GENETICA GENERALE E MOLECOLARE

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "GENETICA GENERALE E MOLECOLARE"

Transcript

1 GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e pseudogeni -Sequenze ripetute Organizzazione della cromatina Il progetto genoma umano -Strategie di clonaggio, mappatura e sequenziamento di genomi complessi -Banche dati di DNA e loro uso. -Metodi per la comparazione di sequenze e per l analisi della similitudine e della omologia. Regolazione dell'espressione genica nell'uomo -Meccanismi epigenetici di regolazione -Elementi genetici di regolazione trascrizionale -Meccanismi di regolazione post-trascrizionale e post-traduzionale

2 Mutazioni e instabilità del genoma -Classi e meccanismi molecolari alla base delle mutazioni -Polimorfismi genetici Metodi per l analisi di mutazioni e polimorfismi -Diagnostica molecolare Genomica funzionale (metodi per lo studio dell espressione genica) -Tecniche di RT-PCR e real time PCR. -Array di DNA, analisi: - per la caratterizzazione di cellule tumorali; - per lo studio di malattie multifattoriali; - per la risposta ai farmaci.

3 Testi consigliati - Tom Strachan, Genetica molecolare umana, 2 a Ed. UTET, T.A. Brown, Genomi 2 a Ed. EdiSES, R.J. Reece, Analisi dei Geni e Genomi Ed. EdiSES, 2006 Prova d esame - Esame scritto (quiz e qualche domanda a risposta breve)

4 Il genoma umano LEZIONE 1

5 Il DNA mitocondriale % del genoma umano 37 geni: 13 codificano per polipeptidi del mitocondrio (concetto di semiautonomia); 24 codificano per prodotti maturi ad RNA, necessari per l espressionedel genoma mitocondriale. I geni sono estremamente compatti: privi di introni e parzialmente sovrapposti

6 Il DNA nucleare contiene ca 3,4x10 9 coppie di basi, suddivise in 23 coppie di molecole lineari: i cromosomi. Il più piccolo contiene ca di nucleotidi; il più grande ca

7 Ma quanto genoma serve? Relazione tra complessità degli organismi e dimensione del loro genoma

8 IL CONTENUTO MINIMO DI DNA TROVATO IN CIASCUNA CLASSE AUMENTA CON L AUMENTARE DELLA COMPLESSITA BIOLOGICA Tuttavia COMPARAZIONI ALL INTERNO DELLA STESSA CLASSE INDICANO LA PRESENZA DI UN ECCESSO DI DNA RISPETTO ALLA QUANTITA RICHIESTA PER CODIFICARE IL SET DI INFORMAZIONI (PROTEINE) NECESSARIE PARADOSSO DEL VALORE C SOLO UNA PARTE DEL GENOMA CODIFICA PER LE INFORMAZIONI FONDAMENTALI ALCUNE SEQUENZE POSSONO ESSERE PRESENTI IN COPIA MULTIPLA E LA LORO QUANTITA NON CORRELA CON LA COMPLESSITA

9 CONTENUTO DEL DNA (C) DIFFERENZE TRA COMPLESSITA (S) CONTENUTO = SOMMA DI TUTTE LE SEQUENZE DEL GENOMA COMPLESSITA = SOMMA DI TUTTE LE SEQUENZE DIVERSE DI UN GENOMA ORGANISMI CON SIMILE COMPLESSITA (S) POSSONO CONTENERE QUANTITATIVI DIVERSI DI SEQUENZE (C)

10 In base alla ripetizione, nei genomi degli eucarioti si possono distinguere tre tipi di sequenze: La proporzione delle diverse sequenze varia in specie diverse

11 Ma quali sequenze sono contenute nel genoma?????

12 GENI 1. Geni che codificano per polipeptidi; ACCTGAATTACGGATTGGCCTATTACGACTAGC..

13 Qual è la struttura dei geni che codificano per polipeptidi, negli eucarioti? I geni sono solitamente presenti in copia singola o in basso numero di copie. Su scala evolutiva i geni sono tuttavia cresciuti in grandezza.

