STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI"

Transcript

1 STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

2 Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries information from one generation to the next. In molecular terms, it is the entire DNA sequence (including exons, introns and noncoding transcriptional control regions) necessary for production of a functional protein or RNA

3 ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGTT AAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTACT GGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTAG TCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAATC CTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACCA TAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTAT TGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAGT AGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCTCT GGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAGAA ATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTCTT CTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCAGA ACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGAGA AAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCTCT GCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACAAA GCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGA GACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCT GGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATG ATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATGAC TTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATC TGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCG ATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGG CATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAG GGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTC TCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAA ATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAG

4 Struttura del GENE

5 GENE procariotico Genoma di E. coli

6 GENE procariotico OPERONE Sequenze regolatrici a monte Sequenze codificanti Sequenze terminatrici della sequenza codificante

7 GENE procariotico animazione

8 GENE procariotico Promotori

9 GENE procariotico Sequenze codificanti ORF (Open Reading Frame) ATGGTATAT TAA MET VAL TYR STOP

10 GENE procariotico Promotore A B C Operone Sequenze codificanti Terminatore

11 GENE procariotico Promotore A B C Operone Sequenze codificanti Terminatore mrna mrna mrna Proteina Proteina Proteina

12 GENE procariotico Repressione Promotore A B C Operone Sequenze codificanti Terminatore Nessuna espressione

13 GENE EUCARIOTICO GENI DELLA I CLASSE RNA RIBOSOMIALE rrna (28S-5,8S e 18s) GENI DELLA II CLASSE RNA MESSAGGERO mrna Piccoli RNA nucleari snrna microrna - LncRNA GENI DELLA III CLASSE RNA TRANSFER trna Piccoli rna nucleolari snorna Piccoli rna citoplasmatici - scrna

14 GENE EUCARIOTICO

15 GENE EUCARIOTICO

16 GENE EUCARIOTICO

17 GENE EUCARIOTICO

18 GENE EUCARIOTICO

19 Promotore GENE EUCARIOTICO

20 Promotore GENE EUCARIOTICO

21 Sequenza codificante modulare GENE EUCARIOTICO

22 GENE EUCARIOTICO Segnale di poliadenilazione

23 Organizzazione genica negli eucarioti I geni eucariotici sono monocistronici Eccezioni: Unità di trascrizione policistroniche risolte in mrna maturi monocistronici per trans-splicing splicing (es in tripanosomi, nematodi, platelminti); uso di IRES, reinizio della traduzione o frameshift traduzionale I geni eucariotici non mostrano nessuna evidente relazione tra localizzazione e l attivitl attività funzionale (functional clustering) o con l espressione l spazio- temporale Eccezioni: Raggruppamento di geni con funzione correlata, quali geni Hox, geni per emoglobine e geni per immunoglobuline (duplicazioni i in tandem?) 23

24

25 Organizzazione genica negli eucarioti Alcuni geni eucariotici sono policistronici Taxon Tripanosomi (Euglenozoa) Cnidari Platelminti (Metazoa Acoelomata) Nematodi (Metazoa Pseudocoelomata) Ciona intestinalis/oikopleura dioica Entità tutti gli RNA alcuni RNA pochi RNA molti RNA molti RNA Il processamento del precursore policistronico è associato al Trans Splicing delle estremità 5 degli mrna e alla poliadenilazione delle estremità 3 per generare i trascritti monocistronici. 25

26 Geni codificanti per proteine - geni presenti in unica copia (single( single-copy genes) - geni omologhi presenti in copie multiple ed organizzati in famiglie geniche I membri di una stessa famiglia genica possono essere localizzati i in unico cluster, dispersi, o localizzati in più cluster: Geni in cluster: α-globin (7), growth hormone (5), Class I HLA heavy chain (20),. Geni dispersi: Pyruvate dehydrogenase (2), Aldolase (5), PAX (>12),.. Geni localizzati in più cluster: HOX (38 4), Histones (61 2), Olfactory receptors (>900 25), 26

