Analisi del DNA genomico mediante Southern Blot Hybridization

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Analisi del DNA genomico mediante Southern Blot Hybridization"

Transcript

1 Analisi del DNA genomico mediante Southern Blot Hybridization Permette la mappatura dei siti di restrizione attorno al frammento di DNA genomico per il quale si dispone di una sonda specifica a) Il DNA genomico viene digerito con uno o più enzimi di restrizione 10 µg di DNA genomico se la sonda è > 500bp µg di DNA genomico se la sonda è piccola (oligonucleotide) b) I frammenti di digestione vengono separati mediante elettroforesi su gel di agarosio(0.7%) ± Bromuro di Etidio DNA marker DNA non dig. HindIII BamHI EcoRI c) Il DNA viene denaturato in situ e trasferito a un supporto solido (Filtro di nitrocellulosa o membrana di nylon) - (facoltativo) Il gel viene immerso in HC1 (0.2M) Depurinazione blanda - Il gel viene immerso in NaOH (0.5N): Denaturazione del DNA e idrolisi nelle regioni depurinate (rottura DNA in frammenti pii piccoli per facilitare il trasferimento del - Il gel viene immerso in un tampone Neutralizzazione dell NaOH

2 Il trasferimento sul filtro può essere fatto mediante 1) Trasferimento capillare (Capillary transfer) 2) Trasferimento elettroforetico (Electro-blotting) 3) Trasferimento col vuoto (Vacuurn blotting) Il filtro viene fatto essiccare all aria e successivamente il DNA viene fissato al filtro mediante: a) riscaldamento a 80 C, l h se il filtro e di nitrocellulosa b) riscaldamento a 70 C, l h e/o irraggiamento all UV se il filtro e di nylon

3 d) La membrana viene sottoposta a preibridazione - Soluzione di preibridaziòne: - Contenitore per la preibridazione: SEAL FILTER CELLOPHANE FILTER e) La membrana viene sottoposta a ibridazione con la sonda radioattiva Soluzione di ibridazione: Soluzione di preibridazione + Sonda denaturata (bollitura della sonda per 5 ) Stesse condizioni di temperatura della preibridazione, o/n

4 f) La membrana viene sottoposta a differenti lavaggi, prima meno stringenti (alto sale, bassa temperatura) poi via via più stringenti (basso sale, alta temperatura) I) 2X SSC, 0.1% SDS RT 5 II) 2X SSC, 0.1% SDS 37 C 20 III) 2X SSC, 0.1 % SDS 60 C 20 IV) 0.IX SSC, 0.1% SDS 68 C 1h Sonda HindIII HindIII BamHI BamHI BamHI DNA genomico EcoRI EcoRI

5 Elettroforesi Blotting Preibridazione e ibridazione Lavaggi Rivelazione

6 Fattori che influenzano la rivelazione di un segnale in Southern Blot Hybridization 1) La frazione di genoma complementare con la sonda (Es. geni. a singola copia o multipli) 2) La grandezza della sonda (Sonde grandi forniscono segnali più intensi di sonde piccole) 3) L attività specifica della sonda (Sonde ad attività specifica più elevata forniscono segnali più intensi di sonde ad attività specifica bassa) 4) La frazione del DNA genomico trasferito sul filtro Es. 0.1 pg di un frammento di DNA di 1000 bp presente una sola volta in un genoma (es. genoma umano ~ bp) DNA genomico da digerire: /1000 x 0.1 pg = pg = 0.3 µg Ibridazione con 25 ng di una sonda di dimensioni > 500 bp Attività specifica>106 cpm/ng Visibile in autoradiografia dopo alcuni giorni

