Diss: ETH. 26- Okt Cat_. presented by. Dipl. ETH Natw. Accepted on the recommendation of. Diss. ETH No 9131

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Diss: ETH. 26- Okt. 1990. Cat_. presented by. Dipl. ETH Natw. Accepted on the recommendation of. Diss. ETH No 9131"

Transcript

1 Diss: ETH 26- Okt Diss. ETH No 9131 CHROMATIN STRUCTURE DURING TRANSCRIPTION IN THE YEAST SACCHAROMYCES CEREVISIAE A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZÜRICH for the degree of Doctor of Natural Sciences presented by Stefano Omari Dipl. ETH Natw. born 24. August 1962 Citizen of Locarno (Ticino) Accepted on the recommendation of P.D. Dr. Fritz Thoma, examiner Prof. Dr. Timothy Richmond, co-examiner Cat_ Prof. Dr. Theodor Koller, co-examiner 1990

2 RIASSUNTO Questa tesi di dottorato si occupa di due temi, concementi la relazione esistente tra struttura e funzione della cromatina nei geni attivi. Entrambi, hanno come oggetto di studio, la cellula di lievito Saccharomyces cerevisiae; un organismo eucariota che per la sua semplicitä si presta in maniera ideale per gli studi a livello biologico-molecolare. II materiale genetico di tutte le cellule eucariotiche e condensato dagli istoni, proteine che con il DNA formano i nucleosomi. La RNA polimerasi deve poter leggere il DNA; e concepibile che i nucleosomi possano restare associati con il DNA, che vengano destabilizzati o che vengano distrutti dal passaggio della polimerasi. Abbiamo analizzato questa problematica, partendo da differenti ipotesi di lavoro che abbiamo poi verificato nella cellula di lievito Saccharomyces cerevisiae. La prima presa in considerazione, e che la stabilitä dei nucleosomi durante la trascrizione dipenda dalla frequenza con la quäle il DNA viene trascritto. II gene di lievito URA3, possiede dei nucleosomi che risultano posizionati in maniera molto chiara (Thoma, 1986). Questo gene e scarsamente trascritto; per tale ragione, abbiamo sostituito il suo promotore con quello dei geni GAL1-10, con lo scopo di analizzare la stabilitä dei nuclesosomi durante la trascrizione sul gene URA3. II promotore divergente GAL1-10 e indotto qualora il medium contenga galattosio e represso se contiene glucosio quäle fönte di carbonio. Non abbiamo potuto constatare alcuna differenza tra lo stato represso dei gene artificiale e quello indotto, un risultato che suggerisce che la RNA polimerasi puö trascrivere il DNA nonostante la presenza di nucleosomi in vivo senza comprometterne la stabilitä. Un altro possibile fattore che potrebbe influenzare il destino dei nucleosomi durante la trascrizione e la sequenza dei DNA di un gene. Questa seconda ipotesi e stata vagliata con la costruzione di un altro gene artificiale, GAL-RIBURA, contenente un frammento di DNA dei gene ribosomale di Dictyostelium discoideum. Tale gene e stato analizzato in un Plasmide extracromosomale ed integrato nel genoma di lievito. La stabilitä dei nucleosomi sulla sequenza URA3 durante la

3 5 trascrizione e risultata immutata, mentre i nucleosomi associati con la sequenza di gene ribosomale, sono stati dissociati o destabilizzati dal passaggio della RNA polimerasi. Concludiamo perciö che le due differenti sequenze, posseggono differenti affinitä per gli istoni. Questi risultati dovrebbero essere complementati con altri esperimenti miranti a chiarificare se esista una correlazione tra attivitä di trascrizione ed affinitä di una data sequenza per gli istoni. NeH'ambito dei secondo tema svolto in questa tesi, ci siamo occupati della stabilitä dei nucleosomi esistenti nella regione dei promotore In lievito. E stato suggerito che tratti comprendenti poly(da).poly(dt) in S.cerevisiae agiscano come elementi di promotori costitutivi, esciudendo la formazione di nucleosomi (Struhl, 1985a). Abbiamo analizzato la struttura a livello di cromatina in tale regione nel locus pet56-his3-ded1 e visto che essa e priva di nucleosomi. In esperimenti effettuati in vitro, abbiamo dimostrato che frammenti di DNA contenenti il tratto poly(da).poly(dt), possono formare nucleosomi con efficienza simile ad altri che non lo comprendono. Quindi la peculiare sequenza da sola, non basta ad esciudere i nucleosomi, ma altri fattori contribuiscono a definire la regione priva di nucleosomi.