27

28 La struttura dei geni eucariotici Nel genoma umano non si osserva una distribuzione omogenea dei geni. La più alta densità genica si osserva nel chr 19, mentre il chr 13 e Y mostrano la più bassa densità. GENE esone introne esone introne esone TSS TRASCRIZIONE 5 UTR mrna CDS 3 UTR TRADUZIONE Caratteristiche dei geni umani Mediana Media Numero di esoni 7 8,8 L introni (bp) L 5'UTR (bp) L CDS (bp) L 3'UTR (bp) L gene (bp)

29 La struttura dei geni eucariotici I geni eucariotici presentano una grande varietà di strutture e dimensioni. Ad esempio nel genoma umano: Il più piccolo: trna GLU (69 bp) Il più grande: Distrofina (2.4 Mb, la sua trascrizione richiede circa 16h) Il numero di esoni può variare da 1 (geni privi di introni come molti geni per ncrna, interferoni, istoni, ribonucleasi, HSP, GPCR, ecc.) sino a 363 (Titina). Le dimensioni degli esoni e degli introni sono estremamente variabili. abili. A fronte di esoni costituiti da pochi nucleotidi, l esone l più grande è presente nel gene per ApoB (7.6 kbb). Anche le dimensioni degli introni possono variare da pochi nucleotidi fino a 800 kbp (gene WWOX). Le proteine codificate possono variare nelle dimensioni da pochi residui (piccoli ormoni) sino a molte migliaia (Titina( Titina,, aa). 29

30 GENE EUCARIOTICO Può un gene codificare per diverse proteine?

31 Uno stesso gene può codificare per proteine indirizzate a diversi compartimenti cellulari: l esempio l del gene NFS1 La proteina codificata dal gene NFS1 rimuove lo zolfo dalla cisteina formando alanina. Questo gene utilizza siti di inizio alternativi della trascrizione e quindi traduzione e per generare una isoforma mitocondriale ed una isoforma citoplasmatica. La selezione del sito di inizio della la traduzione è regolata dal ph citosolico. L isoforma che codifica per la proteina mitocondriale (457 aa) contiene un peptide segnale e un dominio aminotrasnferasico. L altra isoforma, che deriva sa un sito di inizio alternativo della a trascrizione codifica per una proteina piùcorta (397 aa) priva del peptide segnale ma contenente il dominio aminotransferasico.

32 GENE EUCARIOTICO Può un gene codificare per diverse proteine? X

33 Uno stesso gene può esprimere proteine con funzioni opposte: l esempio dell attivit attivitàdella Caspasi 9 (CASP9) La forma costitutiva della proteina (CASP9( CASP9,, 9 esoni, 416 aa) induce apoptosi. Essa contiene un Caspase recruitment domain (CARD) e un u dominio caspasi Peptidase_C14. L isoforma più corta della proteina (CASP9S( CASP9S,, 5 esoni, 266 aa) contiene un dominio Caspase recruitment domain (CARD) e un dominio tronco della Peptidase_C14. Questa isoforma èpriva dell attivit attivitàproteasica e agisce da inibitore dell apoptosi.

34 Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere più di un trascritto (ed è quindi soggetto a splicing alternativo). Le diverse isoforme di splicing possono avere specificità a livello di tessuto, di condizione fisiologica, o patologica. 17,635 Human genes >50 Number of Transcripts/ Gene

35 Splicing alternativo e duplicazione genica sono inversamente correlati

36 GENE EUCARIOTICO Può un gene codificare per diverse proteine?

37 Definizione di GENE La trascrizione di un gene si può arrestare in corrispondenza di diversi terminatori Il gene per tp73l codifica per 10 trascritti alternativi,, e utilizza 2 promotori e 3 diversi terminatori della trascrizione

38 I geni possono essere sovrapposti I geni possono essere sovrapposti tra loro, nello stesso orientamento o in orientamento opposto, o anche essere completamente contenuti in altri geni.

