DNA - DENATURAZIONE E RIASSOCIAZIONE

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "DNA - DENATURAZIONE E RIASSOCIAZIONE"

Transcript

1

2 DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando una molecola a doppio strand quando la temperatura viene abbassato lentamente.

3 EVOLUZIONE DELLA MOLECOLA DI DNA Mutazioni strutturali (mutazioni di segmentazione) delezioni inserzioni inversioni ricombinazione Mutazioni puntiformi (mutazioni di sostituzioni) transizioni A G C T G A T C trasversioni A C C A T A C G G C A T G T T G

4 MARCATORI MOLECOLARI DI USO CORRENTE MARCATORI MOLECOLARI CHE SI BASANO SU: RESTRIZIONE PCR SEQUENZIAMENTO - RFLP - RAPD Sequenze di: - PCR-RFLP - ISSR - ndna - SSR (microsatelliti) - cpdna - RAMP - mtdna - AFLP - SNP

5 I DATI SI ANALIZZANO PER OMOLOGIA Sito di mappa Dimensione di frammenti Allineamento di sequenze nucleotidiche

6 TECNICHE DI BASE Strategie di campionamento e conservazione del materiale Estrazione di DNA genomico, purificazione, valutazione della qualità e quantità Elettroforesi su gel Restrizione enzimatica PCR Clonaggio Sequenziamento

7 PCR Polymerase Chain Reaction (PCR) - Replicazione in vitro del DNA. Mullis per questa invenzione ha vinto il premio Nobel nel La PCR è in assoluto la tecnica fondamentale per gli studi molecolari.

8 PCR La reazione di amplificazione necessita di: DNA (template) Primer (inneschi) Miscela di nucleotidi (dntp: datp, dctp, dttp e dgtp) Taq-Polimerasi (DNA polimerasi) MgCl 2 Buffer La reazione avviene all interno di un thermocycler che permette lo svolgersi di cicli termici con temperature e tempi appropriati alle varie fasi della reazione.

9 PCR Paffetti, Emiliani

10 PCR Il DNA viene denaturato (95 C) I primer (forward e reverse) si legano (annealing) ai due strand (50-60 C) La polimerasi, usando i nucleotidi in soluzione, sintetizza la sequenza complementare (estensione 72 C) Le fasi sopra esposte vengono ripetute per decine di volte

11 PCR Regione d interesse DNA Denaturazione......AACCATCGGG.. TTTGAAACCTGGG.....TTGGTAGCCC AAACTTTGGACCC...

12 PCR Annealing dei primer AACCATCGGG.. TTTGAAACCTGGG... 3 AAACTTTG 5 5 ATCGGG 3 3..TTGGTAGCCC AAACTTTGGACCC... 5

13 PCR Estensione Taqpolimerasi AACCATCGGG.. TTTGAAACCTGGG... TAGCCC CTTTTAAAGGG AAACTTTG A T G C T G ATCGGG TTTTCCCAGG TTTGAAAC..TTGGTAGCCC AAACTTTGGACCC

14 PCR 2 a denaturazione AACCATCGGG.. TTTGAAACCTGGG... 3 TAGCCC CTTTTAAAGGG AAACTTTG ATCGGG TTTTCCCAGG TTTGAAAC..TTGGTAGCCC AAACTTTGGACCC

15 PCR 2 annealing e 2 a estensione TAGCCC ATCGGG CTTTTAAAGGG AAACTTTG ATCGGG TTTTCCCAGG AAACTTTG TTTGAAAC

16 PCR

17 PCR Ottimizzazione Temperatura di denaturazione e tempo : 1 min a 94 C Temperatura di annealing (dipendente dal primer) e tempo: T a =1/2 (T m1 +T m2 )-5 C 30 sec Temperatura di estensione e tempo (dipendente dalla polimerasi: C da 0.5 a 3 min (100bp/sec) Da 25 a 35 cicli

18 PCR Ottimizzazione Qualità e quantità del template Concentrazione del Mg ++ : 1.5 mm o più di MgCl 2 Concentrazione di primer: da 0.2 a 1 µm di ognuno dei primer dntp: da 50 a 100 µm di ognuno dei dntp