7 Caratteristiche dei filtri utilizzati per blotting Filtri di nitrocellulosa: a) Il legame degli acidi nucleici al filtro è idrofobico (fissaggio a 80 C in stufa). Durante l ibridazione e i lavaggi si ha rilascio di acidi nucleici. b) Il filtro dopo essiccamento è fragile e non sopporta molti cicli di ibridazione e lavaggio Filtro di nylon: a) Il legame degli acidi nucleici al filtro è covalente e duraturo. Il fissaggio viene fatto in stufa a 70 C, o con alcali deboli oppure mediante UV (254nm) (fissaggio di tipo covalente) b) Il legame avviene a bassa forza ionica (solo in questo caso è possibile usare l electroblotting). Quando il trasferimento su filtro avviene da gel di poliacrilamide il vacuum- e capillary-blotting sono inefficienti c) Dà alto background ed è necessario usare più agenti bloccanti d) Esistono due tipi principali di filtro: nylon non modificato e nylon carico positivamente (con maggiore capacità)

8 Southern blot su frammenti di DNA (Determinazione delle mappe di restrizione) Ibridazione

9 DNA fingerprinting DNA fingerprinting di differenti individui

10 Polimorfismo nella lunghezza dei frammenti di restrizione (RFLP) DNA genomico estratto oppure PCR sul DNA genomico con primer che si appaiano su regioni invariabili Pattern di bande meno complesso di un DNA fingerprinting Se si utilizzano 5-6 sonde è possibile identificare un individuo con una accuratezza paragonabile al complesso DNA fingerprinting

11 Isolamento di un promotore di un gene quando è nota la sequenza di tutto il genoma Nota la sequenza del cdna di interesse si può ricercare la regione del genoma che contiene il gene corrispondente Il gene contiene 2 esoni ed è nel contig 7.31