39 Geni dentro i geni GENE EUCARIOTICO Geni all interno di altri geni sono descritti per i genomi di organismi semplici e nei mitocondri Nei mammiferi sono descritti geni contenuti nei grandi introni di alcuni geni. A differenza dei genomi piu semplici in questi casi spesso viene utilizzato il filamento opposto al gene canonico Esempio: NF1: introne 26 (40Kb) contiene tre piccoli geni (2 esoni) che vengono trascritti dal filamento opposto

40 Geni dentro i geni GENE EUCARIOTICO NF1 Filamento di senso esone 26 Introne 26 esone Filamento antisenso 3 5 OGMP 2.2KB EVI2B 10 KB EVI2A 4 KB

41 GENE EUCARIOTICO

42 GENE EUCARIOTICO

43 GENE nei virus

44 GENE nei virus Virus a DNA VITA? Virus a RNA

45 GENE nei virus

46 GENE nei virus Geni sovrapposti Met Val proteina b Sequenza di DNA GTTTATGGTA Val Tyr Gly proteina A

47 Il genoma è fatto solo di geni?

48 Il genoma è fatto solo di geni? Anatomia del Genoma Umano

49 Il genoma è fatto solo di geni?

50 Pseudogeni Talvolta la copia di un gene non è funzionale, ovvero non viene trascritta in RNA, o viene trascritta in un RNA non funzionale. Le copie inattive di un gene vengono dette pseudogeni. Gli pseudogeni possono essere classificati in: 1) non processati; ; 2) processati. Nel primo caso il gene inattivo è originato dal gene funzionale e contiene la tipica struttura in esoni ed introni. La copia genica può essere completa o parziale. Gli pseudogeni di questo tipo si formano con maggiore probabilità nelle regioni pericentromeriche. Gli pseudogeni processati sono privi di introni in quanto derivano dalla retrotrasposizione di mrna (retropseudogeni( retropseudogeni). Il numero di copie di retropseudogeni è correlato al livello di espressione del gene da cui derivano.

51 Pseudogeni La Trascrittasi Inversa codificata da elementi LINE può retrotrascrivere un mrna in cdna che successivamente può essere integrato a caso in un cromosoma. Se sul sito di inserimento è casualmente presente un promotore il retrogene può essere eventualmente espresso e diventare funzionale. Normalmente, questo non accade e lo pseudogene comincia ad accumulare mutazioni casuali che distruggono la ORF funzionale (frameshifts, codoni di stop). 51

52 Pseudogeni Nel genoma umano sono stati descritti ~8.000 pseudogeni (~5.000 nel genoma del topo). Il maggior numero di pseudogeni processati deriva da geni per proteine ribosomiali; altri gruppi derivano da geni che codificano per proteine che legano il DNA e l RNA, l per molecole strutturali ed enzimi metabolici. Molti pseudogeni derivano da geni a cui non è stata attribuita una funzione. Oltre al livello di espressione dei geni, altri fattori gene-specifici sono responsabili dell origine degli pseudogeni, quali la lunghezza o il loro contenuto in G+C.

53 Il genoma è fatto solo di geni? Il DNA NON CODIFICANTE RIPETUTO IN TANDEM SATELLITE, tipico delle sequenze centromeriche (a-satellite, monomero di 171 bp) MINISATELLITE, monomero 6-64bp, altamente polimorfico. Utilizzato per esami di fingerprint del DNA. Es.DNA telomerico (TTAGGG) MICROSATELLITE, 2-4 bp ripetuti in tandem. Espansioni di triplette sono responsabili di alcune patologie (Distrofia Miotonica)

54 Microsatelliti e Minisatelliti I microsatelliti sono costituiti da unità di ripetizione lunghe da 1 a 10 pb, ripetute in tandem volte, che formano raggruppamenti molto corti, <150pb, di tipo (A)n, (CA)n, (CGG)n, ecc. Sono anche detti SSR (simple sequence repeats). Le ripetizioni possono essere perfette o presentare piccole variazioni. I minisatelliti sono costituiti da unità più lunghe (da 11 a 100pb) ripetute in tandem volte che formano raggruppamenti di lunghezza fino a 20kb Gli SSR costituiscono circa il 3% del genoma umano. Sono molto importanti nello studio delle malattie genetiche in quanto mostrano un elevato grado di polimorfismo nella popolazione umana. Da: Lander et al. Nature 2001, 409:

55 Gli SSR possono formarsi attraverso un meccanismo di scivolamento della replicazione Gli SSR sono presenti con una frequenza di almeno uno ogni circa 2 kb del genoma. Si originano da vari meccanismi tra cui il più importante è lo scivolamento della DNA polimerasi 55 durante la replicazione.

56 Microsatelliti: Genetic Fingerprint Caratteristiche degli SSRs Polimorfismo di lunghezza: DNA fingerprinting Spesso adoperati come marcatori genetici per la mappatura di geni associati a patologie.