4 SUMMARY This thesis is divided into two main topics of research: both focus on the relationship between the structure and the function of chromatin in active genes. Both projects used as model organism the baker's yeast Saccharomyces cerevisiae, a lower eucaryote that is an ideal system for chromatin studies. The DNA of all eukaryotic cells is densely packaged by histone proteins in a linear array of nucleosomes. Since the histones might interfere with the RNA-polymerases, nucleosomes might be stable, unstable or they might dissociate during transcription. We tested different working hypotheses by constructing gene fusions in the yeast Saccharomyces cerevisiae. It is conceivable that the stability of nucleosomes might depend on the rate of transcription. The URA3 gene has clearly positioned nucleosomes (Thoma, 1986) but is poorly transcribed by its own promoter. We substituted the URA3 promoter by the strong GAL1-10 promoter to test whether the transcription rate might influence the stability of the nucleosomes on the URA3 coding region. The GAL promoter is induced in media containing galactose as carbon source and repressed in glucose media. We did not observe any detectable difference in the stability of nucleosomes in the GAL-URA fusion between the repressed State and the transcriptionally active State, which suggests that the RNApolymerase II can transcribe through nucleosomes in vivo without displacing them. Alternatively, the stability of nucleosomes might depend on the DNA sequence. This hypothesis was tested in another fusion gene, GAL-RIBURA, containing a fragment of the ribosomal-rna-gene of Dictyostelium discoideum. The stability of the nucleosomes in the fusion gene was analyzed in a extrachromosomal plasmid and intrachromosomaily. The results indicated that the nucleosomes on the URA3 part remain stable while nucleosomes on the ribosomal part are displaced or destabilized by the passage of the RNA-polymerases. My preliminary conclusion is that the two DNA sequences have different affinities for the histone octamers.

5 In a second project, I tested the stabilty of nucleosomes assembled on the promoter region of yeast. It was suggested that poly(da)poly(dt) tracts in the yeast Saccharomyces cerevisiae act as elements of constitutive Promoters by exclusion of nucleosomes (Struhl, 1985). I have mapped the chromatin structure of the pet56-his3-ded1 region in minichromosomes and shown that the poly(da)poly(dt) tracts are located in nuclease sensitive regions. In vitro reconstitution and competition experiments demonstrated that the naturally occurring poly(da)poly(dt) tract of the DED1 promoter was able to form nucleosomes with the same efficiency as DNA-fragments missing the poly(da)-poly(dt) tract. The poly(da)-poly(dt) tract per se does not exclude nucleosomes. The competition experiments developed in this work can be used to estimate the affinity of the histone octamer of various sequences.

Mechanisms of neuronal apoptosis and axon growth. presented by. Dipl. accepted on the recommendation of. Valeria Gagliardini. Bioc.hemi.

Mechanisms of neuronal apoptosis and axon growth. presented by. Dipl. accepted on the recommendation of. Valeria Gagliardini. Bioc.hemi. Diss. ETH N 13375 Mechanisms of neuronal apoptosis and axon growth A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZÜRICH for the degree of Doctor of Natural Science presented by

Dettagli

Repair of UV-Damaged DNA by Photolyase in Silent Chromatin of Yeast

Repair of UV-Damaged DNA by Photolyase in Silent Chromatin of Yeast Diss. ETH No. 15227 Repair of UV-Damaged DNA by Photolyase in Silent Chromatin of Yeast A dissertation submitted to the Swlss Federallnstltute of Technology (ETH) Zürich For the degree of Doctor of Sclences

Dettagli

Transcriptional regulation during fruiting body formation in

Transcriptional regulation during fruiting body formation in DISS. ETHNO. 15480 Transcriptional regulation during fruiting body formation in the basidiomycetecoprinopsiscinerea: promoter analysis of the cg!2 gene encoding a fruiting body-specificgalectin A dissertationsubmittedto

Dettagli

COMPOSTING FACILITIES AND BIOAEROSOLS AS SOURCES OF LEGIONELLA AND AMOEBAE

COMPOSTING FACILITIES AND BIOAEROSOLS AS SOURCES OF LEGIONELLA AND AMOEBAE DISS. ETH NO. 21679 COMPOSTING FACILITIES AND BIOAEROSOLS AS SOURCES OF LEGIONELLA AND AMOEBAE A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. sc. ETH Zurich) presented

Dettagli

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants

Epithelial-Mesenchymal Transition in Cancer. Relevance of Periostin Splice Variants DISS. ETH NO. 19590 Epithelial-Mesenchymal Transition in Cancer Relevance of Periostin Splice Variants A dissertation submitted to the ETH Zurich For the degree of Doctor of Sciences Presented by Laura