14

15

16

17 Procarioti vs. eucarioti I geni dei procarioti sono organizzati in operoni (policistronici) I geni degli eucarioti sono generalmente singole unità trascrizionali (monocistronici)

18 GENI 2. Geni che codificano per RNAs; Il 5-10% dei geni nucleari sono RNA-genes

19 I geni per gli rrna-eucariotici cluster di geni ripetuti Direzione della trascrizione S 5,8S 28S Direzione della trascrizione S 5,8S 28S Unità di trascrizione 13 Kb DNA intercalato da 20 a 30 Kb Unità di trascrizione 13 Kb RNA di 13Kb 45 S

20 I geni trascritti dalla RNA poliii I geni per l rrna 5S, i trna e alcuni geni per gli snrna.

21 RNA pol I trascrive rrna RNA pol II trascrive mrna per proteine RNA pol III trascrive trna e 5S rrna

22 Non Coding RNAs: RiboRegulators rrna trna Vault Y RNAs 7SK snrnas snornas Guide RNA Introns 5 UTR 3 UTR Catalytic: Ribozymes Telomerase MicroRNAs Viral RNAs Xist, H19 Retrotransposons

23 Distribuzione genomica dei geni negli eucarioti Negli eucarioti unicellulari, la selezione, per aumentare l efficienza, ha mantenuto bassa la quantità di DNA non-codificante. Il DNA non-codificante è invece molto rappresentato negli organismi multicellulari; dove fornisce materiale grezzo per la duplicazione genica e la divergenza.

24 I geni dell uomo Caratteristica Valore medio Numero degli esoni 8.8 Dimensione di un esone Dimensioni di un introne Dimensioni di una regione 5 non tradotta Dimensioni di una regione 3 non tradotta Lunghezza totale di un gene 145 pb 3365 pb 300 pb 770 pb pb Il genoma umano Sequenze codificanti altamente conservate Sequenze non codificanti altamente conservate Sequenze ripetute di tipo trasponibile Sequenze eterocromatiche Altre sequenze non conservate Fig. 6

25 I geni possono essere classificati, oltre che per la funzione, anche per il numero di ripetizioni e l organizzazione Geni singoli Geni ripetuti Geni appartenenti a famiglie Geni in clusters Geni interspersi nel genoma

26 Una certa % dei geni umani è costituita da membri di famiglie di sequenze di DNA. Ovvero geni che condividono tra loro un buon grado di omologia Ibridazione molecolare Sequenziamento del DNA PCR A seconda del grado di omologia tra i diversi geni di una stessa famiglia, si distinguono: FAM DI GENI RIPETUTI ORGANIZZAZIONE IN TANDEM, IN UNO O PIU CLUSTERS (i componenti sono fondamentalmente identici tra loro. es. rrna e Istoni) FAM GENICHE CLASSICHE (i componenti mostrano una certa divergenza tra loro) ORGANIZZAZIONE IN CLUSTERS (es. GLOBINE E HLA) ORGANIZZAZIONE INTERSPERSA (es. actina) SUPERFAMIGLIE GENICHE ORGANIZZAZIONE INTERSPERSA (geni che codificano prodotti funzionalmente correlati, ma con minima omologia di sequenza)

27 Perché esistono le famiglie geniche? Funzioni specializzate. Espressione differenziale. Richiesta di grandi quantità di prodotto.

28 Richiesta di grandi quantità di prodotto: Famiglie di geni ripetuti L unità di trascrizione è ripetuta in tandem, identica, circa 250 volte in cinque raggruppamenti (clusters), localizzati sul braccio corto dei cromosomi acrocentrici (50 unità ripetute in tandem per raggruppamento). Le sequenze codificanti sono estremamente conservate.

29 I geni ribosomali Organismo n ripetizioni Organizzazione Lievito raggruppati su un singolo cromosoma drosofila due raggruppamenti su due cromosomi Xenopus cluster uomo cluster Cellule umane in coltura hanno tra 5X10 6 e 1X10 7 ribosomi

30 Richiesta di funzioni specializzate Famiglie geniche classiche: i geni per la catena pesante HLA di classe I I singoli membri presentano un elevato grado di omologia di sequenza per tutta la lunghezza del gene o almeno per la parte codificante. Le famiglie geniche contengono spesso pseudogeni non processati o frammenti genici.