57 Microsatelliti e malattie genetiche I microsatelliti, ed in particolare le ripetizioni di triplette sono associati a varie malattie genetiche

58 Il genoma è fatto solo di geni? Il DNA NON CODIFICANTE INTERSPERSO SINE, brevi elementi nucleari ripetuti (pseudogene processato di RNA7SL) Alu (300bp, copie nel genoma umano) MIR (130bp, copie nel genoma umano) LINE, lunghi elementi nucleari ripetuti (retrotrasposoni) L1 (6,1Kb a lunghezza completa, copie) Retrovirus endogeni, HERV Elementi simili retroviral tronchi, RTLV e LTR Trasposoni a DNA, Mariner

59 Porzione non codificante:ripetizioni intersperse Costituite da sequenze di DNA ripetute, disperse in tutto il genoma. Sono definite anche Elementi mobili del DNA, perché derivano da elementi trasponibili (sequenze di DNA che si muovono o sono duplicate da una posizione ad un altra nel genoma) Classe I o Retrotrasposoni si originano per eventi di retrotrasposizione, attraverso un intermedio ad RNA elementi LTR LINEs: : long interspersed nuclear elements SINEs: : short interspersed nuclear elements Classe II o Trasposoni a DNA si originano attraverso un intermedio a DNA, secondo meccanismo di trasposizione conservativa o replicativa 59

60 Retrotrasposoni La caratteristica di tutti i retrotrasposoni è la presenza di brevi ripetizioni dirette alle estremità 3 e 5 5, copia della sequenza del sito d integrazione. d

61 Ripetizioni Intersperse nel Genoma Umano Gli elementi ripetuti interspersi costituiscono cirva il 45% del genoma umano. LINE (Long interspersed nuclear elements) L1, L2, L3 LINE ( ~21% del genoma, ~100,000 copie) SINE (Short interspersed nuclear elements) Alu (~10,7% del genoma, ~1,200, 000 copie) MIR, MIR3 (~3% del genoma, ~500,000 copie) Elementi LTR (Long Terminal Repeats) ERV, MalR (8% del genoma, ~500,000 copie) Transposoni a DNA MER1 (Charlie), MER2 (Tigger), others (2,8% del genoma, ~350, 000 copie)

62 Elementi LTR Gli elementi LTR o retrotrasposoni virali (6-7kb) presentano analogie con i retrovirus. Caratteristici degli invertebrati (piante, funghi, insetti) dove sono presenti in gran numero di copie env e non Elementi Ty ins. cerevisiae mancano del gene env elementi copia in Drosophila possono formare particelle virali pb

63 LINEs:long interspersed nuclear elements promotore Pol II RNA binding anche endonucleasi ripetizioni dirette Gli elementi LINEs o trasposoni non-ltr hanno una lunghezza di circa 6-7kb, 6 contengono un promotore per l RNA l polimerasi II (derivano da trascritti della l RNA pol II), una o due ORF e un segnale di poliadenilazione all estremit estremità 3. ORF1 codifica per una proteina a funzione ignota ( lega l RNA?), l ORF2 codifica per un enzima che possiede sia un attivit attività di trascrittasi inversa (RT), simile a quella dei retrovirus e dei retrotrasposoni virali, i, che un attivit attività di DNA endonucleasi (EN). Vi sono tre famiglie principali di elementi LINES: L1 (incluse copie tuttora attive e moltissime copie inattive troncate all estremit estremità 5 ); L2 e L3 (inattive). Le copie attive inserendosi in punti critici del genoma possono inattivare dei geni con conseguente insorgenza di patologie. Le LINEs si inseriscono preferibilmente nelle regioni eucromatiche ricche in A+T. 63

64 Meccanismo di trasposizione degli elementi LINEs 1. Generazione di un trascritto LINE full-length length a partire dal promotore. 2. ORF1 e ORF2 vengono tradotte e legano il LINE mrna. orf2 5 orf Il complesso LINE mrna/orf1/orf2 si sposta nel nucleo, dove l attivitl attività endonucleasica di ORF2 taglia il dsdna. L estremitl estremità libera al 3 3 (sul DNA) funge da innesco per la retrotrascrizione a partire dal 3 UTR. 3 5 orf1 orf Il sito di taglio di ORF1 è TTTT A, e questo spiega l integrazione l preferenziale nelle regioni genomiche ricche in AT. Dato che la LINE RT ha una bassa processività molte delle copie integrate sono tronche (solo 1/100 è completa).

