STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI"

Transcript

1 STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI

2 Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries information from one generation to the next. In molecular terms, it is the entire DNA sequence (including exons, introns and noncoding transcriptional control regions) necessary for production of a functional protein or RNA

3 ATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGATGGAGGAGGACATGTACGTGGACATTTTCCTGGACCCTTATACCTTCCAGGATGACTTTCCTCCAGCTACGTCTCAAC TATTCAGCCCAGGAGCGCCTTTAGATGTGCACCCACTTAATCCATCCAATCCAGAGACTGTATTTCATTCACATCTTGGTGCAGTCAAAAAGGCACCCAGTGACTTTTCATCTGTGGATCTAAGCTTCTT ACCAGATGAACTTACCCAAGAAAATAAAGACCGAACTGTCACTGGAAACAAAGTCACAAATGAGGAAAGCTTTAGGACTCAAGATTGGCAAAGTCAGTTGCAGTTGCCTGATGAACAAGGCAGTGGG CTGAACTTGAATAGCAACAGTTCACCAGATACCCAGTCATGTCTGTGCTCTCATGATGCTGACTCCAACCAGCTCTCTTCAGAAACACCAAATTCCAATGCCTTACCTGTGGTATTGATATCATCCATGA CACCAATGAACCCTGTTACAGAATGTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCTTTGAATGCCAAAAACACAGAATATA ATCCAAAGAGGTTTGCTGCAGTCATAATGAGGATCCGAGAGCCAAGGACCACAGCTCTTATATTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGACGAGTCTCGGCTGGCAGCAAGA AAGTATGCTCGCGTGGTGCAGAAGCTGGGGTTCCCCGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGCAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGC AGTTCAGTAGTTATGAGCCTGAACTGTTCCCTGGCCTTATTTATAAGATGGTGAAACCGCAGGTTGTGCTGCTCATCTTTGCATCTGGAAAGGTTGTACTGACAGGTGCCAAAGAGCGTTCTGAGATCTA CGAAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGGAGGACATATACCTGGACCTCTTCCTGGATCCTTATACCATCCAGGATGACTTTCCTCCAGCTATGTCTCAA CTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACC AGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTG AACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGC CAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGAATGTAGTTTCCACTGCAAATCTGGCCTGTAAATTGGATCTGAGAAAAATAGCCCTGAATGCCAAAAACACAGAATATAACC CAAAGAGGTTTGCTGCAGTAATAATGAGGATCCGAGAGCCAAGGACAACAGCTCTCATCTTTAGCTCTGGGAAAGTGGTCTGTACAGGAGCCAAAAGTGAAGAGGAGTCTCGGCTGGCAGCGAGAAA GTATGCTCGTGTGGTGCAGAAGCTCGGGTTCCCTGTCAGATTCTTCAATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAAATTTCCCATCAGGCTGGAGATTTTGGCACTAACCCATCGGCAG TTCAGTAGTTATGAACCTGAACTTTTCCCCGGCCTTATTTATAAGATGGTAAAACCACAGGTTGTGTTGCTAATCTTTGCATCTGGAAAAGTTGTGTTAACAGGTGCCAAAGAGCGTTCTGAGATCTATG AAGCATTTGAAAACATGTATCCTATTCTAGAAAGTTTTAAGAAAGTCTGAATGGAGCAGGAGGAGACCTACCTGGAGCTCTACCTGGACCAGTGCGCCGCTCAGGATGGCCTTGCCCCACCCAGGTCTC CCCTGTTCAGCCCAGTTGTACCTTATGATATGTACATACTGAATGCATCCAATCCGGATACTGCATTTAATTCGAACCCTGAAGTCAAAGAAACATCTGGTGATTTCTCATCTGTGGATCTTAGCTTCCTA CCAGATGAAGTTACCCAGGAAAATAAAGACCAGCCTGTCATTAGCAAACACGAAACTGAAGAAAATTCTGAAAGCCAAAGTCCACAAAGTAGGTTGCCATCACCCAGCGAACAGGACGTTGGGCTGG GCTTAAACAGCAGCAGTTTGTCAAATTCCCATTCACAGCTGCACCCTGGTGATACTGACTCAGTCCAGCCCTCTCCTGAGAAACCAAACTCCGACTCCTTGTCTCTGGCATCCATAACTCCCATGACACC AATGACCCCTATTTCAGAATGTTGTGGAATTGTACCTCAACTACAGAATATAGTTTCCACTGTAAACCTGGCCTGTAAGTTGGATCTGAAGAAAATAGCTTTGCATGCAAAAAATGCAGAATATAACCC AAAGAGGTTTGCTGCTGTCATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAAT ATGCTCGTGTGGTGCAGAAGCTTGGGTTCCCTGCCAGATTCCTCGATTTTAAAATTCAGAACATGGTTGGAAGCTGTGATGTGAGATTTCCCATCAGGCTGGAAGGTTTGGTGCTAACCCATCAGCAGTT CAGTAGTTACGAGCCTGAACTGTTTCCTGGTCTTATTTATAGAATGGTAAAACCACGAATTGTGTTGCTTATCTTTGTATCTGGAAAAGTTGTGTTGACAGGTGCCAAAGAACGTTCTGAGATCTATGAA GCATTTGAAAACATCTATCCTATTCTAAAAGGTTTTAAAAAAGCCTGAGAAGTCCCCTGGGTAACTTCCAGGCAGCTTCATTTCTGAAGAGTCCAAACTGCAGCATAGAGGACTTATGAAAAACTGTAA AAAATTGGTTTTAAGTGTTCCATTAAACCCAAAGAAAACAGTCACACAACAAAGCCAGACACAGAAAATTAGGGTGACATGTTTCCTGTCATATGTGGAGCCTAGAGAACATAGAGATGATGTGAAAG CAGAAGGAGCTATCAAGAAAAAGGAAAGCAGATGGGGCAGCAGATCCATGGGAATACTGGCAGAACTGTATAATGGAAGAATGTCGTATGCACATATGAACATGTCATAATGAAACCTAGTATTTTGT ACAGTTAATATGGACTAGACAATAGCACAAAGAAATTAGAGATTAGTCTAGCTATATGAAGAGGCTACATCAAAGATCACTCCTTTTTGATGGACAAATTTAATTCCTTATAACTGTAGAGCTGAGATA TTCACTTGCTTGTCAGACATTAAATGTATCCCACTCTTAGGGTCTAGAAGTTACCCAGACTTCTTGTACCATGGTCCCATCTATCTTCAAAGTCAGCAGTGACGACTCTGCCTTATGACAAGGTCATCTCC TGCTTTCAAATCCCTCCCAAAGAGTGGCCAATTCCTCCTTGGCTGCTCAGTCAGTAAGGGCAGGCTTGGATCCTTTCCCTTTCCTAACAATGGACTTGGAATTTTAATTACATCTTCAAAACCCAAGAGC ATTTGGTTTTTTTTAGATAACTGGGAGATACATTTGGAGATAGGGATTTGGGGAGCCACCGAAACATTCTACCTACCATAGGAAATAGTTATAAATCTATTTTACTGGCTGGAGAGATGGCCAAGCAGTT AAGAATACTTTCTGCTTTTTCAAAGGATAGAAATTCTGTTCCTAGCACCCACACTGGGCTTCTTAGTGATTCCAACTCTACAGGACCTGATGCCTCCTTCTCTCTGGCTTCCTTAGATACCAGTTTGTACT GGCACATGCATATGCACAGGAGAAGGCTCTCTCTCTCTCTCTCCCCCCCCCCCCTCTCTCTCTCTCACACACACACACAAGATGGTGAGATATAATTAATAAAATAAAGTAAAATTTGGATCTGTTTTAG TCAGTTTGGGATGCCATAATAAAACACCACAAACTGGGCAGTTTAAACCACAGAAATTTCCTTCATAGTTCTGAAGGCTGGAGATCTAAGATCAAGGTCCCTGCAGATTTGGTCTCTCCTGTAGCAATC CTCCATCTTTCCTTTTAGGTAGCTGCCTTAATGTTGCTCTTTTTACAGCTTTTTCTTTGTATTTCTATGAAAACATCAGACATATTGGATTGGGGCTTCTACACATGATCTTCATGGGATAAGCAATAACCA TAGTTACTGATCTGTGAGGCTGGTTCTGAGTGTGCAGCTCAGTAGGCTGTCTCATTTACAGACACTATGACATTACATCACACATCACTATATAAATCCCAGATTTTTCAAAAGGATCCCCCTATTTTTAT TGGAATGTCTGACTCTAGTGCAGGTTATCCAAGCTCCATTCTCAGGTTCGTTTTATCCACCAAGACTGAGCAGATGAGCTGGGCACAGAGACATGATGATGAATAATTTAAATTGTTCCTTTTAAACAGT AGAATCAAGTAAGGAAGATTTAAAAATACATTTTGCAATCTCTTACATCAAAGTGTCTTCTTCTAGAACAGTTCAATACAGTTAAGCTAAGACATTTGAATTAAAGCGTTTAAGAAAGAAAAGCTTCTCT GGATATTTGGTTTTACATTAACTTCTTGAGTTGTCTGAACCCTAACTGTGGAATTTGCACAGCTGTAGGCAAATTCTCTGTAATAGGTGAAAATCTACCTGGGGTGTGAAGGTGAAGAATAATTACAGAA ATATCACATCTGAATAGATGAGGGGATTCAGCGGGCAAGGGTGCTTGCCACCAAGCCTGACACTCTGGGTTTGATCCTTGTGTTTCTTCCAGAGCTGGAAGGAGAGAACCTACTCCTGAAAATTGTCTT CTGACCATAACATGAGCTCTGCACTGTGCATGTGTCCATGCACACATGCCAATGAAGATAAATCAATATTAGAAATATCACATCTAAGAATCTGGGTATGGTGATGCTCATGCATGTTGTAACCCCAGA ACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAGGGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGGAAAAGGATAAGGATAAAGGCAGAAGAGA AAAGCATTCTTTTCTCACTTGCACAATGAGAAAACCTTATCATGCTACTCTACTGGAAGCACTAGTCTCGGCCCTCCTCTTCTTCTGGGTGCCACCAGCTGTGTCTTGCCTGGCTCATCAACTCCTTCTCT GCTTCTCACCTGACTCCTCAGCTCATTCACAGCATCTGTGCAAGGCAGCAGAGCTGGTCCCGCCTCACTGCGTGCTCCCTGAGGCTGATAAAAGGTATCTGCTCCCACAGCCAGACTGGTACTAACAAA GCTTCTTCCACTTGCCTGGACGCTGATTCCTTTGCTTGTCCTCAGCTCTACGATGACTTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGA GACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATCTGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCT GGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCGATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATG ATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGGCATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAGATGAC TTTCCTCCAGCTATGTCTCAACTGTTCAGCCCAGGAGTGCCTTTAGACATGCACTCACTTCCATCTAATCCAGAGACTGTGTTTCATCCACATCTTGGTGGAGTCAAAAAGGCATCCACTGACTTTTCATC TGTGGATCTAAGCTTCTTACCAGATGAACTTACCCAAGAAAATAGAGACCAAACTGTCACTGGAAACAAGCTGGCAAGTGAGGAAAGCTGTAGGACTCGAGATCGACAAAGTCAGTTGCAGTTGCCCG ATGAACATGGCAGTGAGCTGAACTTGAATAGCAACAGTTCACCAGATCCCCAGTCATGCCTGTGCTTTGATGATGCTCACTCCAACCAGCCCTCTCCAGAAACACCAAACTCCAATGCCTTACCTGTGG CATTGATAGCATCCATGATGCCAATGAACCCTGTTCCAGGATTTTCTGGAATTGTGCCTCAATTACAAGAACTTAGGAGCTGGAGGATATACAAGTTTGTGGCTAGCCTGGACTACATGAGAAGAGAAG GGGGAAGGGAAAGAGAAGGAAAAGAAGAAAAGAAAAGATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTC TCGACTTGCAGCAAGAAAATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAA ATATAATGAGGATCCGAGAGCCCAGGACAACAGCCCTTATATTTAGCTCTGGGAAGATGGTCTGCACGGGAGCCAAAAGTGAAGAGCAGTCTCGACTTGCAGCAAGAAAATATAATGAGGATCCGAG