19 Lunghezza dei primer: basi PCR Disegno dei primer I primer hanno una loro precisa T m può essere calcolata in modo approssimativo: T m =4 C (G+C) + 2 C (A+T) in modo più preciso: T m = (%G+C)-650/lunghezza Contenuto in GC: 50-60% Le basi iniziali al 5 è più conveniente che sia AT, al contrario quelle terminali al 3 CG Sono da evitare hairpin Porre particolare attenzione che non ci sia complementarietà interna o al 3 del primer per evitare la formazione di dimeri

20 PCR Touchdown Al fine di aumentare la specificità si possono utilizzare alte temperature di annealing nei primi cicli (60 C) ed abbassare gradualmente la temperatura (ca 1-5 C) ad ogni ciclo fino alla temperatura ottimale di annealing

21 QUALE MARCATORE PER QUALE SCOPO Quali sono le condizioni che abbiamo o cosa vogliamo avere (in tutto questo va incluso anche il budget a disposizione)? Quali sono le domande a cui vogliamo rispondere? Qual è il livello di variabilità che ci aspettiamo?

22 COME DEVE ESSERE UN BUON MARCATORE Sufficientemente polimorfico ed informativo Preferibilmente co-dominante Presentare una frequenza ed una distribuzione nel genoma alta Selettivamente neutrale Facile e veloce da ottenere Altamente riproducibile e facilmente analizzabile Paffetti, Emiliani

23 MARCATORI MOLECOLARI DI USO CORRENTE MARCATORI MOLECOLARI CHE SI BASANO SU: RESTRIZIONE PCR SEQUENZIAMENTO - RFLP - RAPD Sequenze di: - PCR-RFLP - ISSR - ndna - SSR (microsatelliti) - cpdna - RAMP - mtdna - AFLP - SNP

24 RFLP Ragionevole alto polimorfismo Relativamente facile da un punto di vista operativo, ma con tempi lunghi Marcatore co-dominante Le caratteristiche della sonda non sono sempre disponibili Comparazione diretta dei pattern non sempre facilmente interpretabili

25 Mutazioni che possono e non possono essere evidenziate con gli RFLP Mutazioni puntiformi nel sito di restrizione Inversione quando incorporata nei siti di restrizione Inserzione/delezione dentro e/o fra i siti di restrizione Mutazioni puntiformi fuori dai siti di restrizione Inversioni dentro due siti di restrizione

26 Una variazione da TA e AT porta alla perdita o all acquisto di un sito di restrizione 5 GAATTC 3 3 CTTAAG 5 Perdita di un sito di restrizione EcoRI 5 G AATTC 3 3 CTTAA G 5 Guadagno di un sito di restrizione 5 GAATAC 3 3 CTTATG 5 EcoRI

27 L inserzione causa una variazione nei frammenti di restrizione

28 Delezione/inserzione causa variazione nei frammenti di restrizione

29 PCR-RFLP (CAPS-Cleaved Amplified Polymorphic Sequences) Preparare il frammento di DNA target via PCR Digerire il frammento di PCR con un enzima di restrizione Separazione dei frammenti digeriti tramite elettroforesi Valutazione della dimensione dei frammenti di digestione o mappa di restrizione

30 PCR-RFLP Accurato e preciso Necessario conoscere il frammento Basso polimorfismo e informazioni limitate

31 MARCATORI MOLECOLARI DI USO CORRENTE MARCATORI MOLECOLARI CHE SI BASANO SU: RESTRIZIONE PCR SEQUENZIAMENTO - RFLP - RAPD Sequenze di: - PCR-RFLP - ISSR - ndna - SSR (microsatelliti) - cpdna - RAMP - mtdna - AFLP - SNP

32 RAPD Random Amplified Polymorphic DNA Una semplice PCR con un solo primer (normalmente di 10 basi) di sequenza casuale

33 RAPD 500 bp 1250 bp 200 bp 300 bp 450 bp

34 RAPD I primer sono decameri E importante regolare il contenuto in GC I cicli di amplificazione sono diversi da quelli di una specifica, temperatura di annealing più bassa L analisi dei dati può essere difficoltosa Tra i marcatori molecolari è quello che offre il campionamento più vasto del genoma Tipico profilo di amplificazione primer 1247 Tipico profilo di amplificazione primer 1253 Tipico profilo di amplificazione primer RF2

35 RAPD E una metodica facile e veloce Alto polimorfismo Occorrono solo piccole quantità di DNA Sono sensibili alle condizioni Sono marcatori dominanti Comigrazione di frammenti

36 RAPD Sono dei buoni marcatori nel caso in cui Valutare e stimare la diversità velocemente tra i campioni (in particolare nel caso di valutazione della variabilità intraspecifica) Quando altri metodi non riescono a mettere in evidenza un buon livello di polimorfismo Individuare e caratterizzare tramite il sequenziamento utili marcatori a partire dal prodotto RAPD (bande)

37 RAPD Migliorare la riproducibilità Ottimizzare e stabilizzare le condizioni di PCR Thermo Cycler Ottimizzazione del ciclo (T a =36 C) La velocità di ramping non deve essere troppo veloce (ca 0.5 C per sec) Mg ++ (3 mm) Concentrazione del templato

38 MARCATORI MOLECOLARI DI USO CORRENTE MARCATORI MOLECOLARI CHE SI BASANO SU: RESTRIZIONE PCR SEQUENZIAMENTO - RFLP - RAPD Sequenze di: - PCR-RFLP - ISSR - ndna - SSR (microsatelliti) - cpdna - RAMP - mtdna - AFLP - SNP

39 SSR Simple Sequence repeat od anche comunemente detti microsatelliti o Simple Tandem Repeat (STR) Ripetizioni in tandem (1-6 bp) di corte sequenze per es. AAAAAAAA ATATATATAT GAGGAGGAGGAGGAGGAG CAGACAGACAGACAGACAGA

40 X-satellite Lunghezza di unità ripetute Termine specifico > 100 bp satellite bp minisatellite 1-6 bp microsatellite mixed medisatellite

41 VNTR Variable Number Tandem Repeat Microsatellite (SSR) + minisatellite

42 SSR Polimorfismo determinato dal diverso numero di basi ripetute

43

44 Vantaggi degli SSR Non sono tradotti e non sono sottoposti a selezione quindi accumulano mutazioni costantemente nel tempo Queste mutazioni avvengono estesamente e casualmente intutto il genoma Altamente polimorfici e veramente comuni ( per genoma) Presentano un eredità codominante Quando i primer sono conosciuti possono essere prodotti a partire da piccole quantità di DNA via PCR Possono essere diffusi da un laboratorio ad un altro con facilità

45 Svantaggi degli SSR Sono necessarie informazioni sulla sequenza per poter disegnare i primer nelle zone fiancheggianti ed i procedimenti per ottenerle sono molto dispendiose e lunghe Di solito è necessario testare librerie genomiche per individuare e caratterizzare i loci microsatellite per quelle specie oggetto di studio

46 SSR Quando i primer fiancheggianti l SSR sono noti, il polimorfismo dell SSR può essere facilmente valutato via PCR

47 MARCATORI MOLECOLARI DI USO CORRENTE MARCATORI MOLECOLARI CHE SI BASANO SU: RESTRIZIONE PCR SEQUENZIAMENTO - RFLP - RAPD Sequenze di: - PCR-RFLP - ISSR - ndna - SSR (microsatelliti) - cpdna - RAMP - mtdna - AFLP - SNP

48 AFLP Amplified Fragment Length Polymorphism Questa tecnica è una combinazione tra RFLP e RAPD Sono marcatori potenti per studi intraspecifici

49 AFLP Sito MseI Sito EcoRI DNA genomico + T C+ Il DNA genomico viene digerito con due enzimi di restrizione spesso MseI ed EcoRI, per formare frammenti con le estremità desiderate Adattatori (2 corte sequenze a doppio strand con le estremità complementari ad uno dei frammenti digeriti) sono ligati ai frammenti per formare siti di binding per i primer nelle successive amplificazioni PCR 1 e PCR 2 usando come templato il ligato e primer che possono accoppiarsi con gli adattatori DNA digerito Adattatori complementari Frammenti ligati A + TX A G G XC+

50 AFLP-vantaggi e svantaggi Sono marcatori altamente polimorfici Sono riproducibili E una tecnica facile ed i primer sono standard La procedura è lunga Spesso i risultati sono difficili da analizzare E una tecnica costosa

51 MARCATORI MOLECOLARI DI USO CORRENTE MARCATORI MOLECOLARI CHE SI BASANO SU: RESTRIZIONE PCR SEQUENZIAMENTO - RFLP - RAPD Sequenze di: - PCR-RFLP - ISSR - ndna - SSR (microsatelliti) - cpdna - RAMP - mtdna - AFLP - SNP

52 SNP Single Nucleotide Polymorphism Uno SNP è una differenza in una singola coppia di basi in un sito di DNA Generalmente si possono mettere in evidenza tramite elettroforesi di acrilammide, tramite sequenziamento o spettrofotometria di massa Le loro applicazioni comprendono test ed analisi di linkage, sistemi di screening, ecc.

53 SEQUENZIAMENTO Tecnica precisa ed esplicita Si possono distinguere mutazioni strutturali e puntiformi L omologia può essere facilmente valutata attraverso allineamenti di sequenza

54 SEQUENZIAMENTO Quale frammento? Sequenze codificanti hanno basso polimorfismo Gli introni presentano un polimorfismo medio Gli spaziatori sono altamente polimorfici

55 RAPD Quale marcatore per quale proposta Una correlazione fra la scelta del marcatore ed il livello di diversità AFLP SSR RFLP PCR-RFLP Ricerca veloce e stima dei livelli di diversità (RAPD o ISSR) ISSR Sequenziamento individuo popolazione specie genere famiglia Diversità abbastanza alta (RFLP, PCR- RFLP, Sequenziamento) SSR se i primer per l organismo o per individui tassonomicamente vicini sono disponibili Se siamo disposti a lavorare duramente ed abbiamo abbastanza fortuna possiamo identificare da soli gli SSR Gli AFLP sono una buona scelta se non sono un problema i soldi e l automazione Il sequenziamento è veramente un metodo preciso ed una buona soluzione se esiste un polimorfismo sufficiente

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction)

REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

IL MIGLIORAMENTO GENETICO ANIMALE E LA GENETICA MOLECOLARE

IL MIGLIORAMENTO GENETICO ANIMALE E LA GENETICA MOLECOLARE IL MIGLIORAMENTO GENETICO ANIMALE E LA GENETICA MOLECOLARE Il miglioramento genetico delle produzioni animali, realizzato sino ad ora, è frutto dell elaborazione elaborazione e applicazioni della teoria

Dettagli

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo

SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo C.R.A. Consiglio per la Ricerca in Agricoltura Centro di ricerca per la genomica Fiorenzuola d Arda (Piacenza) SELEZIONE ASSISTITA PER LA RESISTENZA patogeni in orzo Tutor: Dott. Gianni TACCONI Studente:

Dettagli

PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you

Dettagli

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR)

AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento

Dettagli

Marcatori molecolari

Marcatori molecolari Marcatori molecolari Caratteristiche e applicazioni Luca Gianfranceschi e Rosanna Marino 1 I marcatori molecolari Strumento per l analisi genetica Strumento Molecolari Analisi genetica Marcatori non oggetto

Dettagli

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin

Elementi di genetica di base e marcatori molecolari. Dott.ssa Marica Soattin Elementi di genetica di base e marcatori molecolari Dott.ssa Marica Soattin Organismi animali costituiti da cellule di tipo eucariote Cellule con nucleo differenziato delimitato da membrana e organelli

Dettagli

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA

Dettagli

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE

I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE I MARCATORI GENETICI APPLICAZIONE AL SETTORE FORESTALE Un marcatore genetico è un qualsiasi fattore ereditario (quindi trasmissibile alla progenie) di cui esistano più varianti genotipiche. Essi consentono

Dettagli

Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio

Dettagli

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica

Dettagli

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009

Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di. DNA umano. 22-26 giugno 2009 Analisi di polimorfismi usati per la caratterizzazione di profili genetici in campioni di 22-26 giugno 2009 DNA umano 1 GENETICA FORENSE La genetica forense applica tecniche di biologia molecolare al fine

Dettagli

Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento

Dettagli

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA CORSO INTEGRATO di Genetica e Biologia Molecolare GENETICA a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA Dott.ssa Elisabetta Trabetti POLIMORFISMO La presenza nella popolazione di due

Dettagli

Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT

Dettagli

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)

Dettagli

ENZIMI DI RESTRIZIONE

ENZIMI DI RESTRIZIONE ENZIMI DI RESTRIZIONE La scoperta degli enzimi di restrizione e modificazione Intorno agli anni 50 si notò che talvolta l introduzione in E.coli di DNA esogeno, proveniente da un diverso ceppo di E.coli,

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica

Dettagli

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione

Dettagli

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI)

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Dott.ssa G. Scalet Sezione Microbiologia-Dipartimento Di Patologia e Diagnostica Università

Dettagli

Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale

Dettagli

METODI DI MARCATURA DEGLI ACIDI NUCLEICI

METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20

SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 SOLUZIONI AI PROBLEMI DEL CAPITOLO 20 Domande concettuali C1. Si potrebbe concludere che la donna porta una delezione nel gene che è riconosciuto dalla sonda. Per clonare questo gene, potresti iniziare

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Capitolo 1 Introduzione alla PCR

Capitolo 1 Introduzione alla PCR Capitolo 1 Introduzione alla PCR La tecnologia della PCR ha rivoluzionato l attività dei laboratori di ricerca e di diagnostica trovando applicazioni ed impieghi in svariati campi della medicina e della

Dettagli

Principali tecniche di base

Principali tecniche di base Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione (Southern blotting) PCR (Polymerase Chain Reaction) (Sequenziamento) Tecniche di base Enzimi di di restrizione

Dettagli

PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO. Università degli Studi di Palermo C.I.R.I.T.A.

PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO. Università degli Studi di Palermo C.I.R.I.T.A. PROGETTO POR SICILIA 2000/2006 1999.IT.16.1.PO.011/4.17b/8.3.7/0056 Università degli Studi di Palermo C.I.R.I.T.A. PRESENTAZIONE DEI RISULTATI FINALI DEL PROGETTO Studio della struttura genetica e demografica

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato

Dettagli

Tecniche molecolari per la diagnosi di funghi fitopatogeni

Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche molecolari per la diagnosi di funghi fitopatogeni Tecniche che consentono l identificazione, la diagnosi, la quantificazione di un organismo mediante l analisi degli acidi nucleici: DNA RNA Diagnosi

Dettagli

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi

PCR Polymerase Chain Reaction = Reazione a catena della polimerasi PR Polymerase hain Reaction = Reazione a catena della polimerasi mplifica un frammento di D di cui si conosce almeno in parte la sequenza Utilizza un enzima, la D Polimerasi, per copiare una molecola di

Dettagli

Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS

Dettagli

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di

Dettagli

Progettazione di primer per PCR. Verifica della specificità

Progettazione di primer per PCR. Verifica della specificità Progettazione di primer per PCR. Verifica della specificità La PCR (Polymerase Chain Reaction) ha progressivamente assunto importanza tra le tecnologie ricombinanti in quanto in diversi protocolli applicativi

Dettagli

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA.

ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE ANALISI DI SEQUENZA. ANALISI DI MUTAZIONI PUNTIFORMI NON NOTE Margherita Vinciguerra U.O. Ematologia II Laboratorio per lo Studio e la Diagnosi Molecolare Prenatale di Talassemia A.O. V. Cervello, Palermo. Analisi di sequenza

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori

Istruzioni d uso. BAG Cycler Check. REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori Istruzioni d uso BAG Cycler Check REF 7104 (10 test) REF 71044 (4 test) Kit per la validazione dell uniformità della temperatura nei termociclatori pronto all uso, prealiquotato Indice 1. Descrizione del

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Identificazione di mutazioni e analisi dei polimorfismi del DNA

Identificazione di mutazioni e analisi dei polimorfismi del DNA Identificazione di mutazioni e analisi dei polimorfismi del DNA L identificazione delle mutazioni che causano malattie può oggi essere effettuata con metodiche relativamente semplici e pratiche in un laboratorio

Dettagli

Immagine di una sequenza ben riuscita. Sequences troubleshooting

Immagine di una sequenza ben riuscita. Sequences troubleshooting Immagine di una sequenza ben riuscita. Sequences troubleshooting Sequenza fallita Reazione fallita: non presenta picchi definiti e ha un alto rumore di fondo. il primer non trova sito di annealing il DNA

Dettagli

Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali

Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali Dal seme alla farina: metodi tradizionali e innovativi per la tracciabilità genetica dei cereali Chiara Delogu Lorella Andreani SCS- Centro per la sperimentazione e certificazione delle sementi SEME Materiale

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

PCR - Polymerase Chain Reaction

PCR - Polymerase Chain Reaction PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando i principi della duplicazione del DNA,

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

PROGETTO BIOFORM. Tipizzazione del gene PV92

PROGETTO BIOFORM. Tipizzazione del gene PV92 Ci fu un tempo in cui per amplificare il DNA, dovevi crescere tonnellate e tonnellate di piccole cellule. Poi è arrivato un ragazzo di nome Dr. Kary Mullis, Ha detto che si può amplificare in vitro altrettanto

Dettagli

DNA Memory. Approfondimento del corso di Bioinformatica. prof.ssa Cocco. Sebastiano Vascon

DNA Memory. Approfondimento del corso di Bioinformatica. prof.ssa Cocco. Sebastiano Vascon DNA Memory Approfondimento del corso di Bioinformatica prof.ssa Cocco DNA Memory (Outline) Nested PCR NPMM (Nested Primer Molecular Memory) Gerarchie di memoria Accesso ai dati Spazio di memoria Vincoli

Dettagli

Preparazione dei campioni da inviare per il sequenziamento

Preparazione dei campioni da inviare per il sequenziamento Preparazione dei campioni da inviare per il sequenziamento PCR preparativa Buffer 10x dntp 2mM Taq polimerasi Oligonucleotidi up e down 100 ng/ul Volume finale 2 ul/campione 2 ul/campione 0,5 U/campione

Dettagli

PROGETTO DNA CHIAVI IN MANO

PROGETTO DNA CHIAVI IN MANO PROGETTO DNA CHIAVI IN MANO La collaborazione con il Virgilio e il progetto dell IFOM Il progetto DNA chiavi in mano è un percorso pensato dal Centro di Ricerca internazionale IFOM per avvicinare i ragazzi

Dettagli

LA REAZIONE A CATENA DELLA POLIMERASI PCR

LA REAZIONE A CATENA DELLA POLIMERASI PCR LA REAZIONE A CATENA DELLA POLIMERASI PCR INTRODUZIONE Tecnica ideata da Mullis e collaboratori nel 1984 La possibilita' di disporre di quantità virtualmente illimitate di un determinato frammento di DNA,

Dettagli

ESTRAZIONE del DNA da gel di AGAROSIO

ESTRAZIONE del DNA da gel di AGAROSIO (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di Ingegneria Genetica e Microbiologa Applicata Prof. Renato Fani Percorso1: Analisi della variabilità genetica di popolazioni

Dettagli

I marcatori molecolari Strumento per l analisi genetica

I marcatori molecolari Strumento per l analisi genetica I marcatori molecolari Strumento per l analisi genetica Strumento Molecolari Analisi genetica Marcatori non oggetto di studio biologia molecolare Studio delle differenze genetiche Approccio indiretto Alcune

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria

Dettagli

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie TEST GENETICI INDIRETTI per la diagnosi di patologie genetiche ereditarie Diagnosi molecolare indiretta Quando non è nota la mutazione malattia, la diagnosi molecolare di quella malattia in una data famiglia

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

DNA BARCODING E BIODIVERSITÀ MOLECOLARE DELLE ACCIUGHE DEL MEDITERRANEO

DNA BARCODING E BIODIVERSITÀ MOLECOLARE DELLE ACCIUGHE DEL MEDITERRANEO DNA BARCODING E BIODIVERSITÀ MOLECOLARE DELLE ACCIUGHE DEL MEDITERRANEO In collaborazione con il Laboratorio di Neurobiologia dello Sviluppo DISTAV Prof.ssa Simona Candiani Prof. Mario Pestarino Dott.ssa

Dettagli

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni

Corso di: GESTIONE FAUNISTICA. Prof. Bernardino Ragni Corso di: GESTIONE FAUNISTICA Prof. Bernardino Ragni Università degli Studi di Perugia Facoltà di Scienze Matematiche Fisiche Naturali Corso di laurea in Scienze Naturali LAUREA MAGISTRALE Caso di studio:

Dettagli

La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano

La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano SOC di Farmacologia Sperimentale e Clinica VI CONGRESSO NAZIONALE FITeLab Slow Medicine Laboratory: IT s the Future 1-2-3 Ottobre 2015 Ospedale Borgo Roma (Verona) La farmacogeneticanella gestione del

Dettagli

METODI GENETICI NELLA IDENTIFICAZIONE DI

METODI GENETICI NELLA IDENTIFICAZIONE DI METODI GENETICI NELLA IDENTIFICAZIONE DI CIANOBATTERI Susanna Vichi, Simonetta Gemma, Emanuela Testai Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Convegno Cianobatteri

Dettagli

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono

Dettagli

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità

Dettagli

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona

Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Laboratorio di diagnostica Molecolare Dipartimento di Patologia Sezione di Anatomia Patologica Università di Verona Il tecnico di laboratorio biomedico: Applicazioni nel laboratorio di anatomia patologica

Dettagli

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno).

Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Esercitazione di Laboratorio corso Prof Tuberosa Biotecnologie genetiche agrarie Laurea in Biotecnologie (terzo anno). Programma: Giorno 1Preparazione di DNA genomico da foglie 2 - Controllo qualità DNA

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

UNIVERSITÀ DEGLI STUDI DI VERONA FACOLTÀ DI MEDICINA E CHIRURGIA CORSO DI LAUREA IN TECNICHE DI LABORATORIO BIOMEDICO

UNIVERSITÀ DEGLI STUDI DI VERONA FACOLTÀ DI MEDICINA E CHIRURGIA CORSO DI LAUREA IN TECNICHE DI LABORATORIO BIOMEDICO UNIVERSITÀ DEGLI STUDI DI VERONA FACOLTÀ DI MEDICINA E CHIRURGIA CORSO DI LAUREA IN TECNICHE DI LABORATORIO BIOMEDICO Polo Universitario delle Professioni Sanitarie Rovereto Dipartimento di Genetica e

Dettagli

Genotipizzazione virale

Genotipizzazione virale Genotipizzazione virale Typing Separazione basata su maggiori differenze genetiche tra i membri di una singola specie virale Subtyping Individuazione di differenze stabili all interno di un gruppo di virus

Dettagli

Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o

Dettagli

Tecniche molecolari in uso per la caratterizzazione ed identificazione di artropodi di interesse economico

Tecniche molecolari in uso per la caratterizzazione ed identificazione di artropodi di interesse economico Tecniche molecolari in uso per la caratterizzazione ed identificazione di artropodi di interesse economico Perché identificare insetti con tecniche molecolari? Identificazione morfologica Identificazione

Dettagli

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino

Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler. Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino Note Tecniche al LightCycler Selezione di sonde di ibridazione per LightCycler Olfert Landt e Andreas Nitsche, TIB MOLBIOL, Berlino 1. Introduzione Scopo di questa nota La detezione di amplicon specifici

Dettagli

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune:

III giorno: Da questo punto in poi, per entrambe le tipologie di campioni, si segue un protocollo comune: III giorno: 1) Estrazione del DNA genomico da campioni SECCHI e da coltura liquida 2) Preparazione del gel di agarosio 3) Corsa del DNA genomico in gel di agarosio e sua visualizzazione 4) PCR del DNA

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

La PCR e le sue applicazioni. La PCR di base L RT-PCR Applicazioni mediche e forensi

La PCR e le sue applicazioni. La PCR di base L RT-PCR Applicazioni mediche e forensi La PCR e le sue applicazioni La PCR di base L RT-PCR Applicazioni mediche e forensi Polymerase Chain Reaction e sue applicazioni La polymerase chain reaction o PCR è una tecnica relativamente recente che

Dettagli

Materiali e Metodi MATERIALI E METODI

Materiali e Metodi MATERIALI E METODI MATERIALI E METODI 62 1. Pazienti con IBS Per eseguire l analisi del polimorfismo 5HTTLPR è stato necessario ottenere campioni di sangue intero o saliva dai quali estrarre il DNA genomico. A tal fine è

Dettagli

Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva.

Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva. OBIETTIVO DEL LAVORO SPERIMENTALE: TIPIZZAZIONE DEI CROMOSOMI SESSUALI X e Y Amplificazione mediante PCR (Polymerase Chain Reaction) del DNA estratto dalla saliva. Cromosoma X Cromosoma y La tipizzazione

Dettagli

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in

Dettagli

CREAZIONE DELLA BANCA DEL GERMOPLASMA DELLA VALLE D AOSTA, CON IL SUPPORTO DELLA

CREAZIONE DELLA BANCA DEL GERMOPLASMA DELLA VALLE D AOSTA, CON IL SUPPORTO DELLA CREAZIONE DELLA BANCA DEL GERMOPLASMA DELLA VALLE D AOSTA, CON IL SUPPORTO DELLA CARATTERIZZAZIONE GENETICA DI SPECIE VEGETALI DI INTERESSE REGIONALE RICERCATORE TEAM LEADER: FABIO GUGLIELMO INTRODUZIONE:

Dettagli