65 SINEs: : short interspersed nuclear elements A B AAAA SINE Gli elementi SINEs sono elementi non-autonomi, hanno una lunghezza compresa tra 0.1 e 0.4 kb. Hanno un promotore (interno) per L RNA L polimerasi III (derivano da trascritti della l RNA l pol III), e una regione ricca in A all estremit estremità 3 ma non contengono un segnale di poliadenilazione. Gli elementi SINEs non contengono alcuna ORF codificante per una a trascrittasi inversa, ma sono in grado di trasporre utilizzando la trascrittasi si inversa sintetizzata da altri retroelementi (trasposizione( LINEs-dipendente dipendente).

66 SINEs: : short interspersed nuclear elements Gli elementi SINEs sono distribuiti ad alta densità nelle regioni ricche in CG del genoma (isocore H), perché hanno un più elevato contenuto C+G (~57%) rispetto agli elementi LINEs ( 40%). Nel genoma dei primati sono presenti tre differenti famiglie di elementi SINEs: l elemento Alu,, ancora attivo, e gli elementi inattivi MIR e Ther2/MIR3. L elemento Alu, il più comune nei primati, è lungo 0,3kb; è presente in circa di copie nel genoma umano e rappresenta quindi oltre il 10% di tutto il genoma. Presenta una regione ricca in A/T all estremit estremità 3,, coinvolta nel meccanismo di retrotrasposizione. Le sequenze Alu sono localizzate a monte o a valle dei geni, negli introni, nelle regioni 5 5 e 3 3 non tradotte dell mrna. Non è noto il loro ruolo funzionale, nonostante siano molto diffuse nel genoma di tutti i primati. Le sequenze Alu presentano analogie con l RNA l 7SL, componente di una particella ribonucleoproteica coinvolta nel meccanismo di secrezione dei polipeptidi di nuova sintesi attraverso le membrane del reticolo endoplasmatico. Si ritiene che il primo elemento Alu si è originato per un evento di retrotrascrizione di una molecola di RNA 7SL e successiva integrazione della copia nel genoma.

67 Meccanismo di retroposizione dell elemento elemento Alu Si pensa che il taglio al sito di inserimento sia opera della L1 endonucleasi Target-primed reverse transcription (TPRT) Il promotore pol III è necessario ma non sufficiente per la trascrizione che richiede anche sequenze fiancheggianti appropriate. La maggior parte degli elementi Alu integrati non è attiva in quanto non viene integrata in un contesto favorevole e muta rapidamente sia nelle sequenze CpG che nella regione ricca in A.

68 Evoluzione e classificazione degli elementi Alu Gli elementi Alu sono classificati in sottofamiglie che si differenziano per l epoca l della loro integrazione nel genoma, dalle più antiche (Sx, J) alle più recenti (Yc1, etc.). da: Batzer and Deininger, Nature Rev. Gen. 3:370380, 2002)

69 Danni genomici indotti da Alu Numerose patologie sono provocate dall'integrazione casuale di Alu A (Neurofibromatosi, haemophilia, sindrome di Apert, ecc.) o da ricombinazione disuguale (diabete di tipo II, sindrome di Lesch Nyhan, malattia di Tay Sachs, ipercolesterolemia familiare, α-thalassaemia, ecc.). 69

70 Trasposoni a DNA I Trasposoni a DNA sono elementi mobili distinti in due categorie: e: Trasposoni a DNA che si spostano replicandosi: una copia rimane nel sito originale, mentre la nuova copia si inserisce altrove nel genoma Trasposoni a DNA che si spostano in maniera conservativa, da un sito all altro altro del genoma senza aumentare il numero di copie Sono caratterizzati da una sequenza codificante la trasposasi contenente introni, fiancheggiata da ripetizioni terminali invertite, simili a quelle e dei trasposoni batterici. Sono meno comuni negli eucarioti (3% nel genoma umano, raggruppati in 7 classi principali) rispetto ai retrotrasposoni. I più noti sono gli Elementi Ac e Ds del granturco, i primi elementi mobili identificati negli anni 50 da B. McClintock e gli elementi P di Drosophila. Traspongono T mediante il meccanismo di trasposizione conservativa 70