4 Struttura del GENE

5 GENE procariotico Genoma di E. coli

6 GENE procariotico OPERONE Sequenze regolatrici a monte Sequenze codificanti Sequenze terminatrici della sequenza codificante

7 GENE procariotico animazione

8 GENE procariotico Promotori

9 GENE procariotico Sequenze codificanti ORF (Open Reading Frame) ATGGTATAT TAA MET VAL TYR STOP

10 GENE procariotico Promotore A B C Operone Sequenze codificanti Terminatore

11 GENE procariotico Promotore A B C Operone Sequenze codificanti Terminatore mrna mrna mrna Proteina Proteina Proteina

12 GENE procariotico Repressione Promotore A B C Operone Sequenze codificanti Terminatore Nessuna espressione

13 GENE EUCARIOTICO GENI DELLA I CLASSE RNA RIBOSOMIALE rrna (28S-5,8S e 18s) GENI DELLA II CLASSE RNA MESSAGGERO mrna Piccoli RNA nucleari snrna microrna - LncRNA GENI DELLA III CLASSE RNA TRANSFER trna Piccoli rna nucleolari snorna Piccoli rna citoplasmatici - scrna

14 GENE EUCARIOTICO

15 GENE EUCARIOTICO

16 GENE EUCARIOTICO

17 GENE EUCARIOTICO

18 GENE EUCARIOTICO

19 Promotore GENE EUCARIOTICO

20 Promotore GENE EUCARIOTICO

21 Sequenza codificante modulare GENE EUCARIOTICO

22 GENE EUCARIOTICO Segnale di poliadenilazione

23 Organizzazione genica negli eucarioti I geni eucariotici sono monocistronici Eccezioni: Unità di trascrizione policistroniche risolte in mrna maturi monocistronici per trans-splicing splicing (es in tripanosomi, nematodi, platelminti); uso di IRES, reinizio della traduzione o frameshift traduzionale I geni eucariotici non mostrano nessuna evidente relazione tra localizzazione e l attivitl attività funzionale (functional clustering) o con l espressione l spazio- temporale Eccezioni: Raggruppamento di geni con funzione correlata, quali geni Hox, geni per emoglobine e geni per immunoglobuline (duplicazioni i in tandem?) 23

24

25 Organizzazione genica negli eucarioti Alcuni geni eucariotici sono policistronici Taxon Tripanosomi (Euglenozoa) Cnidari Platelminti (Metazoa Acoelomata) Nematodi (Metazoa Pseudocoelomata) Ciona intestinalis/oikopleura dioica Entità tutti gli RNA alcuni RNA pochi RNA molti RNA molti RNA Il processamento del precursore policistronico è associato al Trans Splicing delle estremità 5 degli mrna e alla poliadenilazione delle estremità 3 per generare i trascritti monocistronici. 25

26 Geni codificanti per proteine - geni presenti in unica copia (single( single-copy genes) - geni omologhi presenti in copie multiple ed organizzati in famiglie geniche I membri di una stessa famiglia genica possono essere localizzati i in unico cluster, dispersi, o localizzati in più cluster: Geni in cluster: α-globin (7), growth hormone (5), Class I HLA heavy chain (20),. Geni dispersi: Pyruvate dehydrogenase (2), Aldolase (5), PAX (>12),.. Geni localizzati in più cluster: HOX (38 4), Histones (61 2), Olfactory receptors (>900 25), 26

27

28 La struttura dei geni eucariotici Nel genoma umano non si osserva una distribuzione omogenea dei geni. La più alta densità genica si osserva nel chr 19, mentre il chr 13 e Y mostrano la più bassa densità. GENE esone introne esone introne esone TSS TRASCRIZIONE 5 UTR mrna CDS 3 UTR TRADUZIONE Caratteristiche dei geni umani Mediana Media Numero di esoni 7 8,8 L introni (bp) L 5'UTR (bp) L CDS (bp) L 3'UTR (bp) L gene (bp)

29 La struttura dei geni eucariotici I geni eucariotici presentano una grande varietà di strutture e dimensioni. Ad esempio nel genoma umano: Il più piccolo: trna GLU (69 bp) Il più grande: Distrofina (2.4 Mb, la sua trascrizione richiede circa 16h) Il numero di esoni può variare da 1 (geni privi di introni come molti geni per ncrna, interferoni, istoni, ribonucleasi, HSP, GPCR, ecc.) sino a 363 (Titina). Le dimensioni degli esoni e degli introni sono estremamente variabili. abili. A fronte di esoni costituiti da pochi nucleotidi, l esone l più grande è presente nel gene per ApoB (7.6 kbb). Anche le dimensioni degli introni possono variare da pochi nucleotidi fino a 800 kbp (gene WWOX). Le proteine codificate possono variare nelle dimensioni da pochi residui (piccoli ormoni) sino a molte migliaia (Titina( Titina,, aa). 29

30 GENE EUCARIOTICO Può un gene codificare per diverse proteine?

31 Uno stesso gene può codificare per proteine indirizzate a diversi compartimenti cellulari: l esempio l del gene NFS1 La proteina codificata dal gene NFS1 rimuove lo zolfo dalla cisteina formando alanina. Questo gene utilizza siti di inizio alternativi della trascrizione e quindi traduzione e per generare una isoforma mitocondriale ed una isoforma citoplasmatica. La selezione del sito di inizio della la traduzione è regolata dal ph citosolico. L isoforma che codifica per la proteina mitocondriale (457 aa) contiene un peptide segnale e un dominio aminotrasnferasico. L altra isoforma, che deriva sa un sito di inizio alternativo della a trascrizione codifica per una proteina piùcorta (397 aa) priva del peptide segnale ma contenente il dominio aminotransferasico.