Dettagli

ANTIVIRALCD8 T CELL RESPONSE: ROLE OF PERSISTENTANTIGEN AND OFT HELP. for the degree of Doctor of Natural Sciences. Presentedby PAOLAAGNELLINI

ANTIVIRALCD8 T CELL RESPONSE: ROLE OF PERSISTENTANTIGEN AND OFT HELP. for the degree of Doctor of Natural Sciences. Presentedby PAOLAAGNELLINI DISS. ETH NO. 17413 ANTIVIRALCD8 T CELL RESPONSE: ROLE OF PERSISTENTANTIGEN AND OFT HELP A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGYZÜRICH for the degree of Doctor of Natural

Dettagli

VLSI Circuits for Cryptographic Authentication

VLSI Circuits for Cryptographic Authentication Diss. ETH No. 19351 VLSI Circuits for Cryptographic Authentication A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented by LUCA HENZEN Dipl. El.-Ing. ETH (MSc ETH) born

Dettagli

/. ^y^cr-^a. Bandwidth and Energy Efficiency. Continuous-Phase Modulation. and Coding for. 2?.g. g& presented by Bixio E. Rimoldi. dipl. El. Ing.

/. ^y^cr-^a. Bandwidth and Energy Efficiency. Continuous-Phase Modulation. and Coding for. 2?.g. g& presented by Bixio E. Rimoldi. dipl. El. Ing. Diss. ETH No.8629 /. ^y^cr-^a 2?.g. g& Continuous-Phase Modulation and Coding for Bandwidth and Energy Efficiency A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZÜRICH for the degree

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in

Dettagli

EIII. Energy cost analysis in filament melt spinning. Swiss Federal Institute of Technology Zurich. Doctor of Technical Seiences

EIII. Energy cost analysis in filament melt spinning. Swiss Federal Institute of Technology Zurich. Doctor of Technical Seiences EIII Eidgenössische Technische Hochschule Zürich Ecole polytechnique teoerele de Zurich Politecnico federale di Zurigo Swiss Federallnstitute of Technology Zurich Diss. ETH No. 12 659 Energy cost analysis

Dettagli

Emissions-Controlled Diesel Engine

Emissions-Controlled Diesel Engine Diss. ETH No. 18214 Emissions-Controlled Diesel Engine A dissertation submitted to the Swiss Federal Institute of Technology Zurich for the degree of Doctor of Sciences presented by Ezio Alfieri Dipl.

Dettagli

A Neuromorphic VLSI System for Modeling Spike Based Cooperative Competitive Neural Networks

A Neuromorphic VLSI System for Modeling Spike Based Cooperative Competitive Neural Networks Diss. ETH No. 16578 A Neuromorphic VLSI System for Modeling Spike Based Cooperative Competitive Neural Networks A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY (ETH ZURICH) for the

Dettagli

Lezione XXVII-XXVIll giovedì 1-XII-2011

Lezione XXVII-XXVIll giovedì 1-XII-2011 Lezione XXVII-XXVIll giovedì 1-XII-2011 corso di genomica Laurea Magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 libro consigliato Zanichelli Introduz.

Dettagli

A dissertation submitted to ETH ZURICH. for the degree of Doctor of Sciences. presented by DAVIDE MERCURIO

A dissertation submitted to ETH ZURICH. for the degree of Doctor of Sciences. presented by DAVIDE MERCURIO DISS. ETH NO. 19321 DISCRETE DYNAMIC EVENT TREE MODELING AND ANALYSIS OF NUCLEAR POWER PLANT CREWS FOR SAFETY ASSESSMENT A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented

Dettagli

HIV-Derived Lentiviral Vectors Engineered for Regulated Transgene Expression

HIV-Derived Lentiviral Vectors Engineered for Regulated Transgene Expression Doctoral Thesis ETH No. 16186 HIV-Derived Lentiviral Vectors Engineered for Regulated Transgene Expression A dissertation submitted to the Swiss Federal Institute of Technology Zurich for the degree of

Dettagli

Progettazione e analisi strutturale di un generatore solare d'alta potenza per veicoli spaziali UNIVERSITÀ DI PISA. Facoltà di Ingegneria

Progettazione e analisi strutturale di un generatore solare d'alta potenza per veicoli spaziali UNIVERSITÀ DI PISA. Facoltà di Ingegneria UNIVERSITÀ DI PISA Facoltà di Ingegneria Corso di Laurea Specialistica in Ingegneria Aerospaziale Tesi di laurea Specialistica Progettazione e analisi strutturale di un generatore solare d'alta potenza