12 Cromosoma V Contig 7.31 Prelevata la sequenza compresa tra e bp Gene di interesse Sequenza compresa tra e bp

13 Prelevata la sequenza compresa tra e bp TGTAAACCTCGATGGACTGAATTCAACTGGAAAGGGTGACGAAAGGCCGC TCTCTATCCTCATTATAGACACAGACAACGCTCACCTACGGGTACACTTC ACACACGAGTTTCTCCCTACAAACTTTGTCTTACGTTCATTTTCTCATCA ATCCACAATGCTGTCCCGTTTCATGGGCCATGCCATTTTACATTGCACTT TTGGCTGGTAACAATGACTGGCGCTTGTCCGCAAACGATCAAGTTCCTCA CTTCATCCTCCCAGGGTCAAAGTCAGTCGGCGCTTTAATTTCGCCGCCGC TTCAATCCAAACACCTCCATTCAGAAGACACTCAAAGTGCTGATTAGATT GCAGCATATGTGTGGCTTGGTTTCAGAGCATCGCCATTGCTTGTACATAA CGACATGATCTTTCCACCGCCACTAGAGGCGGTTCTCTGATACTTGGTCT ACCGGCGTGGTATCTTGCAGTCCGCGAACAGAACTCGGCTTGATTTATCC ATCGTCAAGTATCCATCACCCGTCACCCGACCAACCCCACAGATATACCT ACCGCTTATGTTGTAACCGGCACAACTCAACAATTCTTCCGGCCTCCTCT CCTACCTTACCCACCAGTAACGGCTGGTCCTATCCCAGTCCAAGCAAGTT CCCAACGTCTTGGCTCTTGAATCACCGGGAATGTAACCCCATCTTGCTGA AAGAGGATCGACTGTGGATGCCAAGACGTGATGAAACCTACGTGCCTTGC ATGGATACTGTAGTAGTAACTAGTATCCGTTCGCAGTTTCTTTCTGTTCT CACCTCCCCAAGCTACATATGAGAAAACGTACGCAATGCTGTGTGATGAC TGGGTCAGACACCGATACCGATACCGGTGGGACTTCTAGGCTCTTCCAAC CCCCAAAGGCCCATTCTCAGTACACATCGGCTTATAACTTTCGTATGTTG TTGGTGTAAGTTGGGAAAAGAAAGGATTCTTGTCTTCTTTCCGCTTTTGT GAAAGAGTGAGCTCCGCCGTGAGGGGATTCGGGGCAAGGGCATGGCGTTA AAGGGCTTCAATTAGGTAGTGTCCTCCGGATCGACGGTCTTGGTCTCAAC AAGGCTCCTGGAGGTTAACATCTGCCGGGCGGTTGCGTCCATGGCTCCTC TCCACCGTCAACCTCCAATCACGGTCAACTACCAAAATTTCTCTGTACCA TTCTCAAGATTTTCTAGCATTTTCTTGAGCAGAATGGTAAGGAAACAACC AATCAAAGCTCCAACTTGAACCACTACTTATAAATCTTAGTCACAGATGA CCTTGTAGCTCTTCCTGTTATACCCATCTTCAACTAAAGAAGCCATGTCA GGTTACCATTCCCCTCTCTCATGCTACCCTCTTGCTCTTTCGGGTCTGGT AAAACAGAGTGGAAGACTACCAGAGGGTGTGAAGAATGCATATACTCTTC GCCCACGAATAAAATGTAAGCCTACAAGCACGCCAAACAAAACGTCCACC ACACATCCGCACCGCATTTTCTTAAACGGCCGACAAGTGACGGGCATCAT TGCCCATTAAGGCAGGTTACAATCCGTGATGATGGGATAGTATATCACAT AACCGCTCTGGGAGGAAGAGGGGAAACATCGTGGTTCATGTCAAGTGTGT GTGTGTGTGTGGTGTGTGTTTGACTCGTCGATCGACACCTTACATGCTAA CTTCGACGTCGAGAGCCCGCACAGAGAGAGGGAAGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGAGAGGCACCGAGAAGGGAGGTATAAGGACCGGGC CGTCTGGCCCAGTTGAGAATAAAAGGAATCCTTCTCTTCTATGTGCCAGC ACTTCAGCAATCCACGGTTCTACCTGGTTCCTCATCTTCATCTACCATCA AGATGAAGTTCTTCTCTGCCCTCGCCCTCTCCTCTCTCCTGCCGACGGCC GCATGGGCCTGGACCGGCAGCGAAAGCGACAGTACCGGCGCCGACTCCCT CTTCCGCCGCGCCGAAACCATCCAGCAGACGACGGACCGATACCTTTTTA GGATCACGCTCCCGCAATTTACTGCCTATCGCAACGCCAGAAGCCCGGCG ACACTGGACTGGTCCTCAGACAGCTGCAGCTACTCGCCCGATAACCCGTT GGGATTCCCCTTTTCGCCTGCTTGCAATCGTCATGATTTCGGGTATCGCA ACTACAAGGCTCAGTCGAGGTTTACGGATAATAATAAGTTGAAGATTGAT GGAAACTTTAAGACTGAGTATGTCCCTTTTTTTTTTTCTCTCTCTTTCTC TCTCTCTCTCTTTTCCTCCCTCGTTTTATTCCTCTTGTCTCATCCTTCCC CTTGCTTACCTACCTACCCTTCTCCCTTTTTACCCGTCAACGGTCTCCAT CTCTCTTCACATCCTCCTCCGTGAGTAGATTTGATAAAACAGATAGCTAA TCCAACCCTCAACCAACTACATAGTCTCTACTACCAGTGCGACACCCACG GCTACGGCTCCACCTGCCACGCTCTCGCCAACGTCTACTACGCCGCCGTC CGCGAATTTGGTCGCACCAAGGGCGAGCTCCAGGAGGAATACGATCTGCT GCTGGCTCACTACAACGAGCTCGTGGCCGAGGCTATTGCCAAGGGCGAGG ATCCGTTGTATTATTAGCTTTCTGTATATCGGAGGAGGAGGATGAAGGCT Regione contenente il promotore Gene di interesse