32 GENE EUCARIOTICO Può un gene codificare per diverse proteine? X

33 Uno stesso gene può esprimere proteine con funzioni opposte: l esempio dell attivit attivitàdella Caspasi 9 (CASP9) La forma costitutiva della proteina (CASP9( CASP9,, 9 esoni, 416 aa) induce apoptosi. Essa contiene un Caspase recruitment domain (CARD) e un u dominio caspasi Peptidase_C14. L isoforma più corta della proteina (CASP9S( CASP9S,, 5 esoni, 266 aa) contiene un dominio Caspase recruitment domain (CARD) e un dominio tronco della Peptidase_C14. Questa isoforma èpriva dell attivit attivitàproteasica e agisce da inibitore dell apoptosi.

34 Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere più di un trascritto (ed è quindi soggetto a splicing alternativo). Le diverse isoforme di splicing possono avere specificità a livello di tessuto, di condizione fisiologica, o patologica. 17,635 Human genes >50 Number of Transcripts/ Gene

35 Splicing alternativo e duplicazione genica sono inversamente correlati

36 GENE EUCARIOTICO Può un gene codificare per diverse proteine?

37 Definizione di GENE La trascrizione di un gene si può arrestare in corrispondenza di diversi terminatori Il gene per tp73l codifica per 10 trascritti alternativi,, e utilizza 2 promotori e 3 diversi terminatori della trascrizione

38 I geni possono essere sovrapposti I geni possono essere sovrapposti tra loro, nello stesso orientamento o in orientamento opposto, o anche essere completamente contenuti in altri geni.

39 Geni dentro i geni GENE EUCARIOTICO Geni all interno di altri geni sono descritti per i genomi di organismi semplici e nei mitocondri Nei mammiferi sono descritti geni contenuti nei grandi introni di alcuni geni. A differenza dei genomi piu semplici in questi casi spesso viene utilizzato il filamento opposto al gene canonico Esempio: NF1: introne 26 (40Kb) contiene tre piccoli geni (2 esoni) che vengono trascritti dal filamento opposto

40 Geni dentro i geni GENE EUCARIOTICO NF1 Filamento di senso esone 26 Introne 26 esone Filamento antisenso 3 5 OGMP 2.2KB EVI2B 10 KB EVI2A 4 KB

41 GENE EUCARIOTICO

42 GENE EUCARIOTICO

43 GENE nei virus

44 GENE nei virus Virus a DNA VITA? Virus a RNA

45 GENE nei virus

46 GENE nei virus Geni sovrapposti Met Val proteina b Sequenza di DNA GTTTATGGTA Val Tyr Gly proteina A

47 Il genoma è fatto solo di geni?

48 Il genoma è fatto solo di geni? Anatomia del Genoma Umano

49 Il genoma è fatto solo di geni?

50 Pseudogeni Talvolta la copia di un gene non è funzionale, ovvero non viene trascritta in RNA, o viene trascritta in un RNA non funzionale. Le copie inattive di un gene vengono dette pseudogeni. Gli pseudogeni possono essere classificati in: 1) non processati; ; 2) processati. Nel primo caso il gene inattivo è originato dal gene funzionale e contiene la tipica struttura in esoni ed introni. La copia genica può essere completa o parziale. Gli pseudogeni di questo tipo si formano con maggiore probabilità nelle regioni pericentromeriche. Gli pseudogeni processati sono privi di introni in quanto derivano dalla retrotrasposizione di mrna (retropseudogeni( retropseudogeni). Il numero di copie di retropseudogeni è correlato al livello di espressione del gene da cui derivano.

51 Pseudogeni La Trascrittasi Inversa codificata da elementi LINE può retrotrascrivere un mrna in cdna che successivamente può essere integrato a caso in un cromosoma. Se sul sito di inserimento è casualmente presente un promotore il retrogene può essere eventualmente espresso e diventare funzionale. Normalmente, questo non accade e lo pseudogene comincia ad accumulare mutazioni casuali che distruggono la ORF funzionale (frameshifts, codoni di stop). 51

52 Pseudogeni Nel genoma umano sono stati descritti ~8.000 pseudogeni (~5.000 nel genoma del topo). Il maggior numero di pseudogeni processati deriva da geni per proteine ribosomiali; altri gruppi derivano da geni che codificano per proteine che legano il DNA e l RNA, l per molecole strutturali ed enzimi metabolici. Molti pseudogeni derivano da geni a cui non è stata attribuita una funzione. Oltre al livello di espressione dei geni, altri fattori gene-specifici sono responsabili dell origine degli pseudogeni, quali la lunghezza o il loro contenuto in G+C.

53 Il genoma è fatto solo di geni? Il DNA NON CODIFICANTE RIPETUTO IN TANDEM SATELLITE, tipico delle sequenze centromeriche (a-satellite, monomero di 171 bp) MINISATELLITE, monomero 6-64bp, altamente polimorfico. Utilizzato per esami di fingerprint del DNA. Es.DNA telomerico (TTAGGG) MICROSATELLITE, 2-4 bp ripetuti in tandem. Espansioni di triplette sono responsabili di alcune patologie (Distrofia Miotonica)

54 Microsatelliti e Minisatelliti I microsatelliti sono costituiti da unità di ripetizione lunghe da 1 a 10 pb, ripetute in tandem volte, che formano raggruppamenti molto corti, <150pb, di tipo (A)n, (CA)n, (CGG)n, ecc. Sono anche detti SSR (simple sequence repeats). Le ripetizioni possono essere perfette o presentare piccole variazioni. I minisatelliti sono costituiti da unità più lunghe (da 11 a 100pb) ripetute in tandem volte che formano raggruppamenti di lunghezza fino a 20kb Gli SSR costituiscono circa il 3% del genoma umano. Sono molto importanti nello studio delle malattie genetiche in quanto mostrano un elevato grado di polimorfismo nella popolazione umana. Da: Lander et al. Nature 2001, 409:

55 Gli SSR possono formarsi attraverso un meccanismo di scivolamento della replicazione Gli SSR sono presenti con una frequenza di almeno uno ogni circa 2 kb del genoma. Si originano da vari meccanismi tra cui il più importante è lo scivolamento della DNA polimerasi 55 durante la replicazione.

56 Microsatelliti: Genetic Fingerprint Caratteristiche degli SSRs Polimorfismo di lunghezza: DNA fingerprinting Spesso adoperati come marcatori genetici per la mappatura di geni associati a patologie.