Dettagli

We take care of your buildings

We take care of your buildings We take care of your buildings Che cos è il Building Management Il Building Management è una disciplina di derivazione anglosassone, che individua un edificio come un entità che necessita di un insieme

Dettagli

Modeling and Tracking Social Walkers

Modeling and Tracking Social Walkers Diss. ETH No. 20340 Modeling and Tracking Social Walkers A dissertation submitted to the ETH ZURICH for the degree of Doctor of Science ETH presented by Stefano Pellegrini M.Eng. Sapienza University of

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting

Dettagli

Lean Premixed Syngas Combustion for Gas Turbines Applications

Lean Premixed Syngas Combustion for Gas Turbines Applications Diss. ETH No. 19657 Lean Premixed Syngas Combustion for Gas Turbines Applications A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented by SALVATORE DANIELE Dott. Ing. Aerospace,

Dettagli

MAP-BASED CLONING OF THE Rvi15 (Vr2) APPLE SCAB RESISTANCE GENE

MAP-BASED CLONING OF THE Rvi15 (Vr2) APPLE SCAB RESISTANCE GENE DISS. ETH Nr.: 18568 MAP-BASED CLONING OF THE Rvi15 (Vr2) APPLE SCAB RESISTANCE GENE A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZUERICH For the degree of Doctor of science ETH

Dettagli

COMPARATIVE ANALYSIS OF mrna TARGETS FOR HUMAN PUF-FAMILY RNA-BINDING PROTEINS

COMPARATIVE ANALYSIS OF mrna TARGETS FOR HUMAN PUF-FAMILY RNA-BINDING PROTEINS DISS. ETH NO. 18803 COMPARATIVE ANALYSIS OF mrna TARGETS FOR HUMAN PUF-FAMILY RNA-BINDING PROTEINS A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented by ALESSIA GALGANO

Dettagli

The role of Rip2 kinase and bacterial infections in shaping innate and adaptive immune responses

The role of Rip2 kinase and bacterial infections in shaping innate and adaptive immune responses DISS ETH NO. 18170 The role of Rip2 kinase and bacterial infections in shaping innate and adaptive immune responses A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY, ZURICH for the

Dettagli

B R O C H U R E D E I C O R S I

B R O C H U R E D E I C O R S I Scuola di Dottorato in Scienze della Vita e della Salute B R O C H U R E D E I C O R S I Dottorato in Sistemi Complessi per le Scienze della Vita Printed by Campusnet - 24/01/2016 06:15 Indice Indice Giornate

Dettagli

Implementazione e gestione del transitorio nell introduzione di un sistema ERP: il caso Power-One - Oracle

Implementazione e gestione del transitorio nell introduzione di un sistema ERP: il caso Power-One - Oracle FACOLTÀ DI INGEGNERIA RELAZIONE PER IL CONSEGUIMENTO DELLA LAUREA SPECIALISTICA IN INGEGNERIA GESTIONALE Implementazione e gestione del transitorio nell introduzione di un sistema ERP: il caso Power-One

Dettagli

Photonics for THz Quantum Cascade Lasers

Photonics for THz Quantum Cascade Lasers Diss. ETH No. 19024 Photonics for THz Quantum Cascade Lasers A dissertation submitted to ETH Z ÜRICH for the degree of Doctor of Sciences presented by MARIA I. AMANTI Dipl. Phys., Universitita degli studi

Dettagli

Introduzione Kerberos. Orazio Battaglia

Introduzione Kerberos. Orazio Battaglia Orazio Battaglia Il protocollo Kerberos è stato sviluppato dal MIT (Massachusetts Institute of Tecnology) Iniziato a sviluppare negli anni 80 è stato rilasciato come Open Source nel 1987 ed è diventato

Dettagli

Regulation of Neural Crest Stem Cell Development. Stine Büchmann-Møller

Regulation of Neural Crest Stem Cell Development. Stine Büchmann-Møller Diss ETH No. 18562 Regulation of Neural Crest Stem Cell Development A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH for the degree of Doctor of Sciences presented by Stine

Dettagli

Dichotomy Works nasce nel 2015 a Milano come collaborazione creativa tra l architetto Adolfo Martinez e l artista grafica Ivana Serizier Moleiro.