71 Funzione degli elementi ripetuti Punti caldi per ricombinazione (duplicazioni, inversioni, traslocazioni; creazione di nuovi geni per shuffling esonici) Alterazione della espressione genica in quanto portatori di segnali trascrizionali (es. promotori e enhancer di LTR; promotori di Alu; siti di terminazione deboli della trascrizione di elementi L1; segnali di d poliadenilazione) Presenza in geni per proteine (Le Alu contengono siti criptici di splicing; fonte di domini proteici; contributo a variabilità delle proteine) Reclutamento come elementi regolatori (es. BC200 di primati deriva da Alu monomerica) Fonte di pseudogeni processati (ritorno in vita come lunghi esoni? Come nuovi geni? ) Fonte di plasticità del genoma e quindi ruolo attivo nel rimodellamento genomico (riarrangiamenti cromosomici, reshuffling di geni, etc)

72 Qual è l origine di tutto questo? Come si sono evoluti i genomi?

73 Origine ed evoluzione dei genomi

74 Origine ed evoluzione dei genomi Mondo a RNA Nascita di molecole autoreplicanti

75 Origine ed evoluzione dei genomi Mondo a RNA Protogenomi a RNA Compartimentalizzazione all interno di membrane lipidiche Prime strutture di tipo cellulare

76 Origine ed evoluzione dei genomi Come si è evoluto il genoma a DNA? Nascita di enzimi proteici

77 Origine ed evoluzione dei genomi Come si è evoluto il genoma a DNA? Trasferimento della funzione codificante dall RNA al DNA (chimicamente piu stabile)

78 Origine ed evoluzione dei genomi Primi Genomi a DNA (3,8 miliardi di anni fa) Ogni molecola di DNA rappresenta un singolo gene che codifica per una singola proteina singolo gene singola proteina

79 Origine ed evoluzione dei genomi Acquisizione di nuovi geni 1. Duplicazione di alcuni o tutti i geni del genoma 2. Acquisizione di geni da altre specie

80 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di un intero genoma Genoma duplicato

81 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Crossing-over disuguale Scambio disuguale tra cromatidi fratelli

82 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Gene A1 Duplicazione Gene A1 Gene A2 Pressione selettiva Nessuna pressione selettiva Gene A1 Gene B Divergenza Nuova funzione o Funzione simile

83 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Famiglie geniche

84 EVOLUZIONE DEI GENI

85 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Riarrangiamento genico Duplicazione dei domini Rimescolamento di domini

86 Origine ed evoluzione dei genomi Acquisizione di nuovi geni ESONI = MOTIVI PROTEICI MOTIVI N α β β α β β α β C Proteina Gene ESONI

87 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Acquisizione di geni da altre specie Il trasferimento di geni tra batteri è un fenomeno comune in natura che avviene ancora oggi I retrovirus sono capaci di spostare geni animali tra individui della stesse specie e tra specie diverse

88 EVOLUZIONE DEI GENI Maria C. Rivera & James A. Lake The ring of life provides evidence for a genome fusion origin of eukaryotes NATURE VOL SEPTEMBER 2004

89 Origine ed evoluzione dei genomi INTRONI? UN MISTERO 1. IPOTESI INTRONI ANTICHI: gli introni sono molto antichi e si stanno gradualmente perdendo nei genomi degli eucarioti 2. IPOTESI INTRONI RECENTI: gli introni si sono evoluti di recente e si stanno gradualmente accumulando nei genomi degli eucarioti

90 Origine ed evoluzione dei genomi INTRONI? UN MISTERO Teoria esonica dei geni

91 Origine ed evoluzione dei genomi INTRONI? UN MISTERO Le evidenze attuali non inficiano alcuna ipotesi

92 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI

93 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI Uomo Scimpanzè= 98,5% di omologia

94 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI Che cosa ci rende diversi dalle scimmie?