57 Microsatelliti e malattie genetiche I microsatelliti, ed in particolare le ripetizioni di triplette sono associati a varie malattie genetiche

58 Il genoma è fatto solo di geni? Il DNA NON CODIFICANTE INTERSPERSO SINE, brevi elementi nucleari ripetuti (pseudogene processato di RNA7SL) Alu (300bp, copie nel genoma umano) MIR (130bp, copie nel genoma umano) LINE, lunghi elementi nucleari ripetuti (retrotrasposoni) L1 (6,1Kb a lunghezza completa, copie) Retrovirus endogeni, HERV Elementi simili retroviral tronchi, RTLV e LTR Trasposoni a DNA, Mariner

59 Porzione non codificante:ripetizioni intersperse Costituite da sequenze di DNA ripetute, disperse in tutto il genoma. Sono definite anche Elementi mobili del DNA, perché derivano da elementi trasponibili (sequenze di DNA che si muovono o sono duplicate da una posizione ad un altra nel genoma) Classe I o Retrotrasposoni si originano per eventi di retrotrasposizione, attraverso un intermedio ad RNA elementi LTR LINEs: : long interspersed nuclear elements SINEs: : short interspersed nuclear elements Classe II o Trasposoni a DNA si originano attraverso un intermedio a DNA, secondo meccanismo di trasposizione conservativa o replicativa 59

60 Retrotrasposoni La caratteristica di tutti i retrotrasposoni è la presenza di brevi ripetizioni dirette alle estremità 3 e 5 5, copia della sequenza del sito d integrazione. d

61 Ripetizioni Intersperse nel Genoma Umano Gli elementi ripetuti interspersi costituiscono cirva il 45% del genoma umano. LINE (Long interspersed nuclear elements) L1, L2, L3 LINE ( ~21% del genoma, ~100,000 copie) SINE (Short interspersed nuclear elements) Alu (~10,7% del genoma, ~1,200, 000 copie) MIR, MIR3 (~3% del genoma, ~500,000 copie) Elementi LTR (Long Terminal Repeats) ERV, MalR (8% del genoma, ~500,000 copie) Transposoni a DNA MER1 (Charlie), MER2 (Tigger), others (2,8% del genoma, ~350, 000 copie)

62 Elementi LTR Gli elementi LTR o retrotrasposoni virali (6-7kb) presentano analogie con i retrovirus. Caratteristici degli invertebrati (piante, funghi, insetti) dove sono presenti in gran numero di copie env e non Elementi Ty ins. cerevisiae mancano del gene env elementi copia in Drosophila possono formare particelle virali pb

63 LINEs:long interspersed nuclear elements promotore Pol II RNA binding anche endonucleasi ripetizioni dirette Gli elementi LINEs o trasposoni non-ltr hanno una lunghezza di circa 6-7kb, 6 contengono un promotore per l RNA l polimerasi II (derivano da trascritti della l RNA pol II), una o due ORF e un segnale di poliadenilazione all estremit estremità 3. ORF1 codifica per una proteina a funzione ignota ( lega l RNA?), l ORF2 codifica per un enzima che possiede sia un attivit attività di trascrittasi inversa (RT), simile a quella dei retrovirus e dei retrotrasposoni virali, i, che un attivit attività di DNA endonucleasi (EN). Vi sono tre famiglie principali di elementi LINES: L1 (incluse copie tuttora attive e moltissime copie inattive troncate all estremit estremità 5 ); L2 e L3 (inattive). Le copie attive inserendosi in punti critici del genoma possono inattivare dei geni con conseguente insorgenza di patologie. Le LINEs si inseriscono preferibilmente nelle regioni eucromatiche ricche in A+T. 63

64 Meccanismo di trasposizione degli elementi LINEs 1. Generazione di un trascritto LINE full-length length a partire dal promotore. 2. ORF1 e ORF2 vengono tradotte e legano il LINE mrna. orf2 5 orf Il complesso LINE mrna/orf1/orf2 si sposta nel nucleo, dove l attivitl attività endonucleasica di ORF2 taglia il dsdna. L estremitl estremità libera al 3 3 (sul DNA) funge da innesco per la retrotrascrizione a partire dal 3 UTR. 3 5 orf1 orf Il sito di taglio di ORF1 è TTTT A, e questo spiega l integrazione l preferenziale nelle regioni genomiche ricche in AT. Dato che la LINE RT ha una bassa processività molte delle copie integrate sono tronche (solo 1/100 è completa).

65 SINEs: : short interspersed nuclear elements A B AAAA SINE Gli elementi SINEs sono elementi non-autonomi, hanno una lunghezza compresa tra 0.1 e 0.4 kb. Hanno un promotore (interno) per L RNA L polimerasi III (derivano da trascritti della l RNA l pol III), e una regione ricca in A all estremit estremità 3 ma non contengono un segnale di poliadenilazione. Gli elementi SINEs non contengono alcuna ORF codificante per una a trascrittasi inversa, ma sono in grado di trasporre utilizzando la trascrittasi si inversa sintetizzata da altri retroelementi (trasposizione( LINEs-dipendente dipendente).

66 SINEs: : short interspersed nuclear elements Gli elementi SINEs sono distribuiti ad alta densità nelle regioni ricche in CG del genoma (isocore H), perché hanno un più elevato contenuto C+G (~57%) rispetto agli elementi LINEs ( 40%). Nel genoma dei primati sono presenti tre differenti famiglie di elementi SINEs: l elemento Alu,, ancora attivo, e gli elementi inattivi MIR e Ther2/MIR3. L elemento Alu, il più comune nei primati, è lungo 0,3kb; è presente in circa di copie nel genoma umano e rappresenta quindi oltre il 10% di tutto il genoma. Presenta una regione ricca in A/T all estremit estremità 3,, coinvolta nel meccanismo di retrotrasposizione. Le sequenze Alu sono localizzate a monte o a valle dei geni, negli introni, nelle regioni 5 5 e 3 3 non tradotte dell mrna. Non è noto il loro ruolo funzionale, nonostante siano molto diffuse nel genoma di tutti i primati. Le sequenze Alu presentano analogie con l RNA l 7SL, componente di una particella ribonucleoproteica coinvolta nel meccanismo di secrezione dei polipeptidi di nuova sintesi attraverso le membrane del reticolo endoplasmatico. Si ritiene che il primo elemento Alu si è originato per un evento di retrotrascrizione di una molecola di RNA 7SL e successiva integrazione della copia nel genoma.

67 Meccanismo di retroposizione dell elemento elemento Alu Si pensa che il taglio al sito di inserimento sia opera della L1 endonucleasi Target-primed reverse transcription (TPRT) Il promotore pol III è necessario ma non sufficiente per la trascrizione che richiede anche sequenze fiancheggianti appropriate. La maggior parte degli elementi Alu integrati non è attiva in quanto non viene integrata in un contesto favorevole e muta rapidamente sia nelle sequenze CpG che nella regione ricca in A.

68 Evoluzione e classificazione degli elementi Alu Gli elementi Alu sono classificati in sottofamiglie che si differenziano per l epoca l della loro integrazione nel genoma, dalle più antiche (Sx, J) alle più recenti (Yc1, etc.). da: Batzer and Deininger, Nature Rev. Gen. 3:370380, 2002)

69 Danni genomici indotti da Alu Numerose patologie sono provocate dall'integrazione casuale di Alu A (Neurofibromatosi, haemophilia, sindrome di Apert, ecc.) o da ricombinazione disuguale (diabete di tipo II, sindrome di Lesch Nyhan, malattia di Tay Sachs, ipercolesterolemia familiare, α-thalassaemia, ecc.). 69

70 Trasposoni a DNA I Trasposoni a DNA sono elementi mobili distinti in due categorie: e: Trasposoni a DNA che si spostano replicandosi: una copia rimane nel sito originale, mentre la nuova copia si inserisce altrove nel genoma Trasposoni a DNA che si spostano in maniera conservativa, da un sito all altro altro del genoma senza aumentare il numero di copie Sono caratterizzati da una sequenza codificante la trasposasi contenente introni, fiancheggiata da ripetizioni terminali invertite, simili a quelle e dei trasposoni batterici. Sono meno comuni negli eucarioti (3% nel genoma umano, raggruppati in 7 classi principali) rispetto ai retrotrasposoni. I più noti sono gli Elementi Ac e Ds del granturco, i primi elementi mobili identificati negli anni 50 da B. McClintock e gli elementi P di Drosophila. Traspongono T mediante il meccanismo di trasposizione conservativa 70

71 Funzione degli elementi ripetuti Punti caldi per ricombinazione (duplicazioni, inversioni, traslocazioni; creazione di nuovi geni per shuffling esonici) Alterazione della espressione genica in quanto portatori di segnali trascrizionali (es. promotori e enhancer di LTR; promotori di Alu; siti di terminazione deboli della trascrizione di elementi L1; segnali di d poliadenilazione) Presenza in geni per proteine (Le Alu contengono siti criptici di splicing; fonte di domini proteici; contributo a variabilità delle proteine) Reclutamento come elementi regolatori (es. BC200 di primati deriva da Alu monomerica) Fonte di pseudogeni processati (ritorno in vita come lunghi esoni? Come nuovi geni? ) Fonte di plasticità del genoma e quindi ruolo attivo nel rimodellamento genomico (riarrangiamenti cromosomici, reshuffling di geni, etc)