Dichotomy Works nasce nel 2015 a Milano come collaborazione creativa tra l architetto Adolfo Martinez e l artista grafica Ivana Serizier Moleiro. -1- SCHEDA DI PRESENTAZIONE Nome e cognome / Nome del gruppo Adolfo Martinez, Ivana Serizier Moleiro / Dichotomy Works Città Milano Provincia MI Biografia Dichotomy Works nasce nel 2015 a Milano come collaborazione

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi

Dettagli

THINKING DIGITAL SYNCHRONIZING WITH THE FUTURE PENSIERO DIGITALE: SINCRONIZZARSI COL FUTURO

THINKING DIGITAL SYNCHRONIZING WITH THE FUTURE PENSIERO DIGITALE: SINCRONIZZARSI COL FUTURO THINKING DIGITAL SYNCHRONIZING WITH THE FUTURE PENSIERO DIGITALE: SINCRONIZZARSI COL FUTURO A STEP FORWARD IN THE EVOLUTION Projecta Engineering developed in Sassuolo, in constant contact with the most

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

Il differenziamento cellulare

Il differenziamento cellulare Liceo Classico M. Pagano Campobasso Docente: prof.ssa Patrizia PARADISO Allieve (cl. II sez. B e C): BARONE Silvia Antonella DI FABIO Angelica DI MARZO Isabella IANIRO Laura LAUDATI Federica PETRILLO Rosanna

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Optimal Modelingand Drug

Optimal Modelingand Drug Doctoral Thesis ETH No. 16498 Optimal Modelingand Drug Administrationfor Anesthesia in Clinical Practice A dissertation submittedto the Swiss Federal Instituteof Technology for the degree of Doctor of

Dettagli

up date basic medium plus UPDATE

up date basic medium plus UPDATE up date basic medium plus UPDATE Se si potesse racchiudere il senso del XXI secolo in una parola, questa sarebbe AGGIORNAMENTO, continuo, costante, veloce. Con UpDate abbiamo connesso questa parola all

Dettagli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli fss@unife.it Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli fss@unife.it Fonti e testi di riferimento Dan Graur: http://nsmn1.uh.edu/dgraur/ >courses > bioinformatics

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Diss; ETH )(3. Cloning of DRAL, a novel LIM domain protein down-regulated in. embryonal rhabdomyosarcoma cells. Dipl.

Diss; ETH )(3. Cloning of DRAL, a novel LIM domain protein down-regulated in. embryonal rhabdomyosarcoma cells. Dipl. Diss; ETH )(3 Diss. ETH No. 11307 Isolation and characterization of candidate tumor suppressor genes. Cloning of DRAL, a novel LIM domain protein down-regulated in embryonal rhabdomyosarcoma cells a dissertation

Dettagli

INTERIOR DESIGN INTERNI

INTERIOR DESIGN INTERNI INTERNI CREDITO COOPERATIVO BANK BANCA DI CREDITO COOPERATIVO Date: Completed on 2005 Site: San Giovanni Valdarno, Italy Client: Credito Cooperativo Bank Cost: 3 525 000 Architectural, Structural and

Dettagli

DNA-Encoded Chemical Libraries

DNA-Encoded Chemical Libraries DISS. ETH NO. 18153 DNA-Encoded Chemical Libraries A dissertation submitted to the ETH Zurich For the degree of Doctor of Sciences Presented by Luca Mannocci Dott. Chim. Università degli Studi di Pisa

Dettagli

Stato risorse di calcolo CDF in Italia

Stato risorse di calcolo CDF in Italia Stato risorse di calcolo CDF in Italia - August 31, 2011 S. Amerio (INFN Padova) Stato risorse a Fermilab Portale CDFGRID per accedere alle risorse di calcolo locali a Fermilab. Job in corso 5k CDFGRID

Dettagli

Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

Capitolo 7: Domanda con il reddito in forma di moneta

Capitolo 7: Domanda con il reddito in forma di moneta Capitolo 7: Domanda con il reddito in forma di moneta 7.1: Introduzione L unica differenza tra questo capitolo e il precedente consiste nella definizione del reddito individuale. Assumiamo, infatti, che

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

Easter 2008 Gallery Benucci Rome. October 2008 Taormina Chiesa del Carmine, group picture and Gallery Benucci. December 2008 Benucci Gallery, Rome.

