GLOSSARIO Biologia catalizzatore adattamento attivatore catastrofismo alfa elica autosoma cellula bersaglio allantoide autotrofo cellula effettrice

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GLOSSARIO Biologia catalizzatore adattamento attivatore catastrofismo alfa elica autosoma cellula bersaglio allantoide autotrofo cellula effettrice"

Transcript

1 GLOSSARIO Biologia A adattamento [adaptations] Caratteristica ereditaria che aumenta la probabilità di un organismo di sopravvivere e di riprodursi in un determinato ambiente. alfa elica [alpha helix] Forma elicoidale risultante dal ravvolgimento a spirale di un polipeptide nella struttura secondaria di una proteina. allantoide [allantois] Membrana extraembrionale che si sviluppa dal sacco vitellino; aiuta a eliminare i rifiuti azotati dell embrione e forma parte del cordone ombelicale nei mammiferi. allele [alleles] Forma alternativa di un gene. allele dominante [dominant allele] In un individuo eterozigote l allele che si manifesta nel fenotipo. allele recessivo [recessive allele ] In un individuo eterozigote, è l allele che non ha effetti evidenti sul fenotipo. allergene [allergens] Antigene che causa un allergia. amigdala [amygdala] Struttura subcorticale all interno del lobo temporale degli emisferi cerebrali, probabilmente coinvolto nel meccanismo della memoria. amilasi [salivary amylase] Enzima secreto dalla ghiandola salivare che idrolizza l amido. amminoacidi essenziali [essential amino acids] Amminoacidi che non possono essere sintetizzati dagli animali ma devono essere ottenuti dal cibo. amnios [amnion] Annesso embrionale che circonda l embrione come un sacco, delimitando una cavità ripiena di liquido amniotico. anticodone [anticodon] Specifica sequenza di tre nucleotidi di una molecola di trna complementare a una tripletta codone di mrna. anticorpo [antibody] Proteina disciolta nel plasma sanguigno prodotta dai linfociti B che lega un tipo specifico di antigene e funziona come effettore della riposta immunitaria. antigene [antigen] Molecola estranea (non self) che stimola una risposta immunitaria. antistaminico [antihistamine] Farmaco che interferisce con l azione dell istamina, procurando un sollievo temporaneo dai sintomi di una reazione allergica. archei [Archaea] Uno dei due domini dei procarioti; l altro è quello dei batteri. assorbimento [absorption] Assunzione nel corpo di un organismo di piccole molecole nutritive; il terzo stadio della digestione, che segue il processo di demolizione enzimatica. aterosclerosi [artherosclerosis] La forma più comune di arteriosclerosi o indurimento delle arterie. Patologia causata dall accumulo di depositi di grasso nelle pareti delle arterie che le restringe, talvolta fino od occluderle, riducendo il flusso del sangue agli organi vitali del corpo. ATP [ATP; adenosine triphosphate] Adenosina trifosfato; nucleoside trifosfato contenente adenina che rilascia energia in seguito a idrolisi di un legame con un gruppo fosfato. L energia liberata è usata per far avvenire le reazioni endoergoniche della cellula. attivatore [activator] Proteina che attiva un gene o un gruppo di geni legando l intensificatore e promuovendo la trascrizione genica. Appartiene alla famiglia dei fattori di trascrizione. autosoma [autosome] Cromosoma non direttamente coinvolto nella determinazione del sesso di un organismo. autotrofo [autotroph] Organismo che produce da sé il proprio cibo, senza nutrirsi di altri organismi o assumere biomolecole. Gli autotrofi usano l energia del Sole o dell ossidazione delle sostanze inorganiche per ottenere molecole organiche da quelle inorganiche. Piante, alghe e batteri fotosintetici sono autotrofi. B barriera ematoencefalica [blood-brain barrier] Struttura specializzata composta da capillari sanguigni particolari che impediscono il passaggio di molte sostanze dal sangue al cervello, prevenendo le alterazioni dell omeostasi cerebrale. barriera riproduttiva [reproductive barrier] Caratteristica biologica di una specie che impedisce ai suoi membri di incrociarsi con individui di altre specie anche se vivono nello stesso territorio. batteriofago [bacteriophage; phage] Virus che infetta un batterio; abbreviato in fago. bile [bile] Soluzione di sali biliari secreta dal fegato, conservata nella cistifellea; emulsiona i grassi e aiuta la loro digestione. blastocele [blastocoel] Cavità centrale della blastula ripiena di liquido. blastocisti [blastocyst] Embrione dei mammiferi (equivalente alla blastula degli anfibi), costituito da una sfera cava la cui parete è costituita da un solo strato di cellule; si forma dopo la segmentazione e si impianta nell endometrio. blastoporo [blastopore] Piccola apertura su un lato della blastula, attraverso la quale le cellule che formeranno l endoderma e il mesoderma si muovono dalla superficie verso l interno. blastula [blastula] Stadio embrionale che segna la fine della segmentazione durante lo sviluppo animale. biogeografia [biogeography] Disciplina che studia la distribuzione geografica delle specie. C cancerogeno [carcinogen] Agente che provoca il cancro inducendo mutazioni nel DNA. Sono esempi di cancerogeni i raggi X, la luce ultravioletta, il fumo di sigaretta. cariotipo [karyotype] Rappresentazione microfotografica dei cromosomi di una cellula durante la metafase, ordinati per tipo e per dimensioni. carotenoide [carotenoid] Pigmento accessorio, giallo o arancione, presente nei cloroplasti. I carotenoidi assorbono lunghezze d onda che non possono essere assorbilte dalla clorofilla, aumentando così lo spettro di colori che possono essere usati per la fotosintesi. catalizzatore [catalyst] Sostanza che modifica la velocità di una reazione chimica senza essere consumato durante la reazione stessa. catastrofismo [catastrophism] L ipotesi formulata da Georges Cuvier secondo cui l estinzione di tutte le specie che non sono giunte a noi sarebbe dovuta a cataclismi e non alla selezione naturale. cellula bersaglio [target cell] Cellula che risponde a un segnale regolatore, come per esempio un ormone. cellula effettrice [effector cell] (1) Nel sistema immunitario, il linfocita T o B specializzato nella difesa contro un antigene specifico. (2) Cellula muscolare o di una ghiandola che esegue un comando del sistema nervoso. cellula gliale [glial cell] Cellula del sistema nervoso che non conduce stimoli elettrici e che provvede al supporto, isolamento e protezione dei neuroni. cellula poliploide [polyploid cells] Cellula con più di due serie complete di cromosomi. cellula staminale [stem cell] Cellula non differenziata in grado di dare origine a tipi cellulari diversi e specializzati. cellule della memoria [memory cell] Clone di linfociti che si formano durante la risposta immunitaria primaria; il clone rimane in un linfonodo fino a quando non viene attivato dal contatto con lo stesso antigene che ha determinato la sua formazione. Quando le cellule della memoria sono attivate, si moltiplicano rapidamente producendo una grande quantità di cloni di linfociti che mettono in atto la risposta secondaria. celoma [coelom] Cavità corporea posta all interno del mesoderma. centriolo [centriole] Struttura della cellula animale formata da cilindri di triplette di microtubuli organizzati secondo lo schema Una cellula animale, solitamente, possiede un paio di centrioli che sono coinvolti nella divisione cellulare. centro di reazione [reaction center] Nel fotosistema di un cloroplasto, il centro di reazione è formato dalla molecola di clorofilla a e dall accettore primario di elettroni che innescano le reazioni luminose della fotosintesi. La clorofilla cede un elettrone eccitato dall energia luminosa all accettore primario di elettroni, il quale lo passa a una catena di trasporto di elettroni. centromero [centromere] Regione di un cromosoma dove i due cromatidi identici sono uniti e dove si attaccano le fibre del fuso nel corso della mitosi e della meiosi. Il centromero si rompe all inizio dell anafase durante la mitosi e nell anafase II durante la meiosi. centrosoma [centrosome] Regione presente nel citoplasma delle cellule eucariotiche, importante durante la divisione cellulare. Centro di organizzazione dei microtubuli. chemiocettore [chemoreceptor] Recettore che rileva i cambiamenti chimici all interno del corpo oppure un la presenza di molecole specifiche nell ambiente esterno. chemiosmosi [chemiosmosis] Teoria che spiega il meccanismo della fosforilazione ossidativa, accoppiando la sintesi di ATP da ADP e fosfato alla presenza di un gra- 1