72 Qual è l origine di tutto questo? Come si sono evoluti i genomi?

73 Origine ed evoluzione dei genomi

74 Origine ed evoluzione dei genomi Mondo a RNA Nascita di molecole autoreplicanti

75 Origine ed evoluzione dei genomi Mondo a RNA Protogenomi a RNA Compartimentalizzazione all interno di membrane lipidiche Prime strutture di tipo cellulare

76 Origine ed evoluzione dei genomi Come si è evoluto il genoma a DNA? Nascita di enzimi proteici

77 Origine ed evoluzione dei genomi Come si è evoluto il genoma a DNA? Trasferimento della funzione codificante dall RNA al DNA (chimicamente piu stabile)

78 Origine ed evoluzione dei genomi Primi Genomi a DNA (3,8 miliardi di anni fa) Ogni molecola di DNA rappresenta un singolo gene che codifica per una singola proteina singolo gene singola proteina

79 Origine ed evoluzione dei genomi Acquisizione di nuovi geni 1. Duplicazione di alcuni o tutti i geni del genoma 2. Acquisizione di geni da altre specie

80 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di un intero genoma Genoma duplicato

81 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Crossing-over disuguale Scambio disuguale tra cromatidi fratelli

82 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Gene A1 Duplicazione Gene A1 Gene A2 Pressione selettiva Nessuna pressione selettiva Gene A1 Gene B Divergenza Nuova funzione o Funzione simile

83 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Famiglie geniche

84 EVOLUZIONE DEI GENI

85 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Riarrangiamento genico Duplicazione dei domini Rimescolamento di domini

86 Origine ed evoluzione dei genomi Acquisizione di nuovi geni ESONI = MOTIVI PROTEICI MOTIVI N α β β α β β α β C Proteina Gene ESONI

87 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Acquisizione di geni da altre specie Il trasferimento di geni tra batteri è un fenomeno comune in natura che avviene ancora oggi I retrovirus sono capaci di spostare geni animali tra individui della stesse specie e tra specie diverse

88 EVOLUZIONE DEI GENI Maria C. Rivera & James A. Lake The ring of life provides evidence for a genome fusion origin of eukaryotes NATURE VOL SEPTEMBER 2004

89 Origine ed evoluzione dei genomi INTRONI? UN MISTERO 1. IPOTESI INTRONI ANTICHI: gli introni sono molto antichi e si stanno gradualmente perdendo nei genomi degli eucarioti 2. IPOTESI INTRONI RECENTI: gli introni si sono evoluti di recente e si stanno gradualmente accumulando nei genomi degli eucarioti

90 Origine ed evoluzione dei genomi INTRONI? UN MISTERO Teoria esonica dei geni

91 Origine ed evoluzione dei genomi INTRONI? UN MISTERO Le evidenze attuali non inficiano alcuna ipotesi

92 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI

93 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI Uomo Scimpanzè= 98,5% di omologia

94 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI Che cosa ci rende diversi dalle scimmie?

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

unità C3. Le cellule crescono e si riproducono

unità C3. Le cellule crescono e si riproducono unità 3. Le cellule crescono e si riproducono Durante l interfase la cellula aumenta di dimensioni sintetizza nuove proteine e nuovi organuli duplica il DN al termine di questi processi la cellula compie

Dettagli

Introduzione ai Microarray

Introduzione ai Microarray Introduzione ai Microarray Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Versione 2.3 Versione italiana ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra

Dettagli

Il ciclo cellulare e la sua regolazione

Il ciclo cellulare e la sua regolazione Il ciclo cellulare e la sua regolazione Le cellule possono essere classificate in base alla loro capacità di crescere e di dividersi: Cellule che hanno perso la capacità di dividersi (cellule neuronali,

Dettagli

Da dove prendono energia le cellule animali?

Da dove prendono energia le cellule animali? Da dove prendono energia le cellule animali? La cellula trae energia dai legami chimici contenuti nelle molecole nutritive Probabilmente le più importanti sono gli zuccheri, che le piante sintetizzano

Dettagli

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP

Infatti il glucosio viene bruciato in presenza di ossigeno e l'energia liberata, immagazzinata sotto forma di ATP I mitocondri sono gli organuli responsabili della produzione di energia necessaria alla cellula per crescere e riprodursi. Queste reazioni, che nel loro insieme costituiscono il processo di "respirazione

Dettagli

Diversità tra i viventi

Diversità tra i viventi Diversità tra i viventi PROPRIETÀ della VITA La CELLULA CLASSIFICAZIONE dei VIVENTI Presentazione sintetica Alunni OIRM Torino Tutti i viventi possiedono delle caratteristiche comuni Ciascun vivente nasce,

Dettagli

1. Manifestano la loro azione negativa solo in età adulta avanzata

1. Manifestano la loro azione negativa solo in età adulta avanzata Perché invecchiamo? La selezione naturale opera in maniera da consentire agli organismi con i migliori assetti genotipici di tramandare i propri geni alla prole attraverso la riproduzione. Come si intuisce

Dettagli

Acidi nucleici non codificanti

Acidi nucleici non codificanti Vol. Giacca 4bozza 17-02-2011 11:05 Pagina 19 Acidi nucleici non codificanti 19 maniera controllata in modo da non favorire la crescita di eventuali tumori presenti in sedi lontane da quella in cui sono

Dettagli

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici

1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici 1 Capitolo 8. Sviluppo linfocitario e riarrangiamento ed espressione dei geni dei recettori antigenici La maturazione consiste in una serie di eventi che avvengono negli organi linfoidi generativi o primari:

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Cosa succede in un laboratorio di genetica?

Cosa succede in un laboratorio di genetica? 12 laboratori potrebbero utilizzare campioni anonimi di DNA per lo sviluppo di nuovi test, o condividerli con altri in quanto parte dei programmi di Controllo di Qualità, a meno che si chieda specificatamente

Dettagli

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica

Gli enzimi. Proprietà generali Classificazione e nomenclatura Catalisi enzimatica Gli enzimi Proprietà generali Classificazione e nomenclatura Catalisi enzimatica En-zima εν ζυμη nel lievito Enzima termine generico per definire un catalizzatore biologico Tranne che diversamente indicato,

Dettagli

Il giardino nella macchina

Il giardino nella macchina Idee per una rilettura Il giardino nella macchina La nuova scienza della vita artificiale Claus Emmeche Bollati Boringhieri, 1996 È possibile la vita artificiale? In che modo gli strumenti offerti dalla

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la

INFIAMMAZIONE. L infiammazione è strettamente connessa con i processi riparativi! l agente di malattia e pone le basi per la INFIAMMAZIONE Risposta protettiva che ha lo scopo di eliminare sia la causa iniziale del danno cellulare (es. microbi, tossine etc), sia i detriti cellulari e le cellule necrotiche che compaiono a seguito

Dettagli

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA

Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA IL PRESENTE TESTO E UNA SINTESI DEL TESTO COMPLETO EDITO DA LA MEDICINA BIOLOGICA, n.4, 2010, WWW.MEDIBIO.IT Luc Montagnier IL DNA TRA FISICA E BIOLOGIA ONDE ELETTROMAGNETICHE DAL DNA E ACQUA Lo sviluppo

Dettagli

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è

Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000 L alta incidenza relativa di Emofilia A è Emofilia Malattia ereditaria X cromosomica recessiva A deficit del fatt VIII B deficit del fatt IX Il deficit del fatt VIII prevale (5 volte in più rispetto al IX) Prevalenza nel mondo è di 1:10000-1:50000

Dettagli

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali:

Gli enzimi. L azione degli enzimi è caratterizzata da alcune proprietà fondamentali: Gli enzimi Nel metabolismo energetico le cellule producono notevoli quantità di CO 2 che deve essere eliminata con l apparato respiratorio. Il trasferimento della CO 2 dalle cellule al sangue e da esso

Dettagli

Messa a punto dell analisi della

Messa a punto dell analisi della SSMT Locarno 2012/2013 Lavoro di diploma per il corso di Tecnici in Analisi Biomediche Presso l Istituto Cantonale di Patologia di Locarno Messa a punto dell analisi della traslocazione RET/PTC Lavoro

Dettagli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli

DAI GENI AI SEMI. genetica e biotecnologie in agricoltura. Simona Baima e Giorgio Morelli DAI GENI AI SEMI genetica e biotecnologie in agricoltura Simona Baima e Giorgio Morelli Copyright 2010 Editori: Simona Baima e Giorgio Morelli Copertina e disegni: Franco Marchiolli [www.francomarchiolli.com]