Easter 2008 Gallery Benucci Rome. October 2008 Taormina Chiesa del Carmine, group picture and Gallery Benucci. December 2008 Benucci Gallery, Rome. Nino Ucchino nasce in Sicilia nel 1952. Dall età di otto anni lavora come allievo nello studio del pittore Silvio Timpanaro. Da 14 a 21 anni studia all Istituto Statale d arte di Messina e poi per alcuni

Dettagli

true Design minimale per un impatto massimale. [eos] Minimal design for maximum impact. design made in italy

true Design minimale per un impatto massimale. [eos] Minimal design for maximum impact. design made in italy Design minimale per un impatto massimale. Minimal design for maximum impact. true design made in italy true design made in italy design made in italy Sistema di divani imbottiti e poltrona da attesa basato

Dettagli

Megaphonemini. Portable passive amplifier. design by. Made in Italy

Megaphonemini. Portable passive amplifier. design by. Made in Italy Portable passive amplifier design by Made in Italy Amplificatore passivo portatile in ceramica per iphone. La forma è studiata per amplificare ed ottimizzare al meglio l uscita del suono. Dopo il successo

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l

Dettagli

SCENE UNDERSTANDING FOR MOBILE ROBOTS

SCENE UNDERSTANDING FOR MOBILE ROBOTS DISS. ETH. NO 18767 SCENE UNDERSTANDING FOR MOBILE ROBOTS A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented by LUCIANO SPINELLO MSc Automation Engineering, Università

Dettagli

English-Medium Instruction: un indagine

English-Medium Instruction: un indagine English-Medium Instruction: un indagine Marta Guarda Dipartimento di Studi Linguistici e Letterari (DiSLL) Un indagine su EMI presso Unipd Indagine spedita a tutti i docenti dell università nella fase

Dettagli

Development of new therapeutic tools and genetic in vivo models to study the function of podoplanin in the lymphatic vascular system

Development of new therapeutic tools and genetic in vivo models to study the function of podoplanin in the lymphatic vascular system DISS. ETH NO. 22214 Development of new therapeutic tools and genetic in vivo models to study the function of podoplanin in the lymphatic vascular system A thesis submitted to attain the degree of DOCTOR

Dettagli

DISS. ETH NO. 22010 PHYSICAL AND CHEMICAL GELS. A thesis submitted to attain the degree of. DOCTOR OF SCIENCES of ETH ZURICH. (Dr. Sc.

DISS. ETH NO. 22010 PHYSICAL AND CHEMICAL GELS. A thesis submitted to attain the degree of. DOCTOR OF SCIENCES of ETH ZURICH. (Dr. Sc. DISS. ETH NO. 22010 PHYSICAL AND CHEMICAL GELS A thesis submitted to attain the degree of DOCTOR OF SCIENCES of ETH ZURICH (Dr. Sc. ETH Zurich) Presented by Stefano Lazzari M.Sc. in Chemical Engineering,

Dettagli

SLIM LINE ACU Slim solutions

SLIM LINE ACU Slim solutions SLIM LINE ACU Slim solutions I condizionatori della serie KSL Slim line sono studiati per installazione verticale interna o esterna al quadro.questa nuova linea di prodotto è il risultato tecnico più evoluto

Dettagli

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia

Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Biodiversità delle popolazioni microbiche: tra adattamento e biotecnologia Lorenzo Morelli Istituto di Microbiologia Facoltà di Agraria UCSC Piacenza In questa presentazione Peculiarità del genoma dei

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Quantitative cell mechanics: new insights from a novel functional imaging platform

Quantitative cell mechanics: new insights from a novel functional imaging platform Diss. ETH No. 20424 Quantitative cell mechanics: new insights from a novel functional imaging platform A dissertation submitted to the ETH Zürich for the degree of DOCTOR OF SCIENCES Presented by GUIDO

Dettagli

Diss. ETH No. 12314. Diplom in Biology, Milan, Italy. accepted ANALYSIS OF THE PROTEOLYTIC PROCESSING OF LACTASE-PHLORIZIN HYDROLASE LAURA ZECCA

Diss. ETH No. 12314. Diplom in Biology, Milan, Italy. accepted ANALYSIS OF THE PROTEOLYTIC PROCESSING OF LACTASE-PHLORIZIN HYDROLASE LAURA ZECCA Diss. ETH No. 12314 ANALYSIS OF THE PROTEOLYTIC PROCESSING OF LACTASE-PHLORIZIN HYDROLASE A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH (ETHZ) for the degree of Doctor in

Dettagli

ETA CONSIGLIATA/RECOMMENDED AGE Indica per quale fascia di età è stato pensato il giocattolo. Suggested age group for the ride.

ETA CONSIGLIATA/RECOMMENDED AGE Indica per quale fascia di età è stato pensato il giocattolo. Suggested age group for the ride. 5 12 ETA CONSIGLIATA/RECOMMENDED AGE Indica per quale fascia di età è stato pensato il giocattolo. Suggested age group for the ride. UN BAMBINO/ONE CHILD Su questo gioco può salire al massimo un bambino.

