Biologia Molecolare. CDLM in CTF L analisi del genoma

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma"


1 Biologia Molecolare CDLM in CTF L analisi del genoma

2 L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale

3 La tipizzazione del DNA DNA Fingerprinting - Medicina legale - Test di paternità/maternità - Analisi inquinanti biotici - Tracking specie vegetali

4 Le basi della tipizzazione del DNA Lo 0,1% del DNA differisce tra gli individui Regioni geniche: pressione selettiva <500 bp >500 bp

5 Il DNA satellite Eterocromatina vicino centromeri e telomeri

6 L analisi dei minisatelliti n Lunghezza della ripetizione: 15-50bp

7 Analisi multilocus

8 L analisi dei microsatelliti (STR) n Lunghezza della ripetizione: 2-6bp n Tecnologie amplificative (PCR) n Funziona anche su DNA parzialmente degradato

9 L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale

10 Sequenziamento dei genomi 1975: prima sequenza di un genoma completo X174 (5Kb) : SV40 (5Kb) 1981: genoma mitocondriale umano (16Kb) 1982: Fago lambda (49Kb) 1984: Epstein-Barr (170Kb) 1985: primi organismi cellulari (Haemophilus influenzae 1,83Mb e Mycoplasma genitalium 0,58 Mb) 2001: Pubblicazione del genoma umano (3 miliardi di basi nel suo corredo aploide)

11 Sequenziamento dei genomi

12 Il Paradosso del valore C n n n n Con valore C si intende la quantità di DNA per genoma; non c è un'ovvia correlazione fra la complessità degli organismi e la quantità di DNA del genoma. In realtà nei genomi degli organismi meno complessi si risparmia spazio in quanto i geni sono più vicini tra loro. Confrontando il genoma umano con quello del lievito, emerge che l'organizzazione di quest'ultimo è molto più economica di quella del genoma umano: n n n I geni sono più compatti Le sequenze intergeniche sono più piccole Le ripetizioni disperse e le altre sequenze non codificanti occupano molto meno spazio Il genoma del lievito è più "concentrato"!

13 Il genoma umano ed il sequenziamnto

14 Il Progetto Genoma Umano n Il Genoma è fatto di DNA, molecola costituita da 4 diversi tipi di nucleotidi (A, C, G, T). n Obiettivo del progetto: determinare la sequenza nucleotidica dell'intero genoma nucleare umano. n Progetto pubblico, finanziato da governi e organizzazioni di tutto il mondo. n Progetto privato: Celera Genomics. n Risultati pubblicati nel n Ad oggi risulta sequenziato circa il 92% del genoma umano

15 Stato di completamento n n n n First, the central regions of each chromosome, known as centromeres, are highly repetitive DNA sequences that are difficult to sequence using current technology. The centromeres are millions (possibly tens of millions) of base pairs long, and for the most part these are entirely un-sequenced. Second, the ends of the chromosomes, called telomeres, are also highly repetitive, and for most of the 46 chromosome ends these too are incomplete. It is not known precisely how much sequence remains before the telomeres of each chromosome are reached, but as with the centromeres, current technological restraints are prohibitive. Third, there are several loci in each individual's genome that contain members of multigene families that are difficult to disentangle with shotgun sequencing methods these multigene families often encode proteins important for immune functions. Other than these regions, there remain a few dozen gaps scattered around the genome, some of them rather large, but there is hope that all these will be closed in the next couple of years. Da wikipedia

16 Metodi di sequenziamento dei genomi

17 L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale

18 DNA Microarrays Decine di migliaia di trascritti possono essere analizzati quantitativamente in un singolo esperimento In a typical cdna or oligo platform, 2 different channels can be used to identify differences in expression profiles of two samples.