Dettagli

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico

Monossido d azoto NO (Nitric Oxide) Messaggero del segnale cellulare. Molecola regolatoria nel sistema nervoso centrale e periferico Monossido d azoto NO (Nitric Oxide) Ruolo biologico: Messaggero del segnale cellulare Molecola regolatoria nel sistema cardiovascolare Molecola regolatoria nel sistema nervoso centrale e periferico Componente

Dettagli

Citochine dell immunità specifica

Citochine dell immunità specifica Citochine dell immunità specifica Proprietà biologiche delle citochine Sono proteine prodotte e secrete dalle cellule in risposta agli antigeni Attivano le risposte difensive: - infiammazione (immunità

Dettagli

COMUNICAZIONE TRA CELLULE E AMBIENTE

COMUNICAZIONE TRA CELLULE E AMBIENTE COMUNICAZIONE TRA CELLULE E AMBIENTE 1. LE CELLULE COMUNICANO TRA LORO Le cellule vegetali comunicano attraverso i plasmodesmi. Dato lo spessore della parete cellulare, come possono interagire tra loro

Dettagli

LA MEMBRANA PLASMATICA

LA MEMBRANA PLASMATICA LA MEMBRANA PLASMATICA 1. LE FUNZIONI DELLA MEMBRANA PLASMATICA La membrana plasmatica svolge le seguenti funzioni: 1. tenere concentrate tutte le sostanze indispensabili alla vita: è proprio la membrana

Dettagli

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre?

Test di logica e cultura generale. 6. Quale di queste parole è estranea alle altre? Test di logica e cultura generale 1. Tre amici Carlo, Piero e Nicola acquistano della frutta al mercato. Ognuno di loro sceglie un diverso tipo di frutta e spende una somma differente. Sapendo che: - Carlo

Dettagli

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione

PROTOCOLLO DI BIOSICUREZZA. Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione PROTOCOLLO DI BIOSICUREZZA Sperma Scarti Morti Disinfezioni Personale Aghi e strumentario Derattizzazione Disinfezione Il ricorso a disinfettanti e disinfestanti, se unito ad altre misure tese a minimizzare

Dettagli

Cos è un analisi genetica (test genetico)?

Cos è un analisi genetica (test genetico)? 12 Cos è un analisi genetica (test genetico)? Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra Luglio 2008 Questo lavoro è sponsorizzato dal Consorzio EU-FP6 EuroGentest,

Dettagli

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus

Flavescenza dorata (FD) Diffusione epidemica Vettore: cicalina Scaphoideus L AVANZAMENTO DELLA RICERCA SULLA RESISTENZA ALLA FLAVESCENZA DORATA Elisa Angelini CRA-VIT Centro di Ricerca per la Viticoltura, Conegliano (TV) DUE GIALLUMI IMPORTANTI IN EUROPA ED ITALIA Flavescenza

Dettagli

Ereditarietà legata al cromosoma X

Ereditarietà legata al cromosoma X 16 Ereditarietà legata al cromosoma X Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle

Dettagli

Il fabbisogno alimentare e il ruolo dei nutrienti

Il fabbisogno alimentare e il ruolo dei nutrienti Il fabbisogno alimentare e il ruolo dei nutrienti Le necessità del nostro corpo Cibo e bevande sono i mezzi con cui il nostro organismo si procura le sostanze di cui ha bisogno per le sue attività vitali.

Dettagli

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier

Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier RICERCA APPLICATA / Stress ossidativo, invecchiamento e malattie degenerative Finalmente chiarezza sull'originale fermentato da Carica papaya studiato da Luc Montagnier A cura del Dipartimento Scientifico

Dettagli

unità B3. Le teorie sull evoluzione

unità B3. Le teorie sull evoluzione documentazione fossile è provata da embriologia comparata anatomia comparata biologia molecolare L evoluzione avviene per selezione naturale microevoluzione può essere macroevoluzione speciazione allopatrica

Dettagli

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1

13. Anticorpi. (vedi singoli sottocapitoli) I edizione. 13. Anticorpi...1 1 13. Anticorpi I edizione (vedi singoli sottocapitoli) 13. Anticorpi...1 13.1. STRUTTURA DEGLI ANTICORPI ED I GENI DELLE IMMUNOGLOBULINE...3 13.1.1. Struttura/funzione degli anticorpi...4 13.1.2. Dominii

Dettagli

PREVENZIONE E SALUTE GLOBALE

PREVENZIONE E SALUTE GLOBALE PREVENZIONE E SALUTE GLOBALE SI PARTE DALLA VITAMINA D Relatore dr Donata Soppelsa Medico di medicina generale Associato alla Società Italiana di Nutriceutica Quali domande? E sufficiente l integrazione

Dettagli

Fonti alimentari di Inositolo

Fonti alimentari di Inositolo Fonti alimentari di Inositolo Agrumi Cereali integrali Frutta secca(arachidi) Semi(germe di grano) Legumi(fagioli) Lievito di birra Gli alimenti freschi contengono molto più Inositolo rispetto ai prodotti

Dettagli

Ministero dell'istruzione, dell'università e della Ricerca

Ministero dell'istruzione, dell'università e della Ricerca PROVA DI AMMISSIONE AL CORSO DI LAUREA IN MEDICINA VETERINARIA Anno Accademico 2010/2011 Test di Biologia 1. Quale dei seguenti composti NON è di natura lipidica? A) Chitina B) Tripalmitina C) Vitamina

Dettagli

Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato

Dettagli

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico.

Elettroforesi su gel. L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. Elettroforesi su gel L elettroforesi è definita come la migrazione di particelle sotto l influenza di un campo elettrico. La mobilità della particella dipende dalla forza elettrostatica netta che agisce

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE ESERCIZI DI GENETICA (1) Dato il genotipo AaBb: quali sono i geni e quali gli alleli? Disegnate schematicamente questo genotipo con i geni concatenati

Dettagli

DOTTORATO DI RICERCA. Biochimica. Ciclo XXI. Settore scientifico disciplinari di afferenza: BIO/10

DOTTORATO DI RICERCA. Biochimica. Ciclo XXI. Settore scientifico disciplinari di afferenza: BIO/10 Alma Mater Studiorum Università di Bologna DOTTORATO DI RICERCA Biochimica Ciclo XXI Settore scientifico disciplinari di afferenza: BIO/10 TITOLO TESI Trasduzione del segnale e poliamine nell apoptosi

Dettagli

-uno o più IONI INORGANICI

-uno o più IONI INORGANICI Coenzimi e vitamine Alcuni enzimi, per svolgere la loro funzione, hanno bisogno di componenti chimici addizionali, i COFATTORI APOENZIMA + COFATTORE = OLOENZIMA = enzima cataliticamente attivo Il cofattore

Dettagli

«DOVE SI TROVANO I BATTERI?»

«DOVE SI TROVANO I BATTERI?» 1 a STRATEGIA EVITARE LA CONTAMINAZIONE conoscere «DOVE SI TROVANO I BATTERI?» I batteri si trovano ovunque nell ambiente (aria, acqua, suolo ed esseri viventi): Sono presenti sulle materie prime, ad es.

Dettagli

I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO

I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO I I SEGNALI COSTIMOLATORI DEI LINFOCITI T FEDERICA COLLINO ATTIVAZIONE DEI LINFOCITI T L attivazione dei linfociti T vergini richiede la presenza di una particolare regione di contatto tra le cellule T

Dettagli

1 LEZIONE CHE COS E L ALLENAMENTO

1 LEZIONE CHE COS E L ALLENAMENTO 1 LEZIONE CHE COS E L ALLENAMENTO Sono molte le definizioni di allenamento: Definizione generale: E un processo che produce nell organismo un cambiamento di stato che può essere fisico, motorio, psicologico.