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Il Consortium Agreement

Il Consortium Agreement Il Consortium Agreement AGENDA Il CA in generale La govenance Legal and Financial IPR Cos è il CA? Il CA è un accordo siglato fra i partecipanti ad un azione indiretta (ad es. un progetto) finanziata nell

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web.

13-03-2013. Introduzione al Semantic Web Linguaggi per la rappresentazione di ontologie. L idea del Semantic Web. Corso di Ontologie e Semantic Web Linguaggi per la rappresentazione di ontologie Prof. Alfio Ferrara, Prof. Stefano Montanelli Definizioni di Semantic Web Rilievi critici Un esempio Tecnologie e linguaggi

Dettagli

Dr Mila Milani. Comparatives and Superlatives

Dr Mila Milani. Comparatives and Superlatives Dr Mila Milani Comparatives and Superlatives Comparatives are particular forms of some adjectives and adverbs, used when making a comparison between two elements: Learning Spanish is easier than learning

Dettagli

NEW DESIGN MATTEO PICCHIO

NEW DESIGN MATTEO PICCHIO NEW DESIGN Matteo Picchio La prossima primavera verrà varato il rimorchiatore d epoca lungo 24 metri di cui l architetto milanese Matteo Picchio ha curato la riconversione in yacht da diporto; il refitting

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases,

Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, Stefano Goldwurm Medical geneticist Centro Parkinson - Parkinson Institute Istituti Clinici di Perfezionamento-Milan neurodegenerative diseases, movement disorders, Parkinson disease 1- genetic counselling

Dettagli

Hard Disk Drive Duplicator Dock USB 3.0 to SATA HDD Duplicator. StarTech ID: SATDOCK22RU3

Hard Disk Drive Duplicator Dock USB 3.0 to SATA HDD Duplicator. StarTech ID: SATDOCK22RU3 Hard Disk Drive Duplicator Dock USB 3.0 to SATA HDD Duplicator StarTech ID: SATDOCK22RU3 The SATDOCK22RU3 USB 3.0 to SATA Hard Drive Duplicator Dock can be used as a standalone SATA hard drive duplicator,

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Broadband Sigma-Delta A/D Converters

Broadband Sigma-Delta A/D Converters Diss. ETH No. 15392 Broadband Sigma-Delta A/D Converters A dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY ZURICH for the degree of Doctor of Technical Sciences presented by PIO BALMELLI

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

On the role of a high auditory brain area in birdsong learning and maintenance

On the role of a high auditory brain area in birdsong learning and maintenance DISS. ETH Nr. 22097 On the role of a high auditory brain area in birdsong learning and maintenance Abhandlung zur Erlangung des Titels DOKTOR DER WISSENSCHAFTEN der ETH ZÜRICH (Dr. sc. ETH Zürich) vorgelegt

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

TECNOLOGIE CONFEZIONAMENTO ALIMENTARE

TECNOLOGIE CONFEZIONAMENTO ALIMENTARE TECNOLOGIE PER il CONFEZIONAMENTO ALIMENTARE VASCA RICEVIMENTO PRODOTTO FB 359 Reception tank FB 359 TOGLIPEZZI FB 451 Piece remover FB 451 SISTEMA DI CONFEZIONAMENTO CAROTE FB 323+FB 312+FB 395 Carrots

Dettagli

Mark Scheme (Results) Summer 2007

Mark Scheme (Results) Summer 2007 Mark Scheme (Results) Summer 2007 GCE GCE Italian (6566/02) Edexcel Limited. Registered in England and Wales No. 4496750 Registered Office: One90 High Holborn, London WC1V 7BH 6566/02 Reading and Writing

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

A Solar Energy Storage Pilot Power Plant

A Solar Energy Storage Pilot Power Plant UNIONE DELLA A Solar Energy Storage Pilot Power Plant DELLA Project Main Goal Implement an open pilot plant devoted to make Concentrated Solar Energy both a programmable energy source and a distribution

Dettagli

Un impegno per la qualità

Un impegno per la qualità Dentro una capsula MUST è racchiusa una cultura per il benessere. Una tradizione che, con il profumo di terre lontane, oggi rinasce nel cuore del Belpaese, fra le dolci colline marchigiane. Per diventare

Dettagli

ANTIBODY PHAGE TECHNOLOGY: LIBRARY CONSTRUCTION AND APPLICATIONS

ANTIBODY PHAGE TECHNOLOGY: LIBRARY CONSTRUCTION AND APPLICATIONS DISS. ETH NO. 18497 ANTIBODY PHAGE TECHNOLOGY: LIBRARY CONSTRUCTION AND APPLICATIONS A dissertation submitted to the ETH ZURICH for the degree of Doctor of Sciences presented by Valeria Lovato Laurea in