14 TGTAAACCTCGATGGACTGAATTCAACTGGAAAGGGTGACGAAAGGCCGC TCTCTATCCTCATTATAGACACAGACAACGCTCACCTACGGGTACACTTC ACACACGAGTTTCTCCCTACAAACTTTGTCTTACGTTCATTTTCTCATCA ATCCACAATGCTGTCCCGTTTCATGGGCCATGCCATTTTACATTGCACTT TTGGCTGGTAACAATGACTGGCGCTTGTCCGCAAACGATCAAGTTCCTCA CTTCATCCTCCCAGGGTCAAAGTCAGTCGGCGCTTTAATTTCGCCGCCGC TTCAATCCAAACACCTCCATTCAGAAGACACTCAAAGTGCTGATTAGATT GCAGCATATGTGTGGCTTGGTTTCAGAGCATCGCCATTGCTTGTACATAA CGACATGATCTTTCCACCGCCACTAGAGGCGGTTCTCTGATACTTGGTCT ACCGGCGTGGTATCTTGCAGTCCGCGAACAGAACTCGGCTTGATTTATCC ATCGTCAAGTATCCATCACCCGTCACCCGACCAACCCCACAGATATACCT ACCGCTTATGTTGTAACCGGCACAACTCAACAATTCTTCCGGCCTCCTCT CCTACCTTACCCACCAGTAACGGCTGGTCCTATCCCAGTCCAAGCAAGTT CCCAACGTCTTGGCTCTTGAATCACCGGGAATGTAACCCCATCTTGCTGA AAGAGGATCGACTGTGGATGCCAAGACGTGATGAAACCTACGTGCCTTGC ATGGATACTGTAGTAGTAACTAGTATCCGTTCGCAGTTTCTTTCTGTTCT CACCTCCCCAAGCTACATATGAGAAAACGTACGCAATGCTGTGTGATGAC TGGGTCAGACACCGATACCGATACCGGTGGGACTTCTAGGCTCTTCCAAC CCCCAAAGGCCCATTCTCAGTACACATCGGCTTATAACTTTCGTATGTTG TTGGTGTAAGTTGGGAAAAGAAAGGATTCTTGTCTTCTTTCCGCTTTTGT GAAAGAGTGAGCTCCGCCGTGAGGGGATTCGGGGCAAGGGCATGGCGTTA AAGGGCTTCAATTAGGTAGTGTCCTCCGGATCGACGGTCTTGGTCTCAAC AAGGCTCCTGGAGGTTAACATCTGCCGGGCGGTTGCGTCCATGGCTCCTC TCCACCGTCAACCTCCAATCACGGTCAACTACCAAAATTTCTCTGTACCA TTCTCAAGATTTTCTAGCATTTTCTTGAGCAGAATGGTAAGGAAACAACC AATCAAAGCTCCAACTTGAACCACTACTTATAAATCTTAGTCACAGATGA CCTTGTAGCTCTTCCTGTTATACCCATCTTCAACTAAAGAAGCCATGTCA GGTTACCATTCCCCTCTCTCATGCTACCCTCTTGCTCTTTCGGGTCTGGT AAAACAGAGTGGAAGACTACCAGAGGGTGTGAAGAATGCATATACTCTTC GCCCACGAATAAAATGTAAGCCTACAAGCACGCCAAACAAAACGTCCACC ACACATCCGCACCGCATTTTCTTAAACGGCCGACAAGTGACGGGCATCAT TGCCCATTAAGGCAGGTTACAATCCGTGATGATGGGATAGTATATCACAT AACCGCTCTGGGAGGAAGAGGGGAAACATCGTGGTTCATGTCAAGTGTGT GTGTGTGTGTGGTGTGTGTTTGACTCGTCGATCGACACCTTACATGCTAA CTTCGACGTCGAGAGCCCGCACAGAGAGAGGGAAGGGGGGGGGGGGGGGG GGGGGGGGGGGGGGGGAGAGGCACCGAGAAGGGAGGTATAAGGACCGGGC CGTCTGGCCCAGTTGAGAATAAAAGGAATCCTTCTCTTCTATGTGCCAGC ACTTCAGCAATCCACGGTTCTACCTGGTTCCTCATCTTCATCTACCATCA AGATGAAGTTCTTCTCTGCCCTCGCCCTCTCCTCTCTCCTGCCGACGGCC GCATGGGCCTGGACCGGCAGCGAAAGCGACAGTACCGGCGCCGACTCCCT CTTCCGCCGCGCCGAAACCATCCAGCAGACGACGGACCGATACCTTTTTA GGATCACGCTCCCGCAATTTACTGCCTATCGCAACGCCAGAAGCCCGGCG ACACTGGACTGGTCCTCAGACAGCTGCAGCTACTCGCCCGATAACCCGTT GGGATTCCCCTTTTCGCCTGCTTGCAATCGTCATGATTTCGGGTATCGCA ACTACAAGGCTCAGTCGAGGTTTACGGATAATAATAAGTTGAAGATTGAT GGAAACTTTAAGACTGAGTATGTCCCTTTTTTTTTTTCTCTCTCTTTCTC TCTCTCTCTCTTTTCCTCCCTCGTTTTATTCCTCTTGTCTCATCCTTCCC CTTGCTTACCTACCTACCCTTCTCCCTTTTTACCCGTCAACGGTCTCCAT CTCTCTTCACATCCTCCTCCGTGAGTAGATTTGATAAAACAGATAGCTAA TCCAACCCTCAACCAACTACATAGTCTCTACTACCAGTGCGACACCCACG GCTACGGCTCCACCTGCCACGCTCTCGCCAACGTCTACTACGCCGCCGTC CGCGAATTTGGTCGCACCAAGGGCGAGCTCCAGGAGGAATACGATCTGCT GCTGGCTCACTACAACGAGCTCGTGGCCGAGGCTATTGCCAAGGGCGAGG ATCCGTTGTATTATTAGCTTTCTGTATATCGGAGGAGGAGGATGAAGGCT Primer da utilizzare in una PCR sul DNA genomico o sul DNA di una libreria genomica 5 UTR Esone 1 Introne Esone 2 3 UTR