Dettagli

INSUFFICIENZA RESPIRATORIA

INSUFFICIENZA RESPIRATORIA INCAPACITA VENTILATORIA (flussi e/o volumi alterati alle PFR) INSUFFICIENZA RESPIRATORIA (compromissione dello scambio gassoso e/o della ventilazione alveolare) Lung failure (ipoossiemia) Pump failure

Dettagli

Analogia tra il circuito elettrico e il circuito idraulico

Analogia tra il circuito elettrico e il circuito idraulico UNIVERSITÁ DEGLI STUDI DELL AQUILA Scuola di Specializzazione per la Formazione degli Insegnanti nella Scuola Secondaria Analogia tra il circuito elettrico e il circuito idraulico Prof. Umberto Buontempo

Dettagli

Attivazione dei linfociti T

Attivazione dei linfociti T Attivazione dei linfociti T Attivazione linfociti T: caratteristiche generali Eventi extracellulari - Riconoscimento dell antigene - Interazione dei recettori costimolatori Eventi intracellulari - Trasduzione

Dettagli

Effetti dell incendio sull ambiente

Effetti dell incendio sull ambiente Effetti dell incendio sull ambiente Dott. For. Antonio Brunori Effetti del fuoco Il fuoco danneggia e spesso distrugge il bosco, per valutare le effettive conseguenze di un incendio su un ecosistema forestale

Dettagli

IL SISTEMA NERVOSO. Organizzazione e struttura

IL SISTEMA NERVOSO. Organizzazione e struttura IL SISTEMA NERVOSO Organizzazione e struttura IL SISTEMA NERVOSO. è costituito due tipi cellulari: il neurone (cellula nervosa vera e propria) e le cellule gliali (di supporto, di riempimento: astrociti,

Dettagli

Classificazioni dei sistemi di produzione

Classificazioni dei sistemi di produzione Classificazioni dei sistemi di produzione Sistemi di produzione 1 Premessa Sono possibili diverse modalità di classificazione dei sistemi di produzione. Esse dipendono dallo scopo per cui tale classificazione

Dettagli

Teorie dell invecchiamento

Teorie dell invecchiamento G GERONTOL 2005;53:57-74 Società Italiana di Gerontologia e Geriatria EDITORIALE EDITORIAL Teorie dell invecchiamento The aging theories N. FERRARA * **, G. CORBI ** ***, D. SCARPA ****, G. RENGO **, G.

Dettagli

Vitamina D, PTH ed omeostasi del calcio

Vitamina D, PTH ed omeostasi del calcio Vitamina D, PTH ed omeostasi del calcio Funzioni principali della vit D Stimolazione dell'assorbimento del calcio e del fosforo a livello intestinale; Regolazione, in sinergia con l'ormone paratiroideo,

Dettagli

EFFETTI FISIOPATOLOGICI DELLA CORRENTE ELETTRICA SUL CORPO UMANO

EFFETTI FISIOPATOLOGICI DELLA CORRENTE ELETTRICA SUL CORPO UMANO EFFETTI FISIOPATOLOGICI DELLA CORRENTE ELETTRICA SUL CORPO UMANO Appunti a cura dell Ing. Emanuela Pazzola Tutore del corso di Elettrotecnica per meccanici, chimici e biomedici A.A. 2005/2006 Facoltà d

Dettagli

VLT. Aminoacidi Caffeina Derivati botanici Vitamine idrosolubili.

VLT. Aminoacidi Caffeina Derivati botanici Vitamine idrosolubili. VLT VLT (leggi Volt) è un gel energizzante il cui effetto si fonda sulla combinazione e sinergia d azione propria dei componenti in esso contenuti. In VLT si ritrovano, difatti, molteplici principi attivi

Dettagli

ESAME DI STATO DI LICEO SCIENTIFICO 2006 Indirizzo Scientifico Tecnologico Progetto Brocca

ESAME DI STATO DI LICEO SCIENTIFICO 2006 Indirizzo Scientifico Tecnologico Progetto Brocca ESAME DI STATO DI LICEO SCIENTIFICO 2006 Indirizzo Scientifico Tecnologico Progetto Brocca Trascrizione del testo e redazione delle soluzioni di Paolo Cavallo. La prova Il candidato svolga una relazione

Dettagli

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua.

La DIGESTIONE. I principi nutritivi sono: le proteine, i glucidi, i lipidi, le vitamine, i sali minerali e l acqua. La DIGESTIONE Perché è necessario nutrirsi? Il corpo umano consuma energia per muoversi, pensare, mantenere la temperatura costante, ma anche solo per riposarsi. Il consumo minimo di energia è detto metabolismo

Dettagli

Gli organismi viventi

Gli organismi viventi Gli organismi viventi Gli organismi viventi Quali caratteristiche contraddistinguono i viventi? È facile distinguere un organismo vivente da un oggetto non vivente? Gli organismi viventi Tutti gli organismi

Dettagli

Test per portatori sani

Test per portatori sani 16 Test per portatori sani Tutti i nomi originali in questo opuscolo sono stati cambiati per proteggere l'identità degli intervistati. Queste informazioni sono state elaborate dal Genetic Interest Group.

Dettagli

a state of complete physical, men al , an social well ll-bei ng an not merely the absence of disease or infirmity

a state of complete physical, men al , an social well ll-bei ng an not merely the absence of disease or infirmity SALUTE: definizione Nel 1948, la World Health Assembly ha definito la salute come a state of complete physical, mental, and social well-being and not merely the absence of disease or infirmity. Nel1986

Dettagli

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1

CAPITOLO I CORRENTE ELETTRICA. Copyright ISHTAR - Ottobre 2003 1 CAPITOLO I CORRENTE ELETTRICA Copyright ISHTAR - Ottobre 2003 1 INDICE CORRENTE ELETTRICA...3 INTENSITÀ DI CORRENTE...4 Carica elettrica...4 LE CORRENTI CONTINUE O STAZIONARIE...5 CARICA ELETTRICA ELEMENTARE...6

Dettagli

Corso di Impianti Tecnici per l'edilizia - E. Moretti. Condizionamento CLASSIFICAZIONE DEGLI IMPIANTI DI CONDIZIONAMENTO

Corso di Impianti Tecnici per l'edilizia - E. Moretti. Condizionamento CLASSIFICAZIONE DEGLI IMPIANTI DI CONDIZIONAMENTO 1 Impianti di Climatizzazione e Condizionamento CLASSIFICAZIONE DEGLI IMPIANTI DI CONDIZIONAMENTO Premessa Gli impianti sono realizzati con lo scopo di mantenere all interno degli ambienti confinati condizioni

Dettagli

Deceduti Regione LOMBARDIA

Deceduti Regione LOMBARDIA Tumore della vescica Di maggior rilievo nei maschi (più di 3/4 dei casi), presenta variazioni geografiche di entità modestissima, minori di ogni altro tipo di carcinoma. Il 9-95% circa è costituito da

Dettagli

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano

Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Le cellule staminali pluripotenti (embrionali) Prof. Fulvio Gandolfi Università degli Studi di Milano Facoltà di Medicina Veterinaria Embriologia e Terapia Genica e Cellulare Le cellule staminali adulte:

Dettagli

Relazione sul data warehouse e sul data mining

Relazione sul data warehouse e sul data mining Relazione sul data warehouse e sul data mining INTRODUZIONE Inquadrando il sistema informativo aziendale automatizzato come costituito dall insieme delle risorse messe a disposizione della tecnologia,

Dettagli

La corrente elettrica

La corrente elettrica PROGRAMMA OPERATIVO NAZIONALE Fondo Sociale Europeo "Competenze per lo Sviluppo" Obiettivo C-Azione C1: Dall esperienza alla legge: la Fisica in Laboratorio La corrente elettrica Sommario 1) Corrente elettrica

Dettagli

2.1 Difetti stechiometrici Variano la composizione del cristallo con la presenza di elementi diversi dalla natura dello stesso.

2.1 Difetti stechiometrici Variano la composizione del cristallo con la presenza di elementi diversi dalla natura dello stesso. 2. I difetti nei cristalli In un cristallo perfetto (o ideale) tutti gli atomi occuperebbero le corrette posizioni reticolari nella struttura cristallina. Un tale cristallo perfetto potrebbe esistere,

Dettagli

L analisi dei villi coriali

L analisi dei villi coriali 12 L analisi dei villi coriali Testo modificato dagli opuscoli prodotti dal Royal College of Obstetricians and Gynaecologists dell Ospedale Guy s and St Thomas di Londra. www.rcog.org.uk/index.asp?pageid=625

Dettagli

2. L INQUINAMENTO ATMOSFERICO

2. L INQUINAMENTO ATMOSFERICO 2. L INQUINAMENTO ATMOSFERICO L aria è una miscela eterogenea formata da gas e particelle di varia natura e dimensioni. La sua composizione si modifica nello spazio e nel tempo per cause naturali e non,

Dettagli

Fenomeni di trasporto. Fenomeni di trasporto

Fenomeni di trasporto. Fenomeni di trasporto La comprensione dei processi fisici, chimici e biologici che governano il trasporto di materia e la trasmissione delle forze è di fondamentale importanza per lo studio della fisiologia cellulare e l ingegnerizzazione

Dettagli

Cinquant anni dalla scoperta del DNA

Cinquant anni dalla scoperta del DNA Poste Italiane S.p.A. - Spedizione in abbonamento postale articolo 2 comma 20/c legge 662/96 - Roma Cinquant anni dalla scoperta del DNA Alcune ricerche dell Istituto Superiore di Sanità Un contributo

Dettagli

IMAGING BIO_MOLECOLARE con DaTSCAN

IMAGING BIO_MOLECOLARE con DaTSCAN IMAGING BIO_MOLECOLARE con DaTSCAN Stelvio Sestini, MD, PhD Unità di Medicina Nucleare - USL4 Prato Università degli Studi di Firenze Concetto 1. Le M. Neurodegenerative sono in aumento Concetto 2. Le

Dettagli

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD)

Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Pædiatric Rheumatology InterNational Trials Organisation Deficit di Mevalonato Chinasi (MKD) (o Sindrome da Iper-IgD) Che cos è? Il deficit di mevalonato chinasi è una malattia genetica. E un errore congenito

Dettagli

1 LA CORRENTE ELETTRICA CONTINUA

1 LA CORRENTE ELETTRICA CONTINUA 1 LA CORRENTE ELETTRICA CONTINUA Un conduttore ideale all equilibrio elettrostatico ha un campo elettrico nullo al suo interno. Cosa succede se viene generato un campo elettrico diverso da zero al suo

Dettagli

Nuove acquisizioni patogenetiche nell osteodistrofia renale.

Nuove acquisizioni patogenetiche nell osteodistrofia renale. Nuove acquisizioni patogenetiche nell osteodistrofia renale. Sequenza di eventi patogenetici (seconda metà anni 70 seconda metà anni 90) IRC deficit di attivazione ridotta escrezione della vitamina D di

Dettagli

Andiamo più a fondo nella conoscenza del Sistema Solare

Andiamo più a fondo nella conoscenza del Sistema Solare Andiamo più a fondo nella conoscenza del Sistema Solare Come abbiamo visto nelle pagine precedenti il Sistema Solare è un insieme di molti corpi celesti, diversi fra loro. La sua forma complessiva è quella

Dettagli

Un aiuto per prendere decisioni più informate 1-5

Un aiuto per prendere decisioni più informate 1-5 Un aiuto per prendere decisioni più informate 1-5 L'unico test che fornisce una valutazione accurata dell aggressività del cancro alla prostata Un prodotto di medicina prognostica per il cancro della prostata.

Dettagli

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria?

DOMANDE E RISPOSTE 1. Che cos è un vaccino? 2. Che cosa si intende con i termini immunità, risposta immune e risposta immunitaria? DOMANDE E RISPOSTE 1. Che cos è un vaccino? Un vaccino è un prodotto la cui somministrazione è in grado di indurre una risposta immunitaria specifica contro un determinato microrganismo (virus, batterio

Dettagli

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior

CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE. un atomo compie all atto di formazione di un composto al fine di formare un maggior CHIMICA ORGANICA: IBRIDAZIONE & RISONANZA IBRIDIZZAZIONE L ibridizzazione o ibridazione è una ricombinazione dei propri orbitali atomici che un atomo compie all atto di formazione di un composto al fine

Dettagli

DRG e SDO. Prof. Mistretta

DRG e SDO. Prof. Mistretta DRG e SDO Prof. Mistretta Il sistema è stato creato dal Prof. Fetter dell'università Yale ed introdotto dalla Medicare nel 1983; oggi è diffuso anche in Italia. Il sistema DRG viene applicato a tutte le

Dettagli

QUESITI A RISPOSTA APERTA

QUESITI A RISPOSTA APERTA QUESITI A RISPOSTA APERTA 1.Che cosa sono gli spettri stellari e quali informazioni si possono trarre dal loro studio? Lo spettro di un qualsiasi corpo celeste altro non è che l insieme di tutte le frequenze

Dettagli

Etichettatura degli alimenti

Etichettatura degli alimenti Ministero della Salute Direzione generale per l igiene e la sicurezza degli alimenti e la nutrizione Etichettatura degli alimenti Cosa dobbiamo sapere La scelta di alimenti e bevande condiziona la nostra

Dettagli

ANEURISMA AORTA TORACICA ASCENDENTE

ANEURISMA AORTA TORACICA ASCENDENTE ANEURISMA AORTA TORACICA ASCENDENTE Definizione Dilatazione segmentaria o diffusa dell aorta toracica ascendente, avente un diametro eccedente di almeno il 50% rispetto a quello normale. Cause L esatta

Dettagli

DIFETTI VISIVI NEI BAMBINI AFFETTI DALLA SINDROME DOWN

DIFETTI VISIVI NEI BAMBINI AFFETTI DALLA SINDROME DOWN DIFETTI VISIVI NEI BAMBINI AFFETTI DALLA SINDROME DOWN DADDY FADEL OPTOMETRISTA Nel 1866 John Langdon Down ha descritto per la prima volta la sindrome che porta il suo nome. Nel 1959 Lejeune et al. hanno

Dettagli

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009

Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Corso SOL Gestione catalogo libro moderno 21-22 settembre 2009 Introduzione generale Autenticazione dell operatore https://sebina1.unife.it/sebinatest Al primo accesso ai servizi di Back Office, utilizzando

Dettagli

L=F x s lavoro motore massimo

L=F x s lavoro motore massimo 1 IL LAVORO Nel linguaggio scientifico la parola lavoro indica una grandezza fisica ben determinata. Un uomo che sposta un libro da uno scaffale basso ad uno più alto è un fenomeno in cui c è una forza

Dettagli

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale?

Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Il cervello ha bisogno di zucchero. e il cuore pure, ma quale? Questo vecchio slogan pubblicitario riconduce ad una parziale verità scientifica, oggi più che attuale. E risaputo che parlare di zucchero

Dettagli

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE

GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE GLI INDICATORI COME STRUMENTO PER IL MIGLIORAMENTO DELLA QUALITA ASSISTENZIALE D r. C a r l o D e s c o v i c h U.O.C. Governo Clinico Staff Direzione Aziendale AUSL Bologna Bologna 26 Maggio 2010 INDICATORE

Dettagli

Correnti e circuiti a corrente continua. La corrente elettrica

Correnti e circuiti a corrente continua. La corrente elettrica Correnti e circuiti a corrente continua La corrente elettrica Corrente elettrica: carica che fluisce attraverso la sezione di un conduttore in una unità di tempo Q t Q lim t 0 t ntensità di corrente media

Dettagli

Ministero dell'istruzione, dell'università e della Ricerca

Ministero dell'istruzione, dell'università e della Ricerca PROVA DI AMMISSIONE AL CORSO DI LAUREA IN MEDICINA VETERINARIA Anno Accademico 2009/2010 Test di Cultura generale e Ragionamento logico 1. Il Patto Molotov-Ribbentrop del 1939 fra l Unione Sovietica e

Dettagli

LA MOBILITÀ ARTICOLARE

LA MOBILITÀ ARTICOLARE LA MOBILITÀ ARTICOLARE DEFINIZIONE La mobilità articolare (detta anche flessibilità o scioltezza articolare) è la capacità di eseguire, nel rispetto dei limiti fisiologicamente imposti dalle articolazioni,

Dettagli

Elementi di Statistica

Elementi di Statistica Elementi di Statistica Contenuti Contenuti di Statistica nel corso di Data Base Elementi di statistica descrittiva: media, moda, mediana, indici di dispersione Introduzione alle variabili casuali e alle

Dettagli

COS E LA PRODUZIONE INTEGRATA?

COS E LA PRODUZIONE INTEGRATA? Cos è la Produzione Integrata (PI). Con questo scritto desidero fare una cronistoria sulla produzione integrata, un sistema di lotta iniziato negli anni 80, dove un ticinese nella persona del Dott. Mario

Dettagli

Architettura dei Calcolatori

Architettura dei Calcolatori Architettura dei Calcolatori Sistema di memoria parte prima Ing. dell Automazione A.A. 2011/12 Gabriele Cecchetti Sistema di memoria parte prima Sommario: Banco di registri Generalità sulla memoria Tecnologie

Dettagli