Dettagli

ETH ZURICH DOCTOR OF SCIENCES. Ronny Pini Chemical Engineer, ETH Zurich born on October 2 nd, 1980 Citizen of Ascona (TI), Switzerland

ETH ZURICH DOCTOR OF SCIENCES. Ronny Pini Chemical Engineer, ETH Zurich born on October 2 nd, 1980 Citizen of Ascona (TI), Switzerland Diss. ETH no. 18483 ENHANCED COAL BED METHANE RECOVERY FINALIZED TO CARBON DIOXIDE STORAGE Dissertation submitted to the ETH ZURICH for the degree of DOCTOR OF SCIENCES presented by Ronny Pini Chemical

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

true Le linee essenziali della leggerezza. [hebe] The essential lightness. design made in italy

true Le linee essenziali della leggerezza. [hebe] The essential lightness. design made in italy Le linee essenziali della leggerezza. The essential lightness. true design made in italy true design made in italy design made in italy Divano caratterizzato da linee essenziali e rigorose per una pulizia

Dettagli

CEDMEGA Rev 1.2 CONNECTION TUTORIAL

CEDMEGA Rev 1.2 CONNECTION TUTORIAL CEDMEGA Rev 1.2 CONNECTION TUTORIAL rev. 1.0 19/11/2015 1 www.cedelettronica.com Indice Power supply [Alimentazione]... 3 Programming [Programmazione]... 5 SD card insertion [Inserimento SD card]... 7

Dettagli

Ingegneria del Software Testing. Corso di Ingegneria del Software Anno Accademico 2012/2013

Ingegneria del Software Testing. Corso di Ingegneria del Software Anno Accademico 2012/2013 Ingegneria del Software Testing Corso di Ingegneria del Software Anno Accademico 2012/2013 1 Definizione IEEE Software testing is the process of analyzing a software item to detect the differences between

Dettagli

DOLFINI DILETTA MATRICOLA 686017

DOLFINI DILETTA MATRICOLA 686017 DOLFINI DILETTA MATRICOLA 686017 CELLULA GENES EXPRESSION PROGRAM TRASCRIPTION PROGRAM CHROMATIN-MODIFYING COMPLEX TF ON PROMOTERS TRASCRIPTION COMPLEX 141 TF DAL YEAST PROTEOME DATABASE MYC EPITOPE TAG

Dettagli

brand implementation

brand implementation brand implementation brand implementation Underline expertise in reliable project management reflects the skills of its personnel. We know how to accomplish projects at an international level and these

Dettagli

GCE. Edexcel GCE Italian(9330) Summer 2006. Mark Scheme (Results)

GCE. Edexcel GCE Italian(9330) Summer 2006. Mark Scheme (Results) GCE Edexcel GCE Italian(9330) Summer 006 Mark Scheme (Results) Unit Reading and Writing Question Answer Testo.. B B C - A 4 Testo. a. passione che passione b. attrae c. sicuramemte d. favorito ha favorito

Dettagli

Prova finale di Ingegneria del software

Prova finale di Ingegneria del software Prova finale di Ingegneria del software Scaglione: Prof. San Pietro Andrea Romanoni: Francesco Visin: andrea.romanoni@polimi.it francesco.visin@polimi.it Italiano 2 Scaglioni di voto Scaglioni di voto

Dettagli

Quality Certificates

Quality Certificates Quality Certificates Le più importanti certificazioni aziendali, di processo e di prodotto, a testimonianza del nostro costante impegno ed elevato livello di competenze. Qualità * certificata * Certified

Dettagli

Sacca di Goro case study

Sacca di Goro case study Sacca di Goro case study Risposte alle domande presentate all incontro di Parigi (almeno è un tentativo ) Meeting Locale, Goro 15-16/10/2010, In English? 1.What is the origin of the algae bloom? Would

Dettagli

Guida all installazione del prodotto 4600 in configurazione plip

Guida all installazione del prodotto 4600 in configurazione plip Guida all installazione del prodotto 4600 in configurazione plip Premessa Questo prodotto è stato pensato e progettato, per poter essere installato, sia sulle vetture provviste di piattaforma CAN che su

Dettagli

Dynamic Torsion Test for the Mechanical Characterization of Soft Biological Tissues

Dynamic Torsion Test for the Mechanical Characterization of Soft Biological Tissues Diss. ETH Nr. 17028 Dynamic Torsion Test for the Mechanical Characterization of Soft Biological Tissues A Dissertation submitted to the SWISS FEDERAL INSTITUTE OF TECHNOLOGY in ZURICH for the degree of

Dettagli

La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli