Dimensione: px
Iniziare la visualizzazioe della pagina:




2 Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries information from one generation to the next. In molecular terms, it is the entire DNA sequence (including exons, introns and noncoding transcriptional control regions) necessary for production of a functional protein or RNA


4 Struttura del GENE

5 GENE procariotico Genoma di E. coli

6 GENE procariotico OPERONE Sequenze regolatrici a monte Sequenze codificanti Sequenze terminatrici della sequenza codificante

7 GENE procariotico animazione

8 GENE procariotico