2 diente di ioni idrogeno ai due lati della membrana mitocondriale interna. chemioterapia [chemotherapy] Trattamento farmacologico atto a curare una patologia. chiasma [chiasma] Sito visibile al microscopio dove avviene lo scambio di materiale genetico attraverso il crossing-over tra cromatidi di cromosomi omologhi, durante la profase I della meiosi. ciclo litico [lytic cycle] Ciclo di replicazione virale che provoca la lisi della cellula ospite e la conseguente liberazione di nuovi virus. ciclo mestruale [menstrual cycle] Ciclo riproduttivo tipico di alcuni primati, compresa la specie umana, durante il quale sono stimolati prima la proliferazione dell endometrio e poi il suo sfaldamento; è sincronizzato e regolato da ormoni. ciclo ovarico [ovarian cycle] Sequenza di fasi funzionali, controllata da ormoni, che si svolge nella gonade femminile dei mammiferi e che culmina con l ovulazione. citoscheletro [cytoskeleton] Rete di filamenti proteici (microtubuli, microfilamenti, filamenti intermedi) che fornisce un sostegno strutturale a una cellula eucariotica e partecipa ad eventi meccanici e di trasporto. coenzima [coenzyme] Biomolecola (solitamente una vitamina o una sostanza derivata da una vitamina) che agisce come cofattore, aiutando la catalisi enzimatica in una reazione metabolica. coesione [cohesion] Tendenza di molecole dello stesso tipo ad attaccarsi l una all altra, spesso mediata da legami idrogeno. codominanza [codominance] Manifestazione fenotipica di due alleli di un gene in un individuo eterozigote. codone [codon] L unità di base del codice genetico; sequenza di tre nucleotidi di mrna che codifica per un particolare amminoacido o costituisce il segnale di inizio o di fine catena di un polipeptide. cofattore [cofactor] Sostanza di natura non proteica (per esempio un atomo di rame, ferro o zinco, o una molecola organica) necessaria a un enzima per catalizzare una reazione metabolica. I cofattori possono rimanere permanentemente legati al sito attivo oppure interagire debolmente con il substrato durante la catalisi. Vedi anche: coenzima. complesso maggiore di istocompatibilità [major histocompatibility complex] Complesso di geni presente nei mammiferi che codifica per la sintesi di proteine presenti sulla superficie cellulare; tali proteine sono coinvolte nel riconoscimento degli antigeni, nella risposta immunitaria e nel rigetto dei trapianti. Nella specie umana questi geni sono anche noti come HLA. comunità [biological community] Insieme degli organismi che vivono insieme e hanno la possibilità di interagire in una determinata area. congiuntiva [conjunctiva] Sottile membrana mucosa che aiuta a mantenere umido l occhio; ricopre la superficie interna della palpebra e la parte anteriore del globo oculare, eccetto la cornea. coniugazione [conjugation] Nei batteri, trasferimento diretto di DNA tra due cellule temporaneamente unite. consumatore [consumers] In un ecosistema, qualsiasi organismo che si nutre di vegetali o altri animali. Vedi anche: produttore. cromatidi fratelli [sister chromatids] Copie di un cromosoma mantenute insieme a livello del centromero e separate durante la mitosi o la meiosi II. cromatina [chromatin] Complesso di DNA e proteine che costituisce i cromosomi eucariotici. Quando la cellula non è in fase di divisione, la cromatina assume l aspetto di una massa di fibre molto lunghe e sottili, non visibili al microscopio ottico. cromosoma [chromosome] Struttura filiforme presente nel nucleo di tutte le cellule eucariotiche, contenente i geni. Ogni cromosoma è composto da una lunga molecola di DNA associata a proteine. cromosomi omologhi [homologous chromosomes] I due cromosomi corrispondenti che formano una coppia in una cellula diploide. I cromosomi omologhi hanno la stessa lunghezza e il centromero nella stessa posizione; possiedono geni che codificano per gli stessi caratteri in loci corrispondenti, ma possono avere alleli diversi. Uno dei due cromosomi omologhi viene ereditato dal padre e l altro dalla madre. crossing-over [crossing-over] Scambio di segmenti corrispondenti tra i cromatidi di due cromosomi omologhi che si verifica durante la profasi I della meiosi. I siti del crossing-over sono detti chiasmi; il risultato del crossing-over è la formazione di cromosomi ricombinanti. Vedi anche: frequenza di ricombinazione; ricombinazione genetica. D deriva genetica [genetic drift] Cambiamento nel pool genico di una popolazione di piccole dimensioni, dovuto al caso. desmosoma [anchoring junctions; desmosome] Zona di strettissima contiguità e adesione tra cellule che permette lo scambio di sostanze tra una cellula e l altra. determinante antigenico [antigenic determinants] Regione sulla superficie di un antigene alla quale si lega un anticorpo. differenziamento cellulare [cellular differentiation] Specializzazione della struttura e della funzione delle cellule che avviene durante lo sviluppo di un organismo multicellulare e che dipende dal controllo genico. dimorfismo sessuale [sexual dimorphism] Presenza di differenze morfologiche tra gli individui di sesso opposto in una specie. diploide [diploid] (1) Contenente due assetti omologhi di cromosomi per ogni cellula, ciscuno ereditato da un genitore. (2) Riferito a una cellula 2n. E effetto collo di bottiglia [bottleneck effect] Deriva genetica dovuta alla drastica riduzione della popolazione, generalmente in seguito ad una catastrofe naturale, in modo tale che la popolazione sopravvissuta non sia più rappresentativa della popolazione originale. effetto del fondatore [founder effect] Deriva genetica che si verifica nella colonizzazione di un piccolo numero di individui che si staccano dalla popolazione parentale. evo-devo [evo-devo] Disciplina che studia le corrispondenze tra la biologia dell e voluzio ne e quella o. L abbreviazione «devo» indi ca il termine inglese «development» (svi luppo). F fenotipo [phenotype] L insieme delle caratteristiche visibili di un organismo. feto [fetus] Stadio dello sviluppo umano compreso tra la nona settimana di gestazione, quando sono presenti tutte le principali strutture anatomiche, fino alla nascita. fibre muscolari lente [slow muscle fibers] Cellule muscolari che possono mantenere la contrazione per un lungo periodo. fibre muscolari veloci [fast muscle fibers] Cellule muscolari adatte a contrazioni rapide e intense. fibrina [fibrin] Forma attiva del fibrinogeno, una proteina coinvolta nella coagulazione del sangue. La fibrina forma aggregati filamentosi che costituiscono la trama del coagulo. fibrinogeno [fibrinogen] Proteina inattiva del plasma che viene attivata dalla trombina e convertita in fibrina, la quale si aggrega formando filamenti che costituiscono l impalcatura del coagulo. filtrato [filtrate] Fluido estratto dal sangue dal sistema escretore; il rene produce urina dopo aver concentrato il filtrato e aver riassorbito i soluti utili. fitness [fitness] In una popolazione, il contributo di un individuo al pool genico della generazione successiva. flusso genico [gene flow] Acquisto o perdita di alleli in una popolazione a causa dei movimenti di individui o di gameti dentro e fuori dalla popolazione. foglietti embrionali [germ layers] I tre strati cellulari che si formano in embrione durante la gastrulazione: l ectoderma forma lo strato più estreno della gastrula, l endoderma dà origine al canale digerente embrionale e il mesoderma si dispone nello spazio tra l ectoderma e l endoderma. foglietto ripiegato [ pleated sheet] Una delle possibili strutture secondarie delle proteine, in cui la catena polipeptidica si ripiega avanti e indietro. In questo modo due tratti della catena si trovano affiancate parallelamente l una all altra e vengono tenute insieme da legami idrogeno. Detto anche foglietto beta. follicolo [follicle] Gruppo di cellule che circonda, protegge e nutre la cellula uovo durante il suo sviluppo all interno dell ovaia, e che secerne estrogeni. fossile [fossil ] Resto o impronta di un organismo che è vissuto nel passato. fotoautotrofo [photoautotroph] Organismo che, attraverso la fotosintesi, sintetizza biomolecole complesse utilizzando l energia della luce solare e il carbonio contenuto nel diossido di carbonio atmosferico. fotofosforilazione [photophosphorylation] Biologia 2