31 Espressione differenziale Famiglie geniche classiche: raggruppamento α e β globinico α globina HS-40 ξ 2 ψ ξ1 ψ α2 ψ α1 α 2 α 1 θ β globina HS-4 HS-3 HS-2 ε G γ A γ Ψβ δ β Le LCR si trovano a monte dei raggruppamenti e la loro funzione è di organizzare il raggruppamento in un dominio di cromatina attiva, agendo come enhancer.

32 ORGANIZZAZIONE IN CLUSTER -> CONTROLLO FUNZIONALE: i singoli geni sono fisicamente distanziati tra loro, ma strettamente raggruppati; questo permette di essere soggetti a un meccanismo di regolazione comune. Le LCR sono brevi sequenze enhancer che agiscono in cis, che vengono riconosciute da fattori di trascrizione eritroidospecifici. Si ritiene che l alternanza delle emoglobine sia legata oltre che a fenomeni di competizione dei geni per interagire con le LCR, anche all intervento di silenziatori gene-specifici, modulati durante lo sviluppo. DNA nell embrione ε Gγ Aγ Ψβ δ β DNA nel feto ε Gγ Aγ Ψβ δ β DNA nell adulto ε Gγ Aγ Ψβ δ β

33 Famiglie geniche classiche con organizzazione interspersa: Non vi è una relazione fisica tra i membri di una famiglia. Possono derivare da eventi di duplicazione genica oppure da eventi di trasposizione. famiglia n copie caratteristiche aldolasi 5 3 geni funzionali e 2 pseudogeni, su 5 cromosomi diversi NF1 >12 1 gene funzionale (17q), copie difettose, non processate gliceraldeide 3-fosfato-deidrogenasi >18 1 gene funzionale actina >20 4 geni funzionali

34

35 Superfamiglie geniche: i geni codificano prodotti funzionalmente correlati ma che non mostrano elevati gradi di omologia di sequenza né motivi amminoacidici particolarmente conservati I membri della superfamiglia delle Ig sono proteine di superficie con strutture e domini simili tra loro

36 Come si sono formati i geni ripetuti e le famiglie geniche? Meccanismo della Duplicazione Genica Un Crossing-over ineguale durante la meiosi genera un cromosoma con due copie di un gene, e un altro con nessuna copia. La ricombinazione può avvenire tra corte sequenze di DNA ripetuto (elementi Alu)

37 Duplicazione genica e: mantenimento della stessa funzione, acquisizione di nuove funzioni o perdita funzionale Pressione selettiva SI g e n e a n c e s t r a l e A d u p l i c a z i o n e m u t a z i o n i Pressione selettiva NO m u t a z i o n i funzione originaria A funzione correlata A2 nessuna funzione ψa

38 Pseudogeni I Pseudogeni non processati: convenzionali ed espressi Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso le sequenze fiancheggianti. Data la loro somiglianza nell organizzazione genomica, la loro natura non funzionale puo essere riconosciuta, a livello di sequenza, dalla presenza di codoni di stop nella regione corrispondente alla porzione codificante del gene funzionale o dalla presenza di un elevato numero di mutazioni ognuna della quali originerebbe una molecola mutante. Sono comuni nelle famiglie di geni raggruppati Talvolta possono venir espressi a livello di RNA o addirittura come polipeptide, che non viene utilizzato nella molecola funzionale: gene della globina θ, sicuramente viene espresso, ma non se ne riscontra la presenza nell emoglobina funzionale

39 Pseudogeni II Pseudogeni processati: sono copie non funzionali degli esoni di un gene espresso e si ritrovano nelle famiglie dei geni interspersi. La loro origine sembrerebbe dovuta all integrazione di una sequenza di DNA originatesi per azione di una trascrittasi inversa. se sono copie di trascritti della RNApolimerasi II di solito non sono espressi perche privi del promotore. Possono venir espressi se integrati vicino ad un promotore, in questo caso l espressione potrebbe non essere nello spazio e nel tempo quella originaria se sono copie di trascritti della RNApolimerasi III possono avere al loro interno il promotore ed essere espressi. Possono raggiungere un elevato numero di copie (sequenze Alu)

40

41 Quindi i geni rappresentano una piccola frazione del genoma nucleare umano.e il resto? 30% 70% 1.5%

42 Famiglie di DNA ripetuto non genico

43 Il genoma nucleare contiene una grande quantità di sequenze ripetute che sono in gran parte inattive da un punto di vista trascrizionale DNA RIPETUTO IN TANDEM: i blocchi possono mappare su piu cromosomi a seconda delle dimensioni medie delle unita si suddivide in: DNA satellite DNA minisatellite DNA microsatellite DNA RIPETUTO INTERSPERSO: Le singole unita sono sparse nel genoma. Contengono sequenze che possono essere retrotrasposte attraverso un intermedio di RNA.

44 DNA altamente ripetuto in tandem Sequenze semplici Unità di sequenza di bp Parecchie famiglie per ciascun organismo Localizzato prevalentemente nell eterocromatina I blocchi possono mappare su più cromosomi

45 Classi principali del DNA ripetuto in tandem

46 Organizzazione dei DNA satelliti nei centromeri

47 DNA RIPETUTO INTERSPERSO Viene suddiviso in due principali famiglie: Short Interspersed Nucleotide Elements; Long Interspersed Nucleotide Elements Classe Famiglia Dimensioni unità ripetuta SINE Alu 0,3 kb lunghezza completa MIR Dimensione media 0,13 kb LINE LINE-1 (Kpn) LINE -2 6,1 kb lunghezza completa, ma le dimensioni medie sono 0,8 kb Dimensione media 0,25 kb LTR ERV Dimensione media 1,3 kb N copie % Genoma ca 10,7% ca ca 2,5% ca ca 17,3% ,3% ,7% Trasposoni a DNA MER-1 (Charlie) Dimensione media 0,25 kb ca ,4%

48 DNA ripetuto intersperso

49 SINE la famiglia più rappresentata è quella Alu. Probabilmente la sequenza Alu deriva per retrotrasposizione dal gene dell RNA 7SL, trascritto dalla RNA poliii. Alu è specifica dei primati Le ripetizioni Alu hanno un elevato contenuto in GC e sono localizzate nelle bande G chiare La tipica sequenza Alu è un dimero ripetuto in tandem di 130 bp; nella regione terminale è presente una corta sequenza ricca in residui A Tra i due dimeri vi è una asimmetria dovuta all inserzione di un elemento di 32 nt all interno della seconda ripetizione.

50 LINE: I membri di tale famiglia sono elementi trasponibili, elementi di DNA instabili che migrano in regioni differenti del genoma L elemento consenso della famiglia Kpn (6,1 kb) possiede due ORF: ORF 1: codifica per p40 a funzione ignota ORF2: codifica per una proteina con un dominio endonucleasico con attività di trascrittasi inversa. La sequenza completa è rara.

51 Viral retrotransposons contain LTRs and behave like retroviruses in the genome "

52 Nonretroviral retrotransposons lack LTRs "

53 Nonretroviral retrotransposons move by an unusual mechanism "

54 retrotrasposone Sito di inserzione NNNNNNNNCCTGATTTACTTTTTTTTT! NNNNNNNNGGACTAAATGAAAAAAAAA NNNNNNNNC NNNNNNNNGGACTAAAT CTGATTTACTTTTTTTTT! GAAAAAAAAA! NNNNNNNNCCTGATTTA NNNNNNNNGGACTAAAT CTGATTTACTTTTTTTTT! GACTAAATGAAAAAAAAA! NNNNNNNNCCTGATTTA NNNNNNNNGGACTAAAT CTGATTTACTTTTTTTTT! GACTAAATGAAAAAAAAA! SEQUENZE RIPETUTE DIRETTE

55 Classi di sequenze di mammifero che vengono trasposte mediante un intermedio a RNA Retrovirus endogeni-> sequenze che assomigliano ai retrovirus ma non sono in grado di infettare. Contengono le lunghe ripetizioni terminali (LTR) fiancheggianti dei retrovirus ed elementi dei retrovirus come la trascrittasi inversa Retrotrasposoni sono privi delle LTR e di altri elementi dei retrovirus. Codificano per la trascrittasi inversa RT contengono una sequenza A/T ad una estremità : Elementi LINE-1 Pseudogeni processati sono privi di trascrittasi inversa quindi non possono fare trasposizione indipendente, ma necessitano di altri elementi. Elementi SINE come la famiglia Alu

