





Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione


Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo

Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo EPATITE B: DIAGNOSI. Il Laboratorio GA Niro, A Andriulli Divisione di Gastroenterologia - Casa Sollievo della Sofferenza- IRCCS San Giovanni Rotondo La descrizione del meccanismo replicativo del virus



ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre



TRASMISSIONE VERTICALE DI HCV METODO NAZIONALE STANDARD ALGORITMO MINIMO DI PROVA VSOP 8 Emesso da Standards Unit, Evaluations and Standards Laboratory Centre for Infections Revisione no: 1 Data di revisione: 21.11.07 Emesso da: Standards


Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi



EPIDEMIOLOGIA DELLE INFEZIONI CORRELATE ALL ASSISTENZA EPIDEMIOLOGIA DELLE INFEZIONI CORRELATE ALL ASSISTENZA 1 INTRODUZIONE 2 Le infezioni correlate all assistenza (ICA) rappresentano una complicanza frequente. In media il 5-10% dei pazienti ricoverati in


PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA


Campylobacter: ancora un patogeno emergente?

Campylobacter: ancora un patogeno emergente? Campylobacter: ancora un patogeno emergente? Ludovico DIPINETO Dipartimento di Medicina Veterinaria e Produzioni Animali Università degli Studi di Napoli Federico II Campylobacter Batteri appartenenti


Attuale spazio terapeutico per le cefalosporine orali in pediatria. N. Principi

Attuale spazio terapeutico per le cefalosporine orali in pediatria. N. Principi Attuale spazio terapeutico per le cefalosporine orali in pediatria N. Principi Attuale spazio terapeutico per le cefalosporine orali in pediatria Nicola Principi Principali cefalosporine orali Farmaco





Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona


La sindrome dell intestino irritabile post-infettiva

La sindrome dell intestino irritabile post-infettiva La sindrome dell intestino irritabile post-infettiva Dr.ssa Chiara Ricci Università di Brescia Spedali Civili, Brescia Definizione La sindrome dell intestino irritabile Disordine funzionale dell intestino





Le Nuove Sfide Scientifiche, Tecniche ed Organizzative in Medicina di Laboratorio

Le Nuove Sfide Scientifiche, Tecniche ed Organizzative in Medicina di Laboratorio Le Nuove Sfide Scientifiche, Tecniche ed Organizzative in Medicina di Laboratorio Roma, 6 Novembre 2012 HHV-7 ASSOCIATED MENINGOENCEPHALITIS: AN UNFORGETTABLE CLINICAL CASE Relatore: D.ssa Loria Bianchi


Controllo ufficiale degli OGM nel settore agroalimentare

Controllo ufficiale degli OGM nel settore agroalimentare Controllo ufficiale degli OGM nel settore agroalimentare Ugo Marchesi Istituto Zooprofilattico Sperimentale Lazio e Toscana Centro di Referenza Nazionale per la ricerca di OGM ORGANISMI


Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti


Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando





Sorveglianza West Nile Disease

Sorveglianza West Nile Disease Report 2013 Sorveglianza West Nile Disease Il presente report ha l obiettivo di fornire un aggiornamento dei risultati della sorveglianza integrata su WND nell anno 2013. La sorveglianza è condotta in


REPORT WEST NILE DISEASE (WND) Anno 2014. Aprile 2014

REPORT WEST NILE DISEASE (WND) Anno 2014. Aprile 2014 REPORT WEST NILE DISEASE (WND) Anno 2014 Aprile 2014 1 Sorveglianza West Nile Disease Anno 2014 Il presente report ha l obiettivo di fornire un aggiornamento dei risultati della sorveglianza integrata


Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS


Uova e prodotti a base di uova Dott.ssa Cristina Leonardi

Uova e prodotti a base di uova Dott.ssa Cristina Leonardi LA SICUREZZA ALIMENTARE IN GRAVIDANZA E NELLE ALTRE FASCE A RISCHIO: CONSIGLI E PRECAUZIONI Uova e prodotti a base di uova Dott.ssa Cristina Leonardi Novara, 29 settembre 2012 Borgomanero, 13 ottobre 2012


Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona


Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana


La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica


PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita


R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale


Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis

Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis Roma, ottobre 204 Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis IZSLER Sezione di Pavia Nadia Vicari Metodi molecolari Rilevare Identificare Tipizzare Sub-tipizzare



REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità



BOZZA INDICE 1. INTRODUZIONE... 3 2. PREPARAZIONE DEGLI INOCULI... 4 3. PREPARAZIONE DELLE UNITA DI PROVA E RACCOLTA... 4 Determinazione dell attività sanificante del sistema SUNOX (Pure Health ) indotta dal TiO 2 su superfici contaminate da Listeria monocytogenes, Staphylococcus aureus e Pseudomonas aeruginosa. RELAZIONE


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione


Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA



F. Blasi P O L M O N I T I CLINICA E TERAPIA F. Blasi POLMONITI CLINICA E TERAPIA Prof. Francesco Blasi Istituto di Tisiologia e Malattie Apparato Respiratorio Università degli Studi di Milano IRCCS Ospedale Maggiore Milano POLMONITI CLINICA E TERAPIA



PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi


Il Rischio Biologico Relatore Dr. Mattia Gargano Cosa è il Rischio Biologico? E la possibilità di contrarre durante l espletamento della propria attività lavorativa: INFEZIONI (penetrazione e la moltiplicazione



ProDect CHIP HPV TYPING bcs Biotech SpA Your partner in biotechnology ProDect CHIP HPV TYPING Il test per RIVELARE e TIPIZZARE in maniera rapida ed accurata il PAPILLOMA VIRUS UMANO A lifi i Amplificazione e rivelazione


Come prevenire e gestire l infezione da Clostridium difficile nelle strutture sanitarie

Come prevenire e gestire l infezione da Clostridium difficile nelle strutture sanitarie Agenzia Sanitaria Regionale Area Rischio infettivo Unità Gestione Rischio e Sicurezza Come prevenire e gestire l infezione da Clostridium difficile nelle strutture sanitarie Pietro Ragni Reggio Emilia,


Il contributo dell ECDC nella sorveglianza e controllo dell antibiotico-resistenza a livello europeo

Il contributo dell ECDC nella sorveglianza e controllo dell antibiotico-resistenza a livello europeo Il contributo dell ECDC nella sorveglianza e controllo dell antibiotico-resistenza a livello europeo Dott, Fortunato Paolo D Ancona Centro Nazionale Epidemiologia, Sorveglianza e Promozione della Salute


La gestione sanitaria a garanzia della sicurezza del prodotto

La gestione sanitaria a garanzia della sicurezza del prodotto La gestione sanitaria a garanzia della sicurezza del prodotto Alfonso Zecconi Università degli Studi di Milano Dipartimento Patologia Animale Le tossinfezioni alimentari Problema comune a tutti gli alimenti



STUDIO RETROSPETTIVO SULL ENDOCARDITE ULCERO-POLIPOSA DEL BOVINO STUDIO RETROSPETTIVO SULL ENDOCARDITE ULCERO-POLIPOSA DEL BOVINO Bianco Paolo, Capucchio Maria Teresa*, Catalano Deborah*, Saracco Mauro, Dondo Alessandro**, Grattarola Carla**, Guarda Franco*. Azienda


Risultati dell 11 test inter-laboratorio (PT11) per l identificazione. e la tipizzazione di ceppi di Escherichia coli produttori di

Risultati dell 11 test inter-laboratorio (PT11) per l identificazione. e la tipizzazione di ceppi di Escherichia coli produttori di EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Risultati dell 11 test inter-laboratorio (PT11) per l


Effetto epatoprotettivo della somministrazione di Citexivir in pazienti con epatite cronica da HCV

Effetto epatoprotettivo della somministrazione di Citexivir in pazienti con epatite cronica da HCV Relazione scientifica finale (13/10/2014) Effetto epatoprotettivo della somministrazione di Citexivir in pazienti con epatite cronica da HCV INTRODUZIONE: L'epatite C è una malattia infettiva, causata


Per la conservazione viene aggiunta sodio azide a una concentrazione finale inferiore allo 0,1 %.

Per la conservazione viene aggiunta sodio azide a una concentrazione finale inferiore allo 0,1 %. Scheda Tecnica 0123 Technical File No.: 46 Prodotto: Categoria di prodotto secondo la classificazione CE: Anti-Xga coombsreactive Policlonale, umano IgG Allegato III Autocertificazione del produttore Struttura


(Auto)analisi microbiologiche in farmacia?

(Auto)analisi microbiologiche in farmacia? (Auto)analisi microbiologiche in farmacia? Prof. Giovanni Antonini Dipartimento di Biologia, Università Roma Tre PERCHE OCCORRE FARE ANALISI MICROBIOLOGICHE? Sta assumendo sempre maggiore importanza l


Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari


A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.)

A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.) A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.) Si espongono, per opportuna conoscenza, gli ultimi aggiornamenti disponibili al 12/10/2014


Parte I (punti 3-9): Misure sanitarie obbligatorie per il controllo della Paratubercolosi bovina

Parte I (punti 3-9): Misure sanitarie obbligatorie per il controllo della Paratubercolosi bovina LINEE GUIDA PER L ADOZIONE DI PIANI DI CONTROLLO E PER L ASSEGNAZIONE DELLA QUALIFICA SANITARIA DEGLI ALLEVAMENTI NEI CONFRONTI DELLA PARATUBERCOLOSI BOVINA 1. Definizioni Ai sensi delle presenti linee


L epatite E nei suini domestici e selvatici in Italia

L epatite E nei suini domestici e selvatici in Italia ZOONOSI EMERGENTI E RIEMERGENTI: tra vecchie conoscenze e nuove realtà Torino, 26 febbraio 2013 L epatite E nei suini domestici e selvatici in Italia Fabio Ostanello Dipartimento di Scienze Mediche Veterinarie