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina

Dettagli

Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta

Dettagli

GENI GENOMI e GENOMICA

GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Seconda lezione 2009: GENOMA UMANO e sua organizzazione

Seconda lezione 2009: GENOMA UMANO e sua organizzazione DIAGNOSTICA MOLECOLARE E GENETICA MEDICA Seconda lezione 2009: GENOMA UMANO e sua organizzazione Prof. Massimo Zollo E-mail : massimo.zollo@unina.it Riceve il venerdi dalle 15:00 alle 16:00 Libri da consultare:

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da

Dettagli

Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,

Dettagli

La ricombinazione del DNA

La ricombinazione del DNA La ricombinazione del DNA Ricombinazione omologa I modelli di Halliday e di Meselson-Redding. Il complesso RecBCD genera il filamento di DNA invasore. La proteina RecA promuove lo scambio dei filamenti

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.it Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra

Dettagli

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

Elementi ripetuti del Genoma Umano. Milioni di anni

Elementi ripetuti del Genoma Umano. Milioni di anni Elementi ripetuti del Genoma Umano Patologia Milioni di anni Evoluzione Un gene è duplicato Un gene è riarrangiato Genoma Il Genoma è l intero DNA contenuto in una Cellula Geni Sequenze Intergeniche Sequenze

Dettagli

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI

CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI CORSO DI AGGIORNAMENTO PER GLI INSEGNANTI DELLE SCUOLE MEDIE SUPERIORI INGEGNERIA GENETICA E SUE APPLICAZIONI mercoledì 5 maggio 2004 La regolazione dell'espressione genica prof. Giovanna Viale - Università

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione

Dettagli

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1)

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1) CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi http://hyperphysics.phy astr.gsu.edu/hbase/biology/ribosome.html http://www.accessexcellence.org/rc/vl/gg/ecb/ecb_images/01_24_organelles.jpg

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

LA TRADUZIONE E IL CODICE GENETICO

LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Genoma Umano 3200 Mb. Codificante 10% Ripetuto in tandem Altamente ripetuto. Satellite

Genoma Umano 3200 Mb. Codificante 10% Ripetuto in tandem Altamente ripetuto. Satellite Genoma Umano 3200 Mb Geni e sequenze gene-associate 25% DNA extragenico 75% Non codificante 90% Codificante 10% DNA unico e a basso numero di copie 60% DNA ripetitivo 40% Regioni spaziatrici Introni Seq.

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione

Dettagli

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare

Insegnamento di Genomica. Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare Insegnamento di Genomica Corsi di Laurea Specialistica in: Biotecnologie Agro-industriali Biologia Molecolare e cellulare docenti: Silvia Fuselli (fss@unife.it) Vincenza Colonna Inga Prokopenko Morena

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Citosol Ribosomi Sintesi proteica

Citosol Ribosomi Sintesi proteica CITOSOL (1) Citosol Ribosomi Sintesi proteica Biotecnologie_2012 Tutta la porzione non strutturata che costituisce la parte liquida del citoplasma. In esso si trovano in soluzione tutte le molecole necessarie

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

RNA 29/10/2014. Struttura chimica del RNA

RNA 29/10/2014. Struttura chimica del RNA I Nucleotidi Hanno Tre Componenti Solo DNA Solo RNA Acidi nucleici RNA http://www.uic.edu/classes/phys/phys461/phys450/anjum04/ Struttura chimica del RNA http://www.ncbi.nlm.nih.gov/b ooks/nbk26887/figure/a978/?

Dettagli

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura

Indice generale. Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura Indice generale Prefazione all edizione americana Prefazione all edizione italiana Ringraziamenti dell Editore Guida alla lettura PARTE 1 Introduzione XIII XIV XV XVI CAPITOLO 1 Brevi cenni storici 1.1

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

DNA - DENATURAZIONE E RIASSOCIAZIONE

DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei

Dettagli

Bioinformatica e Biologia Computazionale per la Medicina Molecolare

Bioinformatica e Biologia Computazionale per la Medicina Molecolare Facoltà di Ingegneria dell Informazione Laurea Specialistica e Magistrale in Ingegneria Informatica Facoltà di Ingegneria dei Sistemi Laurea Magistrale in Ingegneria Biomedica Dipartimento di Elettronica

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA CORSO INTEGRATO di Genetica e Biologia Molecolare GENETICA a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA Dott.ssa Elisabetta Trabetti POLIMORFISMO La presenza nella popolazione di due

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO

Dettagli

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione

Dettagli