3 3Biologia Pro duzione di ATP per chemiosmosi durante la fase luminosa della fotosintesi. fotorecettore [photoreceptor] Detto anche fotocettore, è un recettore cellulare eccitabile dalle radiazioni luminose. fotorespirazione [photorespiration] Respirazione supplementare che si verifica nelle piante nelle giornate secche e luminose, quando la pianta chiude gli stomi per risparmiare acqua; mediante la fotorespirazione si forma diossido di carbonio a partire da una molecola a due atomi di carbonio prodotta dal ciclo di Calvin, ma non si producono né molecole di zucchero né di ATP. fotosistema [photosystem] Complesso di proteine e pigmenti in cui avvengono le reazioni della fase luminosa della fotosintesi; è presente in tutti gli organismi fotosintetici ed è costituito da un complesso antenna, da un centro di reazione contenente clorofilla e dall accettore primario di elettroni. Gli eucarioti e i cianobatteri possiedono due fotosistemi, indicati con I e II, in grado di assorbire la luce a lunghezze d onda diverse. frammenti di restrizione [restriction fragments] Molecole di DNA prodotte a partire di una molecola più lunga di DNA tagliata con un enzima di restrizione. frequenza di ricombinazione [recombination frequency] Considerando due geni presenti in loci diversi dello stesso cromosoma, la percentuale di gameti (o cellule figlie) in cui uno dei due geni risulta scambiato da un cromosoma al cromosoma omologo. La progenie ricombinante presenta pertanto una combinazione di alleli diversi da quella dei genitori. La frequenza di ricombinazione fornisce una misura della distanza a cui si trovano i due geni. G gamete [gamete] Cellula sessuale aploide che si forma nelle gonadi; durante la fecondazione, il gamete femminile (cellula uovo) si unisce con il gamete maschile (spermatozoo) per produrre uno zigote diploide. gastrina [gastrin] Ormone digestivo, secreto dallo stomaco, che stimola la secrezione di succo gastrico. gastrula [gastrula] Stadio dello sviluppo embrionale successivo a quello di blastula. Nella maggior parte degli animali la gastrula è costituita da tre strati di cellule, o foglietti: ectoderma, mesoderma ed endoderma. gastrulazione [gastrulation] Fase dello sviluppo embrionale che segue la segmentazione e trasforma la blastula in gastrula. La gastrulazione aumenta il numero di cellule dell embrione e le suddivide in strati distinti. gene [gene] Tratto di DNA (o di RNA, in alcuni virus) caratterizzato da una specifica sequenza che codifica per un informazione ereditabile; negli eucarioti è localizzato nei cromosomi. gene legato al sesso [sex-linked gene] Gene localizzato su un cromosoma sessuale. gene omeotico [homeotic gene] Gene che controlla lo sviluppo embrionale assegnando una precisa identità a specifici gruppi di cellule che daranno origine a uno o più segmenti corporei. gene oncosoppressore [tumor-suppressor gene] Gene il cui prodotto inibisce la divisione delle cellule o ne previene la crescita incontrollata. gene regolatore [regulatory gene] Gene che codifica per una proteina, per esempio un repressore, che controlla la trascrizione di un altro gene o di un gruppo di geni. generazione F 1 [F 1 generation] Progenie della generazione parentale (generazione P); F1 sta per «prima generazione filiale». generazione F 2 [F 2 generation] Progenie della generazione F 1 ; F 2 sta per «seconda generazione filiale». generazione P [P generation] Gli individui che si accoppiano in un incrocio genetico; P sta per «generazione parentale». genetica di popolazione [population genetics] Ramo della genetica che studia i genomi delle popolazioni, la frequenza e la distribuzione dei geni al loro interno e i fattori che alterano le frequenze geniche. genomica [genomics] La disciplina che studia l assetto dei geni e delle loro interazioni. genotipo [genotype] Il complesso dell informazione genetica di un organismo, corrispondente all insieme degli alleli presenti nelle sue cellule che presiedono all espressione dei caratteri somatici (fenotipo). gradiente di concentrazione [concentration gra- dient] Variazione di concentrazione di una sostanza chimica. Le cellule spesso mantengono un gradiente di concentrazione di ioni attraverso le loro membrane. Quando è presente un gradiente di concentrazione, gli ioni o le altre sostanze coinvolte tendono a diffondere dalla zona a concentrazione maggiore a quella a concentrazione minore. I ibrido [hybrid] Individuo prodotto dall incrocio di genitori appartenenti a due specie diverse o a due popolazioni geneticamente distinte. immunità acquisita [acquired immunity] Resistenza conferita dal sistema immunitario in seguito all esposizione ad agenti patogeni. L immunità acquisita è definita anche immunità specifica, a causa della capacità del sistema immunitario di distinguere e di rispondere selettivamente agli agenti patogeni. È basata sull azione degli anticorpi. Vedi anche: immunità innata. immunità attiva [active immunity] Immunità acquisita naturalmente in seguito a un contatto con l antigene dei linfociti B o T, a causa di un infezione o di una vaccinazione. immunità cellulare [cell-mediated immunity] Risposta immunitaria in cui sono coinvolte direttamente cellule del sistema immunitario, e in cui l attività degli anticorpi è di minore rilievo; agisce soprattutto nella difesa contro funghi, protisti, batteri e virus, e contro i tessuti trapiantati. immunità passiva [passive immunity] Immunità temporanea dovuta alla somministrazione di sieri o di immunoglobuline, oppure dovuta ad anticorpi di origine materna acquisiti attraverso la placenta o con il latte (immunità del neonato); dura da qualche settimana a qualche mese, perché il sistema immunitario non è stato stimolato direttamente dagli antigeni. immunità umorale [humoral immunity] Immunità mediata da anticorpi specifici liberati nel sangue o nella linfa. Vedi anche: immunità cellulare. immunoglobulina [immunoglobulin (Ig)] (1) Ciascuna delle cinque classi di glicoproteine che funzionano da anticorpi; sono note 5 classi di immunoglobiline: UgA, IgE, IgG, IgM, IgD. (2) Farmaco contenente anticorpi, utilizzato per l immunizzazione passiva. impronta genetica [DNA fingerprint] Assortimento di alleli che caratterizza ogni individuo, evidenziato nel DNA mediante l uso di sonde nucleotidiche radioattive ed elettroforesi; è utilizzato in medicina legale per identificazioni e assegnazioni di paternità o maternità. incrocio [cross-breeding] Il prodotto della fecondazione tra individui diversi all interno della stessa specie. induttore [inducer]: In un operone, molecola che inattiva in modo specifico un repressore. inserzione [insertion] Mutazione caratterizzata dall inserimento in un gene di una o più coppie di nucleotidi. isolamento comportamentale [behavioral isolation] Barriera prezigotica dovuta all as senza di attrazione fra maschi e femmine di specie diverse. isolamento gametico [gametic isolation] Barriera prezigotica tra due specie dovuta all incapacità di fondersi dando luogo alla fecondazione. isolamento meccanico [mechanical isolation] Barriera prezigotica dovuta all incompatibilità tra gli organi sessuali dei maschi e delle femmine di specie diverse. isolamento temporale [temporal isolation] Barriera prezigotica determinata dalla non contemporaneità del momento dell accoppiamento tra specie diverse. istone [histone] Piccola proteina basica a causa dell elevato contenuto degli amminoacidi lisina e arginina, associata con il DNA (carico negativamente) nel nucleo delle cellule eucariotiche. Gli istoni partecipano all impaccamento del DNA e alla formazione dei nucleosomi, e probabilmente han no un ruolo nella regolazione dell espressione genica. L legamento [ligament] Fascio di tessuto connettivo fibroso che collega le ossa e le cartilagini a formare le articolazioni. letto capillare [capillary bed] Rete ramificata di capillari che si infiltra in ogni organo e tessuto del corpo; in una rete capillare il flusso di sangue è alimentato da piccole arterie (arteriole) e drenato da venule. leucemia [leukemia] Cancro che colpisce il midollo osseo, caratterizzato da un ec cessiva produzione di globuli bianchi. libreria genomica [genomic library] Collezione di cellule trasformate ciascuna delle quali contiene frammenti di DNA provenienti dal genoma di un individuo, da cui è possibile isolare una cellula contenente un singolo gene.