56

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

La ricombinazione del DNA

La ricombinazione del DNA La ricombinazione del DNA Ricombinazione omologa I modelli di Halliday e di Meselson-Redding. Il complesso RecBCD genera il filamento di DNA invasore. La proteina RecA promuove lo scambio dei filamenti

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

Elementi ripetuti del Genoma Umano. Milioni di anni

Elementi ripetuti del Genoma Umano. Milioni di anni Elementi ripetuti del Genoma Umano Patologia Milioni di anni Evoluzione Un gene è duplicato Un gene è riarrangiato Genoma Il Genoma è l intero DNA contenuto in una Cellula Geni Sequenze Intergeniche Sequenze

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Lezione 3. Genoma umano come esempio di genoma eucariote

Lezione 3. Genoma umano come esempio di genoma eucariote Lezione 3 Genoma umano come esempio di genoma eucariote 3.2 x 10 9 bp Genoma umano 22 autosomi + xx (femmina) o xy (maschio) Primo draft di sequenza: 2001 Genotipo: sequenza di DNA, sia nucleare che mitocondriale.

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Genoma Umano 3200 Mb. Codificante 10% Ripetuto in tandem Altamente ripetuto. Satellite

Genoma Umano 3200 Mb. Codificante 10% Ripetuto in tandem Altamente ripetuto. Satellite Genoma Umano 3200 Mb Geni e sequenze gene-associate 25% DNA extragenico 75% Non codificante 90% Codificante 10% DNA unico e a basso numero di copie 60% DNA ripetitivo 40% Regioni spaziatrici Introni Seq.

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

Organizzazione del genoma umano I

Organizzazione del genoma umano I Organizzazione del genoma umano I LEZIONE 7 1 Oggi, uno degli obiettivi prioritari è la comprensione dei meccanismi mediante i quali le informazioni contenute nel materiale genetico portano, partendo da

Dettagli

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare Insegnamento di Genomica Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare docenti: Silvia Fuselli (fss@unife.it) Vincenza Colonna Inga Prokopenko Morena

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2011-2012 11.10.2011 Lezioni N. 7 e 8 Ereditarietà Mendeliana Segregazione alleli, indipendenza geni, associazione, ricombinazione Dott.ssa Elisabetta Trabetti UN GENE =

Dettagli

TRASCRIZIONE DEL DNA. Formazione mrna

TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Genomi dei procarioti

Genomi dei procarioti Genomi dei procarioti Una molecola circolare di DNA E.coli circa 4 x 10 6 coppie di basi Il genoma è quasi tutto codificante Viene trascritto in mrna policistronici Il genoma eucariotico Il genoma eucariotico

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA

Linkage. Lezione 4 (riprendere il testo di Genetica ) By NA Linkage Lezione (riprendere il testo di Genetica ) Tipi di mappe: mappe genetiche Mappe genetiche : si basano sulla frequenza di ricombinazione fra locus identificati attraverso marcatori di varia natura:

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione

Dettagli

L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi

Dettagli

Frontiere della Biologia Molecolare

Frontiere della Biologia Molecolare Prof. Giorgio DIECI Dipartimento di Bioscienze Università degli Studi di Parma Frontiere della Biologia Molecolare Milano, 4 marzo 2016 Fotografia al microscopio elettronico di una plasmacellula NUCLEO

Dettagli

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni Anomalie Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni 17 Transcrittasi inversa 18 Codice genetico mitocondriale 19 Codone

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi

La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi La divisione cellulare e la riproduzione degli organismi Parte I: Mitosi 1 La divisione cellulare Permette agli organismi di accrescersi e sostituire le cellule morte ed è alla base della riproduzione.

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

7. Gruppi genici e sequenza ripetute

7. Gruppi genici e sequenza ripetute 7. Gruppi genici e sequenza ripetute contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale La duplicazione e la delezione di

Dettagli