15 Isolamento del frammento di DNA genomico contenente il gene di interesse (es. isolamento del promotore, struttura del gene, ecc) Placque (o colony) hybridization

16

17 Prelievo della placca (o colonia) positiva Isolamento del DNA del clone λ o del plasmide Crescita su larga scala Sequenziamento

18 PCR inversa (inverse PCR) Permette di amplificare frammenti di DNA, a sequenza ignota, che si trovano esternamente ai primer utilizzati. Viene usata, in sostituzione allo screening di librerie genomiche, per isolare sequenze fiancheggianti un gene, come ad es. un promotore. a) Il DNA genomico viene digerito con un enzima di restrizione che non taglia nella regione a sequenza nota, compresa tra i due primer b) I frammenti di digestione vengono sottoposti a ligasi in condizioni da favorire una ligazione intramolecolare (ad es. condizioni di elevata diluizione del DNA) c) Il DNA circolarizzato viene utilizzato come templato per una PCR con i due primer appaiantisi al frammento di DNA a sequenza nota, ma diretti in direzione opposta l uno rispetto all altro.

19 Elettroforesi classica di frammenti di DNA Modello a setaccio Le molecole di DNA più grandi sono separate da quelle più piccole dall azione di setaccio dovuta alla matrice del gel Molecole a struttura random coil

20 Elettroforesi pulsed-field PFGE (Pulsed-Field Gel Electrophoresis) DNA di dimensioni > 40 Kb non possono essere separati con un elettroforesi su gel di agarosio a campo elettrico costante Mobilità elettroforetica del DNA in funzione della dimensione molecolare in un campo elettrico costante. La PFGE permette di separare DNA fino a 5 Mb. L elettroforesi viene realizzata con un campo elettrico che cambia periodicamente in due direzioni con un intervallo di tempo che varia da 0.1 sec, a qualche ora. A e B rappresentano 2 coppie di elettrodi. Quando i due elettrodi A sono attivati, il DNA caricato nei pozzetti si sposta verso l anodo a destra, come indicato dalla prima freccia. Non appena gli elettrodi A vengono spenti, gli elettrodi B vengono attivati. A questo punto il DNA inizia a muoversi verso sinistra. Al variare della direzione del campo elettrico, le molecole di DNA seguono un percorso a zig-zag come mostrato dalle frecce.

21 Modello a serpente Il meccanismo di migrazione del DNA attraverso le maglie del gel (più strette delle dimensioni della molecola) sembra essere differente e ricorda lo spostamento di un serpente. Nel modello a serpente, le molecole di DNA più larghe della dimensione dei pori del gel di agarosio devono srotolarsi dalla loro iniziale forma a random coil in modo da poter migrare durante l elettroforesi. Il DNA si muove con una estremità che conduce lo spostamento (testa) mentre il resto della molecola (coda) la segue, lungo lo stesso percorso.

22 Nel spostamento del DNA in una PFGE si distinguono 2 fasi: 1) Riorientamento: una delle estremità del frammento di DNA si orienta verso in polo positivo (capo della molecola) 2) Migrazione: il capo della molecola migra verso il polo positivo trascinando l altra estremità (coda della molecola) Fintantoché il tempo di riorientamento è inferiore alla durata del campo elettrico (pulse time), la mobilità della molecola dipende linearmente dalla sua lunghezza. La mobilità di una molecola dipende dalla frazione del pulse time che rimane per la migrazione (migration time): a) Molecole piccole: si riorientano velocemente nel nuovo campo elettrico e spendono la maggior parte del pulse time per la migrazione, prima che il campo elettrico cambi nuovamente. b) Molecole grandi: si riorientano lentamente nel nuovo campo elettrico e spendono solo una piccola parte del pulse time per la migrazione

23

24 Tipi di apparati per PFGE A) Transverse Alternating Field Electrophoresis (TAFE) B) Field Inversion Gel Electrophoresis (FIGE) C) Contour-Clamped Homogeneous Electric Field apparatus (CHEF) D) Rotating Gels

25 Isolamento del cdna quando è nota la sequenza di molte EST correlate

26 Allineamento multiplo delle sequenze EST (CUSTAL W) e determinazione del Contig di EST

27 Mappa di traduzione del Contig di EST, definizione del CDS e progettazione dei prime per PCR

28 Isolamento del cdna intero o della sola CDS mediante PCR L amplificazione di un cdna può essere eseguita: 1) mediante PCR utilizzando come templato il DNA (plasmidico o fagico) totale di una libreria di cdna. 2) mediante la RT-PCR direttamente dall mrna a) L mrna viene retrotrascritto a cdna a singolo filamento mediante la trascrittasi inversa. Il primer utilizzabile può essere: - un primer specifico (gene-specific primer, GSP) - un primer oligo(dt) - una miscela di primer random (esameri) b) Il cdna a singolo filamento viene usato come templato per la reazione specifica di PCR successiva.

29 Procarioti +1 Promotore batterico Terminatore batterico RNA-polimerasi batterica Trascrizione 5 3 mrna Monocistronico o policistronico Eucarioti Promotore eucariotico +1 Esone 1 Esone 2 Esone 3 Terminatore eucariotico RNA-polimerasi II Trascrizione 5 3 Trascritto primario Modificazioni post-trascrizionali - Capping - Poliadenilazione - Splicing (anche alternativo) 5 3 Cap AAAAAAAAAAAAAAAA Poli A ( A) mrna Monocistronico

30 5 3 Cap AAAAAAAAAAAAAAAA Poli A ( A) mrna Monocistronico ATG TAA TTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAA cdna CDS Promotore batterico Vettore batterico ATG cdna eucariotico Sequenza SD terminatore batterico Vettore eucariotico episomico (lievito) Promotore eucariotico cdna eucariotico ATG terminatore eucariotico Origine di relicazione batterica Gene per la resistenza ad un antibiotico Origine di relicazione batterica Gene per la resistenza ad un antibiotico Gene per la selezione in eucariote Origine di relicazione eucariotica Frammento di gene batterico ATG ATG cdna eucariotico TAA TTTTTTTTTTTTTTTT AAAAAAAAAAAAAAAA Punto di fusione 3 possibili fasi di lettura

31 Complementazione funzionale in E.coli Es. Via metabolica di riduzione del solfato SO 4 2- APS ATP solforilasi (Cys D) DPNPasi APS chinasi (Cys C) PAPS PAPS reduttasi (Cys H) SO 3 2- S 2- Solfito reduttasi (Cys J) Cisteina sintasi (Cys K) cisteina

32 Complementazione funzionale Batterio mutante per la solfito reduttasi (Cys J) trasformato con una libreria di cdna di espressione Terreno minimo +Cys Terreno minimo -Cys ecc. Crescita batterica (1.5 ml) ecc. Minipreparazione Plasmidica (2-5 µg)

33 Ricomplementazione Le varie minipreparazioni plasmidiche ritrasformare il ceppo di batteri mutanti vengono utilizzate per ecc. Minipreparazione Terreno minimo +Cys Trasformazione Terreno minimo -Cys Miniprep 1 Miniprep 2 Miniprep 3

34

35

36

37

38

39

40

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità

Dettagli

Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita.

Elettroforesi. Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. Elettroforesi Elettroforesi: processo per cui molecole cariche si separano in un campo elettrico a causa della loro diversa mobilita. A qualunque ph diverso dal pi le proteine hanno una carica netta quindi,

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

PURIFICAZIONE DI DNA

PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi

Dettagli

CLONAGGIO DEL DNA. Clonare significa produrre copie identiche: CLONI.

CLONAGGIO DEL DNA. Clonare significa produrre copie identiche: CLONI. CLONAGGIO CLONAGGIO DEL DNA Clonare significa produrre copie identiche: CLONI. Il CLONAGGIO consiste nella moltiplicazione di un segmento di DNA appartenente ad un dato genoma. Ciò si ottiene unendo tale

Dettagli

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA

Dettagli

Lezione IX-X martedì 25-X-2011

Lezione IX-X martedì 25-X-2011 Lezione IX-X martedì 25-X-2011 corso di genomica laurea magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 non ci sarà lezione martedì 1 e giovedì 3 Novembre

Dettagli

Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (www.cusmibio.unimi.it).

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio

Dettagli

Principali tecniche di base

Principali tecniche di base Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione (Southern blotting) PCR (Polymerase Chain Reaction) (Sequenziamento) Tecniche di base Enzimi di di restrizione

Dettagli

Southern blot. !Per. determinare la presenza o assenza di specifici frammenti genici. !Studio. della struttura e dell organizzazione di un gene

Southern blot. !Per. determinare la presenza o assenza di specifici frammenti genici. !Studio. della struttura e dell organizzazione di un gene Southern blot!per determinare la presenza o assenza di di specifici frammenti genici!studio della struttura e dell organizzazione di di un gene Southern blot Procedura Isolare DNA genomico Digerirlo con

Dettagli

100bp DNA Ladder H3 RTU

100bp DNA Ladder H3 RTU 100bp DNA Ladder H3 RTU Elettroforesi Una combinazione unica di prodotti di PCR e una serie di plasmidi proprietarie digerito con enzimi di restrizione appropriati per produrre frammenti 12, adatto per

Dettagli

Modulo di GENETICA APPLICATA. Esame integrato di METODOLOGIE BIOTECNOLOGICHE CORSO DI LAUREA IN BIOTECNOLOGIE. Docente: FLAVIA CERRATO

Modulo di GENETICA APPLICATA. Esame integrato di METODOLOGIE BIOTECNOLOGICHE CORSO DI LAUREA IN BIOTECNOLOGIE. Docente: FLAVIA CERRATO Modulo di GENETICA APPLICATA Esame integrato di METODOLOGIE BIOTECNOLOGICHE CORSO DI LAUREA IN BIOTECNOLOGIE Docente: FLAVIA CERRATO a. a. 2008-2009 2009 PROGRAMMA 1. Tecniche di base. Taglio e saldatura

Dettagli

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI)

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Dott.ssa G. Scalet Sezione Microbiologia-Dipartimento Di Patologia e Diagnostica Università

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Biotecnologie e bonifica ambientale

Biotecnologie e bonifica ambientale Biotecnologie e bonifica ambientale Prof. Laura Martinis Liceo Scientifico G. Marinelli Prof. Massimo Vischi e Luca Marchiol - Facoltà di Scienze Agrarie dell Università di Udine Cl. III B Noi studenti

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari

Dettagli

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Vettori per il clonaggio: plasmidi fagi cosmidi YAC. Vettori di espressione. Trasformazione tramite calcio cloruro

Vettori per il clonaggio: plasmidi fagi cosmidi YAC. Vettori di espressione. Trasformazione tramite calcio cloruro Vettori per il clonaggio: plasmidi fagi cosmidi YAC Vettori di espressione Trasformazione tramite calcio cloruro Trasformazione tramite elettroporazione Produzione di DNA ricombinante Il genoma eucariotico

Dettagli

Tecniche molecolari per la diagnosi di funghi fitopatogeni

Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche che consentono l identificazione, la diagnosi, la quantificazione di un organismo mediante l analisi degli acidi nucleici: DNA RNA Diagnosi

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D

determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Metodi di studio delle proteine : determinazione della quantità determinazione della struttura primaria (sequenza a.a.) determinazione della struttura 3D Spettrofotometro cuvetta monocromatore rivelatore

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

ENZIMI DI RESTRIZIONE

ENZIMI DI RESTRIZIONE ENZIMI DI RESTRIZIONE La scoperta degli enzimi di restrizione e modificazione Intorno agli anni 50 si notò che talvolta l introduzione in E.coli di DNA esogeno, proveniente da un diverso ceppo di E.coli,

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Kit didattico Edvotek: la Tecnica del DNA fingerprinting

Kit didattico Edvotek: la Tecnica del DNA fingerprinting International pbi S.p.A. Milano Copyright pbi MARZO 2003 Kit didattico Edvotek: la Tecnica del DNA fingerprinting Introduzione L analisi del profilo di restrizione del DNA, detto anche DNA fingerprinting,

Dettagli

Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno

Dettagli

Identificazione di mutazioni e analisi dei polimorfismi del DNA

Identificazione di mutazioni e analisi dei polimorfismi del DNA Identificazione di mutazioni e analisi dei polimorfismi del DNA L identificazione delle mutazioni che causano malattie può oggi essere effettuata con metodiche relativamente semplici e pratiche in un laboratorio

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Immagine di una sequenza ben riuscita. Sequences troubleshooting

Immagine di una sequenza ben riuscita. Sequences troubleshooting Immagine di una sequenza ben riuscita. Sequences troubleshooting Sequenza fallita Reazione fallita: non presenta picchi definiti e ha un alto rumore di fondo. il primer non trova sito di annealing il DNA

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR

Francesca Ceroni. Biotecnologie tradizionali. Biologia Sintetica. F. Ceroni 16/09/2010. Bressanone GNB 2010 1. 1) DNA ricombinante 2) PCR XXIX Scuola Annuale di Bioingegneria. Bressanone, 13-17 settembre 2010 Francesca Ceroni Biotecnologie tradizionali 1) DNA ricombinante 2) PCR 3) Sequenziamento automatizzato Biologia Sintetica 4) Approccio

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE

LA TECNOLOGIA DEL DNA RICOMBINANTE UNITÀ VET. DIDATTICA DI BIOLOGIA MOLECOLARE LA TECNOLOGIA DEL DNA RICOMBINANTE Roberto Giacominelli Stuffler 1. Gli enzimi di restrizione 2. La trascrittasi inversa 3. Il DNA ricombinante 4. La PCR 2 GLI

Dettagli

Tecniche di biologia

Tecniche di biologia Tecniche di biologia Negli anni 70, la scoperta degli enzimi di restrizione, della trasformazione batterica e dell elettroforesi su gel di agarosio ha avviato lo sviluppo della biologia molecolare e dell

Dettagli

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

MARCATURA DEGLI ACIDI NUCLEICI

MARCATURA DEGLI ACIDI NUCLEICI MARCATURA DEGLI ACIDI NUCLEICI MARCATURA DEGLI ACIDI NUCLEICI La marcatura degli acidi nucleici è una delle tecniche di base nello studio della Biologia Molecolare, rappresenta infatti una tappa preliminare

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

Perche usare Gel di Poliacrilammide per separare le proteine?

Perche usare Gel di Poliacrilammide per separare le proteine? Perche usare Gel di Poliacrilammide per separare le proteine? I gel di poliacrilammide hanno una trama piu compatta I pori hanno dimensioni minori che nei gel di agarosio Le proteine sono molto piu piccole

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE Un marcatore genetico è un qualsiasi fattore ereditario (quindi trasmissibile alla progenie) di cui esistano più varianti genotipiche. Essi consentono

Dettagli

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010

PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per

Dettagli