19 Microarray: the hybridization (1)

20 Microarray: the hybridization (2) Gene 1 Tagged cdna from sample Gene 2 The hybridization is due to Watson-Crick base paring Gene 3 Coated glass slide

21 Microarray di DNA

22 Protein Arrays n I sirna sono piccoli RNA che operano autosilenziamento (stesso locus) n Sono di solito complementari al 100% alle sequenze bersaglio n I microrna (o mirna) sono coinvolti nei processi di eterosilenziamento n La complementarietà è inferiore al 100%

23 Protein Arrays in fase diretta

24 Protein Arrays in fase inversa

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà

Bioinformatica Analisi del trascrittoma. Dott. Alessandro Laganà Bioinformatica Analisi del trascrittoma Dott. Alessandro Laganà Analisi del trascrittoma Regolazione dell espressione genica I microarray cdna microarray Oligo microarray Affymetrix Chip Analisi dei dati


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso


Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi


CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi


Il genoma umano. Cosa significa genoma? Ditelo con parole vostre

Il genoma umano. Cosa significa genoma? Ditelo con parole vostre Il genoma umano Cosa significa genoma? Ditelo con parole vostre Cos è il genoma umano? 22 coppie di autosomi + una coppia di cromosomi sessuali (XX o XY)


Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei


Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8

Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8 Strumenti della Genetica Molecolare Umana (3) Capitoli 6-7-8 PCR allele specifica-arms (equivalente a ASO) Trova applicazione per individuare specifiche e NOTE mutazioni patogene in un sistema che nel


Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare Insegnamento di Genomica Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare docenti: Silvia Fuselli ( Vincenza Colonna Inga Prokopenko Morena


Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica





Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione


I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più.

I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Piante transgeniche prive di geni marker I geni marker sono necessari per l'isolamento di piante transgeniche (efficienza di trasf. non ottimale), ma poi non servono più. Possibili problemi una volta in


La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza



GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2014-2015 Docente: Silvia Fuselli Fonti e testi di riferimento Dan Graur: >courses > bioinformatics


La tecnologia dei microarray

La tecnologia dei microarray La tecnologia dei microarray Introduzione per l analisi dell espressione genica: Affymetrix GeneChip spotted arrays L analisi dei dati Campi di applicazione dei microarray Introduzione I progetti di sequenziamento


a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA CORSO INTEGRATO di Genetica e Biologia Molecolare GENETICA a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA Dott.ssa Elisabetta Trabetti POLIMORFISMO La presenza nella popolazione di due


Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica


Lezione IX-X martedì 25-X-2011

Lezione IX-X martedì 25-X-2011 Lezione IX-X martedì 25-X-2011 corso di genomica laurea magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 non ci sarà lezione martedì 1 e giovedì 3 Novembre


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:


Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS


Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi



GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza



TECNICHE DI ANALISI BIOLOGICHE TECNICHE DI ANALISI BIOLOGICHE VENERDÍ 15.12.2006 Flow chart: 1. struttura cellulare; 2. genesi cellulare; 3. organizzazione cellulare; 4. compartimentazione cellulare; 5. struttura del d.n.a.; 6. topografia


Bell, Nature 421: 414, 2003. Tratta da lezioni di genetica Prof. PF Pignatti

Bell, Nature 421: 414, 2003. Tratta da lezioni di genetica Prof. PF Pignatti La scoperta della doppia elica mezzo secolo fa ha coinvolto la pratica medica con lentezza, ma sono probabili trasformazioni significative nei prossimi 50 anni. Bisogna cambiare la pratica medica e la






PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA


Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una

Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp ( Mbp=150Gbp) di una Genomi vegetali Da 7x10 7 bp per genoma aploide (130Mbp diploide, 5 cromosomi) di Arabidopsis thaliana alle 1,5x10 11 bp (150.000Mbp=150Gbp) di una Liliacea. Tra le graminacee il frumento ha un genoma


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti


Functional & regulatory genomics

Functional & regulatory genomics Biologia Cellulare Molecolare Avanzata Functional & regulatory genomics 1. Complexity of eukaryotic genomes. 2. Basic concepts of gene transcription and regulation 3. Transcriptomes 4. Coding, noncoding


Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione


RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.





Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione


Docente Prof. Agata Gadaleta email: - Tel. 080 544 2993

Docente Prof. Agata Gadaleta email: - Tel. 080 544 2993 Corso di Laurea: Scienze e tecnologie alimentari Corso Integrato: Biotecnologie per la qualità degli alimenti Modulo: Metodologie geneticomolecolari (6 CFU) (4 CFU Lezioni + 2 CFU Esercitazioni) Docente


Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


Esercitazioni di Genomica

Esercitazioni di Genomica Esercitazioni di Genomica Bioinformatica ai tempi del NGS, PhD CRIBI Biotechnology Center, University of Padua BMR Genomics srl, Spin-Off Giovanni Birolo, PhD CRIBI Biotechnology Center, University of



scaricato da LA TECNOLOGIA DEI MICROARRAYS LA TECNOLOGIA DEI MICROARRAYS 1 8 anni dopo: 4162 riferimenti bibliografici sui microarrays I microarrays misurano il livello di espressione degli mrna trascritti dai geni del sistema biologico di interesse


Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010

Le biotecnologie. Sadava et al. Biologia La scienza della vita Zanichelli editore 2010 Le biotecnologie 1 Cosa sono le biotecnologie? Le biotecnologie sono tutte quelle tecniche utilizzate (fin dall antichità) per produrre sostanze specifiche a partire da organismi viventi o da loro derivati.


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini

Analisi del genoma umano: possibilità e limiti. Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini Analisi del genoma umano: possibilità e limiti Francesca Lugani, MD, PhD U.O.C. Nefrologia, dialisi e trapianto IRCCS G. Gaslini What is DNA? It's a history book - a narrative of the journey of our species


Polimorfismo: la presenza di due o più forme alleliche in una specie; ovvero la presenza di alleli che mostrano variazioni in una data posizione.

Polimorfismo: la presenza di due o più forme alleliche in una specie; ovvero la presenza di alleli che mostrano variazioni in una data posizione. Polimorfismo: la presenza di due o più forme alleliche in una specie; ovvero la presenza di alleli che mostrano variazioni in una data posizione. Polimorfismi della lunghezza dei frammenti di restrizione


Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione


Sequenziamento e analisi di genomi completi

Sequenziamento e analisi di genomi completi Sequenziamento e analisi di genomi completi Genoma L'insieme del materiale genetico di un organismo o cellula. (Hans Winkler, 1920) Un genoma è sequenziato quando viene stabilita interamente la successione


Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno


Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli

Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016. Docente: Silvia Fuselli Introduzione al corso di bioinformatica e analisi dei genomi AA 2015-2016 Docente: Silvia Fuselli Possibili testi di riferimento Introduction to Genomics, A.M. Lesk, Oxford Capitoli 1, 3,


Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,



DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando


La Tecnologia dei Microarray. Tor Vergata Aprile 2011 (

La Tecnologia dei Microarray. Tor Vergata Aprile 2011 ( La Tecnologia dei Microarray Tor Vergata Aprile 2011 ( SH Friend and RB Stoughton, The Magic of Microarray, Scientific American, February. 2002, pp. 44-49 Vogliamo sapere velocemente


Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula

Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Oltre il DNA: alla scoperta dei m eccanismi molecolari che regolano lo svilup po e la fisiologia della cellula Prof. Paolo Macchi, PhD Lab of Molecular and Cellular Neurobiology - CIBIO Univ. Trento


Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


I genomi vegetali. Arabidopsis (genoma aploide circa 140 Mb di DNA; 2n=10 barbabietola da zucchero (750 Mb; 2n=18) pino (23000 Mb; 2n=24)

I genomi vegetali. Arabidopsis (genoma aploide circa 140 Mb di DNA; 2n=10 barbabietola da zucchero (750 Mb; 2n=18) pino (23000 Mb; 2n=24) I genomi vegetali A. thaliana barbabietola pino Arabidopsis (genoma aploide circa 140 Mb di DNA; 2n=10 barbabietola da zucchero (750 Mb; 2n=18) pino (23000 Mb; 2n=24) Tre specie diploidi, le differenze



SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura



ANALISI DI LINKAGE (CONCATENAZIONE) ANALISI DI LINKAGE (CONCATENAZIONE) L analisi di linkage permette di determinare la posizione cromosomica di un locus responsabile di una determinata malattia/carattere genetico rispetto a marcatori polimorfici


Ibridazione degli acidi nucleici

Ibridazione degli acidi nucleici Ibridazione degli acidi nucleici L ibridazione consiste nel porre a contatto acidi nucleici a singolo filamento provenienti da fonti diverse: Sonda di solito una popolazione omogenea di molecole note.


Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN)

Verifiche qualitative dell RNA e cdna in ambito dei trials BCR/ABL e AML translocation programme. Massimo Degan, CRO Aviano (PN) e cdna in ambito dei trials BCR/ABL e AML translocation programme Massimo Degan, CRO Aviano (PN) perchè è importante verificare l RNA La verifica della qualità dell RNA nei saggi diagnostico-molecolari


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici

II LEZIONE. Database di interesse per la genetica e la biologia molecolare. Portali per l'accesso a database e servizi bioinformatici II LEZIONE Database di interesse per la genetica e la biologia molecolare Portali per l'accesso a database e servizi bioinformatici DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance



FASI SPERIMENTALI PRINCIPALI FASI SPERIMENTALI PRINCIPALI 1: I dentificazione, isolamento e clonaggio gene codificante per proteina bersaglio ( BIOINFORMATICA) 2: espressione in sistema eterologo 3: purificazione e caratterizzazione


La tecnologia dei microarray

La tecnologia dei microarray La tecnologia dei microarray I microarray I progetti di sequenziamento (progetti permesso di identificare migliaia di geni genoma) ) hanno Migliaia di geni (ed i loro prodotti, le proteine) operano in


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Struttura della cromatina

Struttura della cromatina Struttura della cromatina Il DNA nel nucleo è protetto dall azione delle nucleasi Se la cromatina viene trattata con nucleasi aspecifiche la maggior parte del DNA viene frammentata in frammenti di 200


La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana PREMESSA


Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico



ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio


Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli


Corso di Genetica per la Facoltà di Medicina e Chirurgia Alberto Piazza

Corso di Genetica per la Facoltà di Medicina e Chirurgia Alberto Piazza Rilevanza clinica delle malattie genetiche Caratteri monofattoriali Corso di Genetica per la Facoltà di Medicina e Chirurgia Alberto Piazza circa il 25% di tutti i pazienti in età pediatrica manifestano


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina


Il sequenziamento del genoma umano

Il sequenziamento del genoma umano Il sequenziamento del genoma umano 1. storia e risultati dei due progetti: HGP e Celera. 2. innovazioni e problematiche di ricerca connesse al progetto genoma umano: (a) sequenziamento su larga scala (b)


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,


Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA

Analisi qualitativa con Agilent BioAnalyzer. cdna, RNA Totale e Messaggero e small RNA Il Servizio di Biologia Molecolare si è di recente dotato di uno strumento per l analisi qualitativa e quantitativa degli acidi nucleici Agilent Bioanalyzer 2100 e ha implementato tale tecnologia nell






DATABASE DI GENETICA E BIOLOGIA MOLECOLARE DATABASE DI GENETICA E BIOLOGIA MOLECOLARE OMIM Online Mendelian Inheritance in Man EntrezGene curated sequence and descriptive information about genetic loci GenCards HGMD dbsnp database of human genes,


English-Medium Instruction: un indagine

English-Medium Instruction: un indagine English-Medium Instruction: un indagine Marta Guarda Dipartimento di Studi Linguistici e Letterari (DiSLL) Un indagine su EMI presso Unipd Indagine spedita a tutti i docenti dell università nella fase





Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II


Il sequenziamento del DNA

Il sequenziamento del DNA Il sequenziamento del DNA Si può ottenere la massima informazione sulla struttura di una molecola di DNA determinandone la sequenza nucleotidica completa Il sequenziamento del DNA è una componente irrinunciabile


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (



TRE PAROLE CHIAVE DELLA GENETICA TRE PAROLE CHIAVE DELLA GENETICA Questo documento è pubblicato sotto licenza Creative Commons Attribuzione Non commerciale Condividi allo stesso modo


Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e


Marcatori molecolari nelle piante

Marcatori molecolari nelle piante Marcatori molecolari nelle piante Mappa genetica: rappresentazione grafica dei singoli gruppi di associazione con l indicazione dell ordine e della posizione relativa dei geni lungo il cromosoma determinata


Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare


La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione


Lezione 5. Next Generation Sequencing

Lezione 5. Next Generation Sequencing Lezione 5 Next Generation Sequencing Perchè Next Generation Sequencing Si possono generare centinaia di milioni di corte sequenze (35bp-250bp) in una sola corsa in un tempo breve con un basso prezzo per