4 locus [locus] La posizione di un gene su un cromosoma. Cromosomi omologhi contengono serie identiche di loci disposti nello stesso ordine. M macroevoluzione [macroevolution] Evoluzione che porta alla comparsa di nuove specie, provviste di nuovi caratteri e di nuove modalità di adattamento all ambiente. Vedi anche: microevoluzione. mappa genica [genetic map] Sequenza del DNA di un gene in cui sono indicati i siti degli elementi regolatori, degli introni, degli esoni e delle mutazioni. marcatore genetico [genetic marker] 1) Sequenza di DNA marcata con una sostanza radioattiva utilizzata durante uno studio ge netico. (2) Gene che conferisce una caratteristica fenotipica (resistenza a un antibiotico, capacità di sintetizzare una moleco la) alle cellule che lo possiedono, e che quindi possono essere distinte da quelle che ne sono prive. meccanocettore [mechanoreceptor] Recettore sensoriale che rileva gli stimoli di tipo meccanico, come tatto e pressione, o lo stiramento e l allungamento dei muscoli. membrana basale [basement membrane] Denso strato extracellulare di proteine e polisaccaridi che si trova tra un epitelio (per esempio l epidermide) e il tessuto connettivo sottostante. membrana basilare [basilar membrane] Nell orecchio, struttura laminare sulla quale poggiano le cellule ciliate all interno dell organo di Corti. membrana di fecondazione [fertilization envelope] Barriera che si forma intorno alla cellula uovo di molti vertebrati pochi secondi dopo la fecondazione, per impedire l ingresso ad altri spermatozoi. meningi [meninges] Nei vertebrati, le membrane costituite di tessuto connettivo che rivestono il sistema nervoso centrale (encefalo e midollo spinale). mesoderma [mesoderm] Il foglietto embrionale intermedio tra esoderma ed ectoderma, che si forma durante la gastrulazione; nei vertebrati, dà origine tra l altro ai muscoli, alle ossa e al derma. mesofillo [mesophyll] Tessuto interno della foglia, costituito da cellule con parete sottile, circondate da spazi in cui è presente aria; è il luogo principale dove avviene la fotosintesi. metabolismo basale [basal metabolic rate] Stato di attività metabolica minima, sufficiente per mantenere le funzioni vitali di base. metabolismo cellulare [cellular metabolism] L insieme delle reazioni endoergoniche ed esoergoniche di una cellula vitale. metastasi [metastasis] La diffusione di cellule tumorali in tessuti o organi distanti dalla zona di origine del tumore primitivo. microchip a DNA [DNA microarray; DNA microchip] Tecnica che consente di individuare e misurare l espressione di migliaia di geni in un unico esperimento. Piccole quantità di un grande numero di frammenti di DNA a singolo filamento, che rappresentano diversi geni, vengono fissate nei quadratini di un griglia su un vetrino. Questi frammenti vengono poi testati mediante ibridazione con campioni di cdna ottenuti da diversi tessuti e organismi. microevoluzione [microevolution] Variazione nel pool genico di una popolazione; le principali cause di microevoluzione sono la deriva genetica (effetto del fondatore, effetto collo di bottiglia), la selezione naturale, il flusso genico e l insorgenza di mutazioni. Vedi anche: macroevoluzione. microscopio elettronico [electron microscope] Strumento in cui la radiazione utilizzata per ricavare l immagine ingrandita del campione è costituita da un fascio di elettroni. Un microscopio elettronico ha un potere risolutivo migliaia di volte superiore a quello del microscopio ottico. Il più potente microscopio elettronico può distinguere oggetti della grandezza di 0,2 nm. microscopio ottico [light microscope] Strumento ottico che permette di ingrandire strutture o organismi invisibili a occhio nudo. Il microscopio ottico utilizza le radiazioni luminose nell ambito del visibile e comprende due serie di lenti che ingrandiscono l oggetto. Ha un potere di risoluzione fino a 0,2 micrometri e proietta le immagini nell occhio dell osservatore o su una pellicola fotografica. N non-disgiunzione [nondisjunction] Durante la meiosi, mancata separazione di due cromosomi omologhi appaiati; di conseguenza, una delle cellule figlie possiede due copie del cromosoma in questione, mentre l altra ne rimane priva. non-vitalità degli ibridi [hybrid inviability] Tipo di barriera postzigotica tra specie diverse dovuta a incompatibilità del loro assetto cromosomico; ciò fa sì che gli zigoti non si sviluppino, oppure che gli ibridi non raggiungano la maturità sessuale. nucleoide [nucleoid] Regione che contiene il DNA all interno di una cellula procariotica. O oligoelemento [oligoelement] Elemento essenziale, in piccole quantità, per la sopravvivenza di un organismo. omeobox [homeobox] Sequenza di 180 coppie di basi presente all estremità 3 in molti geni omeotici, scoperto per la prima volta nella drosofila. La sequenza dell omeobox è pochissimo variata in organismi molto diversi come moscerini, topi e esseri umani. omeostasi [homeostasis] Mantenimento delle funzioni e delle caratteristiche chimico-fisiche di un organismo, nonostante le variazioni dell ambiente esterno. ominidi [hominids] Famiglia che comprende la specie umana e i suoi diretti antenati. omozigote [homozygous] Una cellula o un organismo che presenta due alleli identici per un dato gene. Vedi anche: eterozigote. oncogene [oncogene] Forma alterata di un gene normale, chiamato proto-oncogene, in grado di causare il cancro. oocita primario [primary oocyte] Cellula germinale femminile diploide che si forma prima della nascita e rimane bloccata fino alla pubertà allo stadio di profase I. Su circa oociti primari, solo 200 o 300 maturano e diventano oociti secondari. oocita secondario [secondary oocyte] Cellula germinale femminile aploide derivata per meiosi dell oocita primario. Nei mammiferi è l oocita secondario, chiamato anche cellula uovo, a essere fecondato. oogenesi [oogenesis] Processo di formazione e sviluppo dei gameti femminili che avviene nell ovaia. operatore [operator] Nei procarioti, sequenza di nucleotidi posta tra il promotore e i geni di un operone. L operatore costituisce il sito di legame per una specifica proteina chiamata repressore. Quando il repressore è legato all operatore, l enzima RNA polimerasi non può attaccarsi al promotore e quindi la trascrizione dei geni è bloccata. operone [operon] Nei procarioti, unità funzionale costituita da un gruppo di geni contigui, da un promotore e da un operatore. I geni di un operone sono regolati in modo coordinato e codificano per enzimi implicati nella stessa funzione; per esempio, l operone lac contiene i tre geni che codificano per gli enzimi che digeriscono il lattosio. Il promotore e l operatore sono sequenze di DNA che regolano la trascrizione di questi geni. organismo [organism] Essere vivente risultante dall integrazione morfologica e funzionale di unità più semplici, per esempio organi tessuti e cellule. organismo geneticamente modificato [genetically modified organism] Qualsiasi organismo il cui genoma sia stato modificato mediante tecniche di ingegneria genetica, in modo da modificare geni preesistenti o da introdurne di nuovi. Detto anche OGM. osteoporosi [osteoporosis] Malattia dello scheletro caratterizzata da perdita di tessuto osseo; le ossa, più porose, hanno una maggiore predisposizione a deformarsi e a fratturarsi. P pedomorfosi [paedomorphosis] Persistenza nell adulto delle caratteristiche morfologiche e funzionali giovanili. piante C 3 [C 3 plants] Piante che utilizzano esclusivamente il ciclo di Calvin per fissare il diossido di carbonio nelle reazioni al buio della fotosintesi. piante C 4 [C 4 plants] Piante che presentano adattamenti ai climi caldi e secchi, in cui la fissazione del carbonio avviene tramite un composto intermedio a quattro atomi di carbonio, che trasporta CO 2 dal mesofillo alle cellule della guaina del fascio. Sono esempi di piante C 4 il mais e la canna da zucchero. piante CAM [CAM plants] Piante, come i cactus, adattate a climi molto aridi che svolgono la fotosintesi a stomi chiusi durante il giorno e la fissazione del CO 2 durante la notte, quando gli stomi sono aperti. piastra cellulare [cell plate] Setto che compa- Biologia 4

5 5Biologia re sulla linea mediana di una cellula vegetale in divisione, da cui avrà origine la nuova parete cellulare. pili [pilus] Appendici filamentose proteiche presenti sulla superficie delle cellule batteriche, che aiutano i batteri ad aderire alle superfici. I pili sessuali sono usati durante la coniugazione. plasmide [plasmid] Piccolo anello di DNA presente nel citoplasma di numerosi batteri e di alcuni lieviti. I plasmidi contengono materiale genetico extracromosomico, pos sono essere scambiati durante la coniugazione batterica e sono utilizzati in ingegneria genetica come vettori. plasmodesma [plasmodesma] Sottilissimi filamenti citoplasmatici che attraversano le pareti delle cellule vegetali adiacenti mettendole in comunicazione tra loro. pleiotropia [pleiotropy] Controllo di più caratteristiche fenotipiche da parte di un singolo gene. polimorfismo [polymorphism] Presenza, all interno di una popolazione, di diverse varianti di una caratteristica fenotipica, per esempio i gruppi sanguigni nella specie umana. poliploidia [polyploidy] Condizione genomica caratterizzata dalla presenza di un corredo cronosomico aploide ripetuto più di due volte. Le forme poliploidi sono rare tra gli animali ma molto comuni tra le piante. poliribosoma [polyribosome] Complesso subcellulare costituito dall aggregazione di diversi ribosomi con un filamento di RNA messaggero. pool genico [gene pool] L insieme di tutti gli alleli presenti all interno di una popolazione. popolazione [population] Gruppo di individui della stessa specie che vivono nella stessa area geografica. portatore [carrier] (1) Individuo eterozigote per una malattia ereditaria recessiva, che non mostra i sintomi di tale malattia. (2) Organismo sano che ospita microrganismi patogeni e è in grado di diffonderli nell ambiente. produttore [producer] Organismo autotrofo che produce materia organica a partire da sostanze inorganiche, come acqua e diossido di carbonio. I produttori sono in genere organismi fotosintetici e costituiscono il primo anello della catena alimentare. Vedi anche: consumatore. profago [prophage] Genoma di un batteriofago a DNA integrato in un sito specifico del cromosoma batterico. R radiazione adattativa [adaptive radiation] Processo di formazione di un numero elevato di nuove specie, a partire da un comune antenato, che occupano nuove nicchie ambientali. regno [kingdom] Categoria tassonomica posta al di sotto del dominio e al di sopra del phylum. S selezione artificiale [artifiacial selection] Nell agricoltura e nell allevamento la selezione artificiale consiste nella scelta e nel consolidamento delle ceratteristiche desiderate, attraverso una serie di incroci. selezione clonale [clonal selection] Processo grazie al quale un animale può produrre anticorpi specifici per una varietà illimitata di antigeni. Si basa sulla produzione di cloni di cellule immunitarie geneticamente identiche; l antigene agisce selezionando e stimolando la moltiplicazione del clone che espone sulla membrana plasmatica l anticorpo corrispondente. selezione dipendente dalla frequenza [frequency-dependent selection] Condizione selettiva per cui la fitness di un gene o di un carattere fenotipico dipende dalla loro frequenza nella popolazione. selezione direzionale [directional selection] Processo di selezione naturale che tende a privilegiare individui che presentano uno dei due possibili fenotipi estremi, a sfavore di quelli intermedi. Vedi anche: selezione divergente; selezione stabilizzante. selezione divergente [diversifying selection] Processo di selezione naturale che tende a favorire gli individui posti ai due estremi della gamma fenotipica rispetto ai fenotipi intermedi. Vedi anche: selezione direzionale; selezione stabilizzante. speciazione allopatrica [allopatric speciation] Processo di speciazione che si verifica quando una popolazione rimane isolata a causa della comparsa di una barriera geografica. Vedi anche: speciazione simpatrica. speciazione simpatrica [sympatric speciation] Processo di speciazione dovuta a isolamento di tipo riproduttivo, in assenza di barriere geografiche; è molto comune nelle piante. superiorità dell eterozigote [heterozygote advantage] Espressione che indica che in una popolazione gli individui eterozigoti per determinati alleli presentano un successo riproduttivo maggiore degli omozigoti; in questo caso, la selezione naturale tende a conservare due o più alleli per lo stesso carattere. Un esempio di superiorità dell eterozigote è la resistenza alla malaria conferita dall allele recessivo dell anemia falciforme. T teoria cromosomica dell ereditarietà [chromosome theory of inheritance] Principio basilare della biologia che afferma che i geni sono localizzati sui cromosomi e che il comportamento dei cromosomi durante la meiosi determina l assetto dei caratteri ereditati. teoria degli equilibri intermittenti [punctuated equilibria model ] Teoria proposta da Jay Gould ed Eldredge secondo la quale l evoluzione procederebbe a scatti, intervallati da lunghi periodi di stasi. Vedi anche: teoria gradualistica. teoria gradualistica [gradualist model] Teoria evolutiva secondo la quale le nuove specie evolvono gradualmente dalla popolazione ancestrale; quindi, i grandi eventi (le speciazioni) avvengono attraverso un progressivo accumularsi di molti piccoli cambiamenti. È la visione di Darwin dell origine delle specie. Vedi anche: teoria de gli equilibri intermittenti. terapia genica [gene therapy] Terapia di una malattia dovuta ad un alterazione genica mediante l introduzione di una copia del gene normale nelle cellule somatiche o germinali. testcross [testcross] Test usato per rivelare il genotipo di un individuo, basato sull incrocio tra l organismo in esame e un individuo omozigote recessivo per lo stesso carattere. trasduzione sensoriale [sensory transduction] Trasformazione di uno stimolo in un potenziale d azione da parte di un recettore sensoriale. trasferimento nucleare [nuclear transplantation] Processo con cui viene il nucleo di un uovo o di uno zigote viene sostituito con quello di un altra cellula. U umore acqueo [aqueous humor] Nell occhio dei vertebrati, liquido simile al plasma presente nello spazio tra il cristallino e la cornea. Aiuta a mantenere la forma dell occhio e fornisce nutrienti e ossigeno al cristallino, all iride e alla cornea, drenando anche le sostanze di rifiuto. Vedi anche: umore vitreo. umore vitreo [vitreous humor] Nell occhio dei vertebrati, sostanza gelatinosa che occupa la cavità posta dietro al cristallino; contribuisce a mantenere la forma dell occhio. Vedi anche: umore acqueo. V vaccinazione [vaccination] Procedura utilizzata per indurre nell uomo o negli animali una resistenza nei confronti di una malattia infettiva, mediante la somministrazione di un vaccino. vaccino [vaccine] Materiale immunologico impiegato nella vaccinazione; può essere costituito da una sospensione di microorganismi patogeni uccisi, vivi oppure attenuati, da prodotti microbici (tossine), da subunità batteriche o da antigeni proteici prodotti mediante ingegneria genetica. Il vaccino stimola una risposta immunitaria attiva senza determinare la malattia. vacuolo alimentare [food vacuole] Vescicola rivestita da membrana che si forma in seguito alla fagocitosi. vacuolo contrattile [contractile vacuole] Organulo presente in alcuni protozoi d acqua dolce, utilizzato per eliminare dal citoplasma l acqua in eccesso. ventricolo [ventricle] (1) Cavità caratterizzata da una parete muscolare spessa, che pompa il sangue proveniente dall atrio fuori dal cuore. Nei mammiferi sono presenti due ventricoli: il ventricolo destro che pompa il sangue povero di ossigeno nelle arterie polmonari; il ventricolo sinistro da cui il sangue ossigenato passa nell aorta. Vedi anche: atrio. (2) Nel l en cefalo, i ventricoli sono cavità ripiene di liquido cerebrospinale poste in continuità con il canale epenidimale del midollo spinale.

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1

Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 Il nucleo e la riproduzione cellulare: mitosi e meiosi 1 IL NUCLEO Il nucleo è la porzione di protoplasma racchiusa all interno della membrana nucleare. Il nucleo rappresenta il cervello della cellula,

Dettagli

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra.

La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra. La riproduzione èl unicomezzochehaunorganismoperassicurarela sopravvivenza della sua specie sullaterra. Se l organismo per qualche causa non può più riprodursi o diminuisce la messa al mondo di nuovi esseri

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

svolgimento del programma precedente M F totale

svolgimento del programma precedente M F totale PROGRAMMAZIONE ANNO SCOLASTICO 2009-2010 Docente:Cristina Marcon CLASSE 2A Materia: Biologia 1. Nel primo consiglio di classe sono stati definiti gli obiettivi educativo-cognitivi generali che sono stati

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

APPARATO SESSUALE MASCHILE E FEMMINILE

APPARATO SESSUALE MASCHILE E FEMMINILE APPARATO SESSUALE MASCHILE E FEMMINILE ANATOMIA 2 Il corpo umano è costituito da organi ed apparati uguali tra maschi e femmine ad esclusione dell apparato riproduttivo. L apparato riproduttivo è composto

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione

Riproduzione molecolare. Riproduzione cellulare. Riproduzione degli organismi. Gametogenesi (femminile e maschile) Fecondazione ARGOMENTO STRUTTURA CELLULARE CONCETTO DI REGOLAZIONE GENICA REGOLAZIONE GENICA PROCARIOTI REGOLAZIONE GENICA EUCARIOTI trascrizione e maturazione RNA trasporto nucleo-citoplasma sintesi proteica via secretiva

Dettagli

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo

Dettagli

Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro

Dettagli

1. Capacità di autorinnovamento illimitato

1. Capacità di autorinnovamento illimitato 1. Capacità di autorinnovamento illimitato 2. Capacità di dare origine in risposta a stimoli adeguati e specifici a cellule progenitrici di transito dalle quali discendono popolazioni di cellule altamente

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA.

LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE. Anno scolastico 2012-2013. CLASSE II A Musicale SCIENZE BIOLOGIA. LICEO ARTISTICO P. GOBETTI OMEGNA PIANO DI LAVORO ANNUALE Anno scolastico 2012-2013 CLASSE II A Musicale SCIENZE BIOLOGIA 2 ore settimanali Docente: Prof.ssa Negri Maria Rosa Testo: Le basi della Biologia

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org

Genetica umana. Storia. Storia. Storia. Storia. Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org Genetica umana Ramón Lucas Lucas, LC lucas@unigre.it www.ramonlucas.org P Anni 30: coperta dei difetti congeniti del metabolismo (difetto ereditario nei processi normali del metabolismo) P Anni 30-45:

Dettagli

Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti

Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti Le cellule del corpo non vivono isolate ma si organizzano a formare tessuti I tessuti studio dei tessuti: è compito dell I STOLOGIA (dal greco istos, tela e logos, discorso). I tessuti UN TESSUTO: è formato

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

9. Test ufficiali assegnati alle prove di selezione dei corsi di laurea in Scienze motorie

9. Test ufficiali assegnati alle prove di selezione dei corsi di laurea in Scienze motorie 9. Test ufficiali assegnati alle prove di selezione dei corsi di laurea in Scienze motorie 9.1 PROVA N. 1 Biologia TEST DI VERIFICA S O L U Z I O N I A P A G I N A 2 8 7 9 01 Il colon fa parte di: a intestino

Dettagli

Glossario essenziale a cura di Salvino Leone

Glossario essenziale a cura di Salvino Leone Glossario essenziale a cura di Salvino Leone I molti termini tecnici usati dagli addetti ai lavori in materia di procreazione assistita non sono usuali. Ne proponiamo un elenco che pur non essendo completo

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente.

La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. CHE COS E LA CELLULA? La cellula è l unità fondamentale di tutti gli organismi viventi ed è la più piccola struttura ad essere classificabile come vivente. DA COSA SONO COSTITUITE LE CELLULE? Tutte le

Dettagli

Conoscenza delle tecniche per studiare le cellule in coltura

Conoscenza delle tecniche per studiare le cellule in coltura Corso di Laurea in Biotecnologie Tecnologie per linee cellulari e staminali Docente: Grazyna Ptak Ricevimento: per appuntamento; contatto: e-mail: gptak@unite.it Obiettivo del corso: Conoscenza delle tecniche

Dettagli

Programmazione annuale a.s. 2012/2013

Programmazione annuale a.s. 2012/2013 Programmazione annuale a.s. 2012/2013 Docente: Mendo Daniela Materia: biologia Classe: 4 B sociale Nel singolo consiglio di classe sono stati definiti i seguenti obiettivi educativo-cognitivi generali:

Dettagli

CELLULE EUCARIOTICHE

CELLULE EUCARIOTICHE CELLULE EUCARIOTICHE Le cellule eucariotiche sono di maggiori dimensioni, rispetto a quelle procariotiche (almeno 10 volte più grandi) Oltre a: membrana plasmatica, citoplasma, DNA e ribosomi (comuni a

Dettagli

Meccanismi di trasporto attivo e passivo 1

Meccanismi di trasporto attivo e passivo 1 Meccanismi di trasporto attivo e passivo 1 Il trasporto di sostanze attraverso la membrana cellulare può avvenire con la partecipazione attiva della membrana: in questo caso si parla di trasporto attivo

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Nozioni di base. www.gensuisse.ch. 1. I geni sono situati nel nucleo della cellula. 3. L insieme dei cromosomi forma il genoma.

Nozioni di base. www.gensuisse.ch. 1. I geni sono situati nel nucleo della cellula. 3. L insieme dei cromosomi forma il genoma. Nozioni di base 1. I geni sono situati nel nucleo della cellula 3. L insieme dei cromosomi forma il genoma corpo cellulare cellula muscolare batterio cellula vegetale cellula nervosa nucleo cellulare genoma

Dettagli

unità C11. La riproduzione

unità C11. La riproduzione Gli animali a fecondazione interna si suddividono in base al tipo di sviluppo dell embrione ovipari ovovivipari vivipari lo sviluppo avviene all esterno del corpo della madre lo sviluppo avviene all interno

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Riproduzione e ciclo cellulare

Riproduzione e ciclo cellulare CAPITOLO 7 Riproduzione e ciclo cellulare Gli organismi pluricellulari complessi, come l essere umano, sono formati da miliardi di cellule diverse che svolgono funzioni specifiche: difendono da agenti

Dettagli

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE

TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE TIPI DI CELLULE : PROCARIOTE ED EUCARIOTE Tutti i tipi cellulari presenti sul nostro pianeta appartengono ad uno di due gruppi fondamentali: procarioti ed eucarioti. I termini procariota (dal greco pro

Dettagli

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione

Dettagli

CLASSI SECONDE. Tecnico Grafico a.s. 2014/ 2015

CLASSI SECONDE. Tecnico Grafico a.s. 2014/ 2015 KIT DI RECUPERO Scienze Integrate BIOLOGIA CLASSI SECONDE Tecnico Grafico a.s. 2014/ 2015 1 MATERIALE DIDATTICO SOSPENSIONE DI GIUDIZIO Scienze Integrate BIOLOGIA CLASSI SECONDE Tecnico Grafico a.s. 2014

Dettagli

SCIENZE FACILI PER LA CLASSE QUINTA

SCIENZE FACILI PER LA CLASSE QUINTA Strumenti per la didattica, l educazione, la riabilitazione, il recupero e il sostegno Collana diretta da Dario Ianes Carlo Scataglini SCIENZE FACILI PER LA CLASSE QUINTA Il corpo umano, il Sistema Solare

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

DNA RICOMBINANTE E BIOTECNOLOGIE

DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

L apparato circolatorio. Prof.ssa Paola Sirigu

L apparato circolatorio. Prof.ssa Paola Sirigu L apparato circolatorio COME SIAMO FATTI? Il nostro corpo è composto da milioni e milioni di cellule. Le cellule che svolgono funzioni simili sono organizzate in tessuti. Un insieme di diversi tessuti

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

Cos è una cellula staminale

Cos è una cellula staminale Cos è una cellula staminale Le cellule staminali sono cellule primitive non specializzate dotate della singolare capacità di trasformarsi in qualunque altro tipo di cellula del corpo. Esistono 4 tipi di

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare V Scuola di Ingegneria dell Informazione Laurea Magistrale in Ingegneria Informatica II Scuola di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica e Informazione

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

LICEO SCIENTIFICO LEONARDO da VINCI REGGIO CALABRIA PROGRAMMA DI SCIENZE NATURALI CLASSE 1 a SEZ. Q a. s. 2013/2014

LICEO SCIENTIFICO LEONARDO da VINCI REGGIO CALABRIA PROGRAMMA DI SCIENZE NATURALI CLASSE 1 a SEZ. Q a. s. 2013/2014 CHIMICA LICEO SCIENTIFICO LEONARDO da VINCI REGGIO CALABRIA PROGRAMMA DI SCIENZE NATURALI CLASSE 1 a SEZ. Q a. s. 2013/2014 NUCLEO FONDANTE A : MISURE E GRANDEZZE TRASFORMAZIONI CHIMICO-FISICHE DELLA MATERIA

Dettagli

Giochi del genoma Memory

Giochi del genoma Memory Giochi del genoma Memory Progetto Citizen Science Centro della Scienza At-Bristol genome games memory Introduzione Memory è uno dei giochi del genoma (Genome Games) sviluppati dal Centro della Scienza

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Citoscheletro Microtubuli

Citoscheletro Microtubuli PROPRIETA DEI MICROTUBULI, FILAMENTI INTERMEDI E FILAMENTI DI ACTINA Citoscheletro Microtubuli Biotec _ 2011 Da G. Karp, BIOLOGIA CELLULARE E MOLECOLARE, 3a ed, CORRETTA Microtubuli Microfilamenti Filamenti

Dettagli

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014

SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 SCHEDA DI PROGRAMMAZIONE DISCIPLINARE DA RIPORTARE SUL P.O.F. A.S. 2013-2014 ASSE DISCIPLINA SCIENTIFICO TECNOLOGICO BIOTECNOLOGIE AGRARIE DOCENTE DARMAN ELENA 2 BIENNIO CLASSE 3 CORSO E SEZIONE TECNICA

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene

Il TCR è un eterodimero costituito da due catene polipeptidiche chiamate catena α ecatenaβ legate insieme da un ponte disolfuro. Entrambe le catene I linfociti T sono le cellule dell immunità adattativa responsabili della protezione verso le infezioni ad opera dei microbi intracellulari. Essi derivano da cellule staminali del midollo osseo che si

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

L apparato cardiocircolatorio

L apparato cardiocircolatorio L apparato cardiocircolatorio L apparato cardio-circolatorio E costituito da tre strutture diverse: Il cuore I vasi sanguigni Il sangue Il cuore Funziona come una pompa premente (ventricoli) e aspirante

Dettagli

Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine

Dettagli

Proliferazione e morte cellulare sono eventi fisiologici

Proliferazione e morte cellulare sono eventi fisiologici MORTE CELLULARE Proliferazione e morte cellulare sono eventi fisiologici Omeostasi tissutale (di tessuti dinamici) Sviluppo embrionale Eliminazione di strutture corporee inutili - Fasi di scultura/rimodellamento

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Il cromosoma è l unità di. replicazione autonoma. Formato da DNA e proteine (cromatina)

Il cromosoma è l unità di. replicazione autonoma. Formato da DNA e proteine (cromatina) I CROMOSOMI 1 I CROMOSOMI Il cromosoma è l unità di materiale ereditario capace di replicazione autonoma Formato da DNA e proteine (cromatina) 2 I CROMOSOMI I CROMOSOMI Gli organismi eucarioti possiedono

Dettagli

allele angiogenesi antisenso apoptosi carcinoma in situ cellula germinale cellula somatica cellule staminali cellule staminali embrionali chimera

allele angiogenesi antisenso apoptosi carcinoma in situ cellula germinale cellula somatica cellule staminali cellule staminali embrionali chimera Glossario allele: una delle possibili forme alternative di un gene che può essere presente nella specifica posizione cromosomica occupata da quel gene angiogenesi: processo di formazione dei vasi sanguigni;

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

cenni di anatomia del testicolo

cenni di anatomia del testicolo cenni di anatomia del testicolo Il gamete maschile è rappresentato della spermatozoo la produzione e maturazione del gamete maschile avviene nel testicolo Il testicolo fa parte dell apparato riproduttivo

Dettagli

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI Ogni individuo possiede un proprio patrimonio genetico che lo rende unico e diverso da tutti gli altri. Il patrimonio genetico è costituito da

Dettagli

Verifica livello 3. Tutto il quaderno di lavoro. Riferimento. Gli studenti risolvono gli esercizi. Compito. Foglio di esercizio Soluzione.

Verifica livello 3. Tutto il quaderno di lavoro. Riferimento. Gli studenti risolvono gli esercizi. Compito. Foglio di esercizio Soluzione. Livello 3 07 / Il sangue Informazione per gli insegnanti 1/7 Riferimento Tutto il quaderno di lavoro Compito Gli studenti risolvono gli esercizi. Materiale Foglio di esercizio Forma sociale Lavoro individuale

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

Il sistema immunitario

Il sistema immunitario 1 Il sistema immunitario COMPONENTI MOLECOLARI E CELLULARI. Meccanismi e caratteristiche delle risposte immunitarie; Risposte umorali e cellulari; Teoria della selezione clonale; Versatilità, specificità

Dettagli

L APPARATO CIRCOLATORIO

L APPARATO CIRCOLATORIO L APPARATO CIRCOLATORIO Tutte le cellule del nostro corpo hanno bisogno di sostanze nutritive e di ossigeno per svolgere le loro funzioni vitali. Così, esiste il sangue, un tessuto fluido che porta in

Dettagli

Funzioni delle proteine del sangue:

Funzioni delle proteine del sangue: PROTEINE DEL SANGUE Funzioni delle proteine del sangue: 1. Funzioni nutrizionali 2. Regolazione dell equilibrio acido base 3. Ripartizione dell acqua nei vari distretti 4. Funzione di trasporto 5. Coagulazione

Dettagli

Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015

Progetto scuola-lavoro Consiglio Nazionale delle Ricerche. Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 Progetto scuola-lavoro Consiglio Nazionale delle Ricerche Chiara Cuccodoro L.s.s. Francesco d Assisi Classe VE A.s. 2014/2015 1 Vaccini a Dna Sono costituiti da un plasmide, cioè un anello di dna, di origine

Dettagli

RIPRODUZIONE E SVILUPPO EMBRIONALE

RIPRODUZIONE E SVILUPPO EMBRIONALE RIPRODUZIONE E SVILUPPO EMBRIONALE Il ponte di collegamento tra i genitori ed i figli, loro diretti discendenti, è molto stretto e consiste in una cellula uovo fecondata (lo zigote) che porta i materiali

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico

PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico PROGRAMMA di BIOLOGIA/MICROBIOLOGIA per la classe IIIB Tecnologico Prof. Bozzato Andrea Prof.ssa Rosa Monica (Laboratorio) Il libro di testo è: Terra Ed. Verde, autori E.L.Palmieri, M.Parotto casa editrice

Dettagli

Apparato Riproduttore

Apparato Riproduttore Apparato Riproduttore LA RIPRODUZIONE. Ogni essere vivente può creare un altro essere vivente, ed è possibile grazie alla RIPRODUZIONE. La riproduzione è possibile grazie all APPARATO RIPRODUTTORE. A differenza

Dettagli

ISTITUTO TECNICO ECONOMICO MOSSOTTI

ISTITUTO TECNICO ECONOMICO MOSSOTTI SECONDE AFM - TUR UdA n. 1 Titolo: biosfera/evoluzione dei viventi/tassonomia Acquisire e decodificare concetto di complessità e di interdipendenza all'interno di un sistema biologico Generalità sulla

Dettagli

Strumenti e Tecniche di studio in patologia

Strumenti e Tecniche di studio in patologia Strumenti e Tecniche di studio in patologia Gli strumenti della patologia: Microscopia Biologia molecolare Indagini biochimiche Microscopia Ottica citopatologia ed istopatologia citochimica ed istochimica

Dettagli

INDIRIZZO AMMINISTRAZIONE, FINANZA e MARKETING e INDIRIZZO TURISMO - BIENNIO CLASSE PRIMA SCIENZE INTEGRATE scienze della terra

INDIRIZZO AMMINISTRAZIONE, FINANZA e MARKETING e INDIRIZZO TURISMO - BIENNIO CLASSE PRIMA SCIENZE INTEGRATE scienze della terra INDIRIZZO AMMINISTRAZIONE, FINANZA e MARKETING e INDIRIZZO TURISMO - BIENNIO CLASSE PRIMA SCIENZE INTEGRATE scienze della terra COMPETENZE DI BASE area scientifico tecnologica (Allegato A2 del DPR 15.03.2010)

Dettagli

ELETTRONICA ED ELETTROTECNICA

ELETTRONICA ED ELETTROTECNICA Istituto di Istruzione Secondaria Superiore Statale «Via Silvestri 301» Programma di BIOLOGIA Classe 2 a A Indirizzo ELETTRONICA ED ELETTROTECNICA n.1 Titolo La cellula La struttura della cellula La teoria

Dettagli

Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente

Dettagli