SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo"

Transcript

1 C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente: Silva Denise Polo Scolastico Mattei- 4A Liceo Scientifico A.S,

2 GPG

3 La striatura bruna dell orzo La striatura bruna è una malattia biotrofica dell orzo ad eziologia fungina, causata dall ascomicete Pyrenophora graminea, diffusa praticamente ovunque si coltivi orzo. Fig. (A) Sintomi fogliari; (B) confronto tra 2 parcelle: quella di sinistra deriva da seme non conciato e mostra evidenti sintomi di striatura bruna.

4 Sistemi di difesa dalle malattie lotta chimica ( antiparassitari) Genetica ( geni di resistenza) L'impiego di varietà di orzo resistenti al patogeno è il metodo di difesa più economico e più ecocompatibile

5 Esperienza di laboratorio: Utilizzo di marcatori molecolari per la selezione assistita (MAS) per la resistenza a malattia fungina in orzo. I principali vantaggi della MAS sono: Possibilità di selezionare genotipi con un gene specifico ( geni di resistenza) possibilità di selezionare simultaneamente per più geni di resistenza a più patogeni. selezione per resistenza a patogeni evitando test di infezione; riduzione dei tempi necessari alla costituzione di nuove verietà.

6 I Marcatori Molecolari I marcatori molecolari sono sequenze identificabili di DNA che si trovano in specifiche regioni del genoma e che vengono trasmesse secondo le normali leggi di Mendel da una generazione all'altra. Si basano sulla rilevazione di differenze nella sequenza nucleotidica del DNA che costituisce il genoma di ogni individuo, diversamente dai marcatori morfologici, che si basano su caratteri osservabili, e da quelli biochimici, che si basano sulle proteine codificate dai geni. Ne esistono molti tipi diversi, differenti per molteplici aspetti, come la quantità di tempo, di risorse e di lavoro richiesti per la loro analisi, la ricorrenza nel genoma e la variabilità genetica in una data popolazione.

7 GENE di RESISTENZA Rdg1 MARCATORI CROMOSOMA 2HL

8 Raccolta del materiale vegetale Genotipi derivati da incrocio tra pianta Resistente (K4-31) e piante suscettibili ORZO A K B Sfera C FO K D Fior E FO K F Boreale G FO H Markers: tutte Yd3+Rdg1 Gene di resistenza: Rdg1

9

10 Analisi molecolare Estrazione del DNA da tessuto fogliare di orzo: Metodo kit Wizard Magnetic 96 DNA Plant System Il metodo si basa sull'uso del reagente MagneSil Paramagnetic Particles (PMPs), che lega gli acidi nucleici, permettendone poi di fare facilmente i lavaggi ed in fine un eluizione in acqua (in cui il DNA si risospende). Procedimento con Robot Biomek 2000 Il ricorso al Robot consente di eseguire in automatico buona parte della procedura di estrazione e purificazione del DNA.

11

12 Polimerase Chain Reaction (PCR). Ideata da Kary Mullis nell aprile 1983 (gli fruttò il premio Nobel per la chimica nel 1993), la PCR non è altro che la polimerizzazione del DNA effettuata in vitro e ripetuta per più volte, portando ad una amplificazione esponenziale della quantità di DNA sintetizzato a partire da una piccola quantità di DNA stampo ( template ). L enzima DNA-polimerasi sintetizza l elica di DNA complementare all elica stampo a partire da dei brevi tratti di DNA a singola elica (primers),appositamente disegnati, perciò basta ripetere più volte denaturazione, appaiamento dei primers ed estensione. L uso di polimerasi termostabili ha permesso di poter ripetere queste fasi più volte di seguito, in macchine dette temocycler, senza dover aggiungere, dopo ogni fase di denaturazione, nuova polimerasi (all inizio si usava la DNApolimerasi di E. coli). Gli step fondamentali della reazione di polimerizzazione sono : denaturazione della doppia elica ad alta temperatura (94 C); appaiamento dei primers alla temperature di appaiamento (temperature di annealing Ta); estensione dei primers a dare DNA a doppia elica (dsdna) alla temperature di lavoro della DNA polimerasi usata (generalmente si usa la Taq-polimerase che lavora a 72 C). 35 cicli di amplificazione: 2 35 =

13 Figura 3-8 Reazione a catena della polimerasi (fonte: Genetica di Russel)

14 Marcatori molecolari per il gene di resistenza marker type primer F/R Tm Ta enzyme FD CAPS TCTCTCATCTATGATATGATCCTAGC AflII CAACAGGATCAGAGAAACCATGC 65.6 GBM1462 SSR CTGTGGCTAAAGAAGGCACC CACGACGTTGTAAAACGACAAGATTGCTGCAGGATAGGC 62.0 Tm= ( C+G) x 4 C +(A+T) x 2 C Ta = Tm-5

15

16 Corsa elettroforetica su gel di agarosio. Poiché a ph alcalino il DNA è carico negativamente (dati i gruppi fosfato dei nucleotidi) si sfrutta la diversa velocità di migrazione elettroforetica attraverso le maglie del gel di agarosio in un campo elettrico. Aumentando la percentuale di agarosio si hanno maglie più fitte e quindi si separano meglio frammenti di dimensioni simili, cioè si aumenta il potere risolutivo del gel.

17 Fig. Genotipizzazione della popolazione F 2 FO 4941 per il gene Rdg2a con la sonda molecolare 146G20-1: il prodotto di PCR digerito ha evidenziato, su gel di agarosio, genotipi con frammenti di circa 270 bp (banda bassa), corrispondenti al controllo resistente (Cornelia), e frammenti di circa 300 bp (banda alta), corrispondenti al controllo suscettibile (Jaidor), oltre a genotipi eterozigoti.

18 Analisi di un intera piastra( 96 campioni)

19 Conclusioni Attraverso l analisi del DNA è possibile selezionare i genotipi resistenti ( MAS) È quindi possibile sviluppare nuove varietà di orzo resistenti in maniera più veloce

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Viaggio al centro della Biodiversità

Viaggio al centro della Biodiversità Liceo G.M. Colombini - Piacenza - indirizzo scientifico-tecnologico Biodiversità all interno di ogni specie e varietà dovute all azione dell uomo in ambito genetico Viaggio al centro della Biodiversità

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction)

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi PR Polymerase hain Reaction = Reazione a catena della polimerasi mplifica un frammento di D di cui si conosce almeno in parte la sequenza Utilizza un enzima, la D Polimerasi, per copiare una molecola di

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali

Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali Chiara Delogu Lorella Andreani SCS- Centro per la sperimentazione e certificazione delle sementi SEME Materiale

Dettagli

Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

PROGETTO BIOFORM. Tipizzazione del gene PV92

PROGETTO BIOFORM. Tipizzazione del gene PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole cellule. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica Biologia molecolare clinica Organizzazione del laboratorio di biologia molecolare clinica Le tecniche di biologia molecolare negli ultimi anni si sono diffuse nei laboratori di diagnostica clinica dove

Dettagli

Principali tecniche di base

Principali tecniche di base Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione (Southern blotting) PCR (Polymerase Chain Reaction) (Sequenziamento) Tecniche di base Enzimi di di restrizione

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM)

Lezione 7-8 Giovedì 18 Marzo 2010. aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) Lezione 7-8 Giovedì 18 Marzo 2010 aula 2 ore 9:00 corso integrato di Biologia Applicata (BU) ed Ingegneria Genetica (BCM) materiale del T-Rex system pfrt/laczeo = Flp-In target site vector for stable transfection

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

PROGETTO BIOFORM. Tipizzazione del locus PV92

PROGETTO BIOFORM. Tipizzazione del locus PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole celle. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto

Dettagli

LA REAZIONE A CATENA DELLA POLIMERASI PCR

LA REAZIONE A CATENA DELLA POLIMERASI PCR LA REAZIONE A CATENA DELLA POLIMERASI PCR INTRODUZIONE Tecnica ideata da Mullis e collaboratori nel 1984 La possibilita' di disporre di quantità virtualmente illimitate di un determinato frammento di DNA,

Dettagli

Marcatori molecolari

Marcatori molecolari Marcatori molecolari Caratteristiche e applicazioni Luca Gianfranceschi e Rosanna Marino 1 I marcatori molecolari Strumento per l analisi genetica Strumento Molecolari Analisi genetica Marcatori non oggetto

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale

Dettagli

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin Elementi di genetica di base e marcatori molecolari Dott.ssa Marica Soattin Organismi animali costituiti da cellule di tipo eucariote Cellule con nucleo differenziato delimitato da membrana e organelli

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE Un marcatore genetico è un qualsiasi fattore ereditario (quindi trasmissibile alla progenie) di cui esistano più varianti genotipiche. Essi consentono

Dettagli

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine

Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi basati sulla ricerca del DNA e delle proteine Università degli Studi del Piemonte Orientale A. Avogadro CORSO DI ALTA FORMAZIONE IN LEGISLAZIONE ALIMENTARE Metodi per il rilevamento degli OGM in matrici alimentari: principi ed i metodi di analisi

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche

BIOLOGIA MOLECOLARE: introduzione alle tecniche e alle loro applicazioni cliniche I T A L B I O F O R M A i n c o l l a b o r a z i o n e c o n O R D I N E N A Z I O N A L E D E I B I O L O G I o r g a n i z z a i l c o r s o d i a g g i o r n a m e n t o BIOLOGIA MOLECOLARE: introduzione

Dettagli

Elettroforesi degli acidi nucleici

Elettroforesi degli acidi nucleici Elettroforesi degli acidi nucleici Una volta che i frammenti del DNA o del RNA da analizzare sono stati amplificati con la reazione PCR è necessario separarli ed identificarli. A tale scopo si utilizza

Dettagli

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,

Dettagli

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini

Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero. Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Protocollo di Real-Time RT-PCR per la diagnosi del fitoplasma della Moria del Pero Claudio Ratti, Chiara Lanzoni e Carlo Poggi Pollini Moria del pero (Candidatus Phytoplasma pyri) Fitoplasmi: Microrganismi

Dettagli

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a)

PRINCIPALI APPLICAZIONI DELLA PCR. PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) EAZIONE A CATENA DELLA POLIMEASI (PC) PINCIPALI APPLICAZIONI DELLA PC UPPE primer LOWE primer GENE X 1. Identificazione di agenti patogeni nell uomo, negli animali o negli alimenti (batteri e virus) 2.

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

Retrovirus, DNA ricombinante e PCR (seconda parte). LA LEZIONE

Retrovirus, DNA ricombinante e PCR (seconda parte). LA LEZIONE Retrovirus, DNA ricombinante e PCR (seconda parte). LA LEZIONE Polymerase chain reaction (PCR) Il metodo della reazione a catena della polimerasi è stato ideato nel 1983 da Kary B. Mullis, che nel 1993

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

ELETTROFORESI SU GEL

ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi

Dettagli

HPV & Cervico-carcinoma

HPV & Cervico-carcinoma Infezione HPV & Cervico-carcinoma Infezione HPV HPV ad alto rischio Età all infezione 80% 20% Fattori mmunologici Transitoria Infezione persistente Infezione da C. trachomatis Displasia basso grado CIN

Dettagli

BIODIVERSITA VEGETALE PER CARATTERI UTILI. La biodiversità: una risorsa essenziale della natura Bari, 18 febbraio 2011

BIODIVERSITA VEGETALE PER CARATTERI UTILI. La biodiversità: una risorsa essenziale della natura Bari, 18 febbraio 2011 La biodiversità: una risorsa essenziale della natura Bari, 18 febbraio 2011 BIODIVERSITA VEGETALE PER CARATTERI UTILI A. Blanco Dipartimento di Biologia e chimica agro-forestale Università di Bari Biodiversità

Dettagli

Capitolo 1 Introduzione alla PCR

Capitolo 1 Introduzione alla PCR Capitolo 1 Introduzione alla PCR La tecnologia della PCR ha rivoluzionato l attività dei laboratori di ricerca e di diagnostica trovando applicazioni ed impieghi in svariati campi della medicina e della

Dettagli

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni Corso di: GESTIONE FAUNISTICA Prof. Bernardino Ragni Università degli Studi di Perugia Facoltà di Scienze Matematiche Fisiche Naturali Corso di laurea in Scienze Naturali LAUREA MAGISTRALE Caso di studio:

Dettagli

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare

Quantificazione di. legionella pneumophila. mediante metodo biomolecolare Quantificazione di legionella pneumophila mediante metodo biomolecolare Laboratorio di Epidemiologia Genetica e Genomica di Sanità Pubblica Istituto di Igiene LABORATORIO DI EPIDEMIOLOGIA GENETICA: ATTIVITA

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

La tecnica Real-Time PCR nelle analisi alimentari: Sicurezza e prevenzione delle frodi

La tecnica Real-Time PCR nelle analisi alimentari: Sicurezza e prevenzione delle frodi La tecnica Real-Time PCR nelle analisi alimentari: Sicurezza e prevenzione delle frodi -Dr. Matteo D Andrea- -Product Specialist PCR, R-Biopharm Italia- Scandali alimentari: Sempre maggiore attenzione

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania

Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania Azienda Ospedaliero-Universitaria Policlinico - Vittorio Emanuele Catania Settore: Provveditorato ed Economato - tel. 095/7435769 fax 095/37844 Oggetto: Procedura negoziata per la fornitura di diagnostici

Dettagli

MAS MARKER ASSISTED SELECTION SELEZIONE ASSISTITA DEI MARCATORI. Carmine Correale

MAS MARKER ASSISTED SELECTION SELEZIONE ASSISTITA DEI MARCATORI. Carmine Correale MAS MARKER ASSISTED SELECTION SELEZIONE ASSISTITA DEI MARCATORI Carmine Correale CHE COS E La Selezione Assistita dei Marcatori (MAS Marker Assisted Selection) è una tecnica che accelera e semplifica la

Dettagli

Il termine deriva dal greco antico κλών(klōn, ramo", "ramoscello"), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o

Il termine deriva dal greco antico κλών(klōn, ramo, ramoscello), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o Il termine deriva dal greco antico κλών(klōn, ramo", "ramoscello"), e perclonazione, inbiologia, si intende lariproduzione asessuata, naturale o artificiale, di un intero organismo vivente o anche di una

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità

RELAZIONE TECNICA. Indagini Biologico-Molecolari per Accertamento di Paternità RELAZIONE TECNICA Indagini Biologico-Molecolari per Accertamento di Paternità PROSPETTO RIASSUNTIVO DELL'ANALISI ANALISI INDAGINE DI PATERNITA' PERSONE SOTTOPOSTE AL TEST QUESITO Campione Biologico Tampone

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO. Università degli Studi di Palermo C.I.R.I.T.A.

PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO. Università degli Studi di Palermo C.I.R.I.T.A. PROGETTO POR SICILIA 2000/2006 1999.IT.16.1.PO.011/4.17b/8.3.7/0056 Università degli Studi di Palermo C.I.R.I.T.A. PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO Studio della struttura genetica e demografica

Dettagli

Strumenti e Tecniche di studio in patologia

Strumenti e Tecniche di studio in patologia Strumenti e Tecniche di studio in patologia Gli strumenti della patologia: Microscopia Biologia molecolare Indagini biochimiche Microscopia Ottica citopatologia ed istopatologia citochimica ed istochimica

Dettagli

MAS -Marker Assisted Selection SELEZIONE ASSISTITA DA MARCATORI

MAS -Marker Assisted Selection SELEZIONE ASSISTITA DA MARCATORI MAS -Marker Assisted Selection SELEZIONE ASSISTITA DA MARCATORI CHE COS E La Selezione Assistita da Marcatori (MAS, Marker Assisted Selection) è una tecnica che accelera e semplifica la selezione delle

Dettagli

CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O.

CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O. ALLEGATO A CAPITOLATO TECNICO PER DIAGNOSTICI PER TIPIZZAZIONE MOLECOLARE DA DESTINARSI AL LABORATORIO DI GENETICA MOLECOLARE-MEDICINA LEGALE P.O. MONSERRATO Durata della fornitura: 1 anno + 1 rinnovabile

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

INTRODUZIONE ALLA BIOLOGIA MOLECOLARE CLINICA (a cura del Responsabile Scientifico del Congresso: Dott. Paolo Lanzafame)

INTRODUZIONE ALLA BIOLOGIA MOLECOLARE CLINICA (a cura del Responsabile Scientifico del Congresso: Dott. Paolo Lanzafame) INTRODUZIONE ALLA BIOLOGIA MOLECOLARE CLINICA (a cura del Responsabile Scientifico del Congresso: Dott. Paolo Lanzafame) La Biologia Molecolare Clinica è il settore disciplinare afferente alla Medicina

Dettagli

Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia

Dettagli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli ANALISI OGM SOYA Il progetto si proponeva di verificare le caratteristiche qualitative di diversi lotti di soya rispetto alla contaminazione accidentale da OGM per avere una valutazione indicativa della

Dettagli

Ibridazione degli acidi nucleici

Ibridazione degli acidi nucleici Ibridazione degli acidi nucleici L ibridazione consiste nel porre a contatto acidi nucleici a singolo filamento provenienti da fonti diverse: Sonda di solito una popolazione omogenea di molecole note.

Dettagli

LA TECNOLOGIA DEL DNA RICOMBINANTE

LA TECNOLOGIA DEL DNA RICOMBINANTE UNITÀ VET. DIDATTICA DI BIOLOGIA MOLECOLARE LA TECNOLOGIA DEL DNA RICOMBINANTE Roberto Giacominelli Stuffler 1. Gli enzimi di restrizione 2. La trascrittasi inversa 3. Il DNA ricombinante 4. La PCR 2 GLI

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

Il controllo analitico degli OGM

Il controllo analitico degli OGM Il controllo analitico degli OGM Problematiche analitico metodologiche nella tracciabilità degli OGM INDIVIDUAZIONE: l obiettivo è di determinare se un prodotto contiene OGM o no (non da notizie sul tipo

Dettagli

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675

Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 Orga Bio Human S.r.l. DIREZIONE E UFFICI: Via Amsterdam 75, 00144 Roma Tel/fax: 06 99701675 SEDE LEGALE: Via Helsinki 21, 00144 Roma Tel. 06 97998273; Fax 06 52246148 e-mail: orgabiohuman@fastwebnet.it

Dettagli