INFEZIONI DA MENINGOCOCCO: INFORMAZIONI PER I CITTADINI INFEZIONI DA MENINGOCOCCO: INFORMAZIONI PER I CITTADINI S.I.S.P. - U.O.S. Epidemiologia e Profilassi Malattie Infettive Dr.ssa Andreina Ercole La meningite batterica Evento raro, nei paesi industrializzati,



LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni



RICERCA INFEZIONE DA EPATITE C METODO NAZIONALE STANDARD ALGORITMO MINIMO DI PROVA RICERCA INFEZIONE DA EPATITE C VSOP 5 Emesso dalla Standards Unit, Evaluations and Standards Laboratory Centre for Infections Revisione no: 5 Data di


1985 - Diplomato presso l'istituto Tecnico Agrario Statale G. Ferraris di Vercelli, nell'anno scolastico 1984-85 con la votazione di 60/60

1985 - Diplomato presso l'istituto Tecnico Agrario Statale G. Ferraris di Vercelli, nell'anno scolastico 1984-85 con la votazione di 60/60 Prof. Valerio Bronzo Professore Associato Confermato presso il Dipartimento di Scienze Veterinarie per la Salute, la Produzione Animale e la Sicurezza Alimentare della Facoltà di Medicina Veterinaria dell





Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi



TRASPORTO DEL SANGUE E DEI CAMPIONI BIOLOGICI MEDIANTE CONTENITORI IDONEI TRASPORTO DEL SANGUE E DEI CAMPIONI BIOLOGICI MEDIANTE Via San Carlo, 13 Arluno (Milano) 4 marzo 2014 2 Introduzione Le attività connesse con la spedizione ed il trasporto di sostanze infettive o potenzialmente


Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI)

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Dott.ssa G. Scalet Sezione Microbiologia-Dipartimento Di Patologia e Diagnostica Università


Febbre del Nilo occidentale (West Nile Virus - WNV)

Febbre del Nilo occidentale (West Nile Virus - WNV) FSME (Frühsommermeningoenzephalitis) Febbre del Nilo occidentale (West Nile Virus - WNV) 95 West Nile Virus Foto: CNN Febbre del Nilo occidentale (West Nile Virus - WNV) DEFINIZIONE La febbre del Nilo



IL RISCHIO BIOLOGICO LA SICUREZZA E LA SALUTE SUL LAVORO cominciamo a SCUOLA IL RISCHIO BIOLOGICO protocollo d intesa 5 febbraio 2015 ASL Brescia ASL Vallecamonica Sebino - Direzione Territoriale del Lavoro Ufficio Scolastico


Controllo microbiologico degli alimenti: metodi a confronto

Controllo microbiologico degli alimenti: metodi a confronto Fiera di Cremona, venerdì 17 aprile 2009 Controllo microbiologico degli alimenti: metodi a confronto Valerio Giaccone Facoltà di Medicina veterinaria Università di Padova Dal 1 gennaio 2006 è entrata in


Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica



LA PREVENZIONE DEL RISCHIO BIOLOGICO LA PREVENZIONE DEL RISCHIO BIOLOGICO Campo di applicazione Tutte le attività lavorative in cui vi è rischio di esposizione ad agenti biologici Definizioni Agente Biologico (a.b.) Qualsiasi microorganismo


Malattie infettive microrganismi patogeni trasmissibilità orizzontale o contagiosità

Malattie infettive microrganismi patogeni trasmissibilità orizzontale o contagiosità Le malattie infettive - definizione - rapporto tra microrganismi e uomo - modalità di trasmissione delle infezioni - le basi della prevenzione - il ruolo dell ambiente domestico Malattie infettive: forme



METROLOGIKA PRESENTAZIONE DEL SISTEMA. ML BIOTECH Via Preie 38, 10080 TORRE CANAVESE (TO) TEL. 0124 372220 www.metrologika. METROLOGIKA PRESENTAZIONE DEL SISTEMA SOMMARIO PRESENTAZIONE DEL SISTEMA METROLOGIKA - Introduzione - Il carico socio economico delle infezioni ospedaliere - Stime dei tassi di infezioni (ICA) correlate


Il declino degli antibiotici e le nuove strategie per la terapia antibatterica

Il declino degli antibiotici e le nuove strategie per la terapia antibatterica Il declino degli antibiotici e le nuove strategie per la terapia antibatterica Paolo Visca Dipartimento di Scienze, Università Roma Tre Lezione ASTRE, 25/01/2014 Anno 1918: principale causa di morte 1


La prevalenza dei ceppi di salmonella multi-resistenti nei casi umani. Ida Luzzi

La prevalenza dei ceppi di salmonella multi-resistenti nei casi umani. Ida Luzzi La prevalenza dei ceppi di salmonella multi-resistenti nei casi umani Ida Luzzi Dipartimento di Malattie Infettive, Parassitarie e Immunomediate Istituto Superiore di Sanità, Roma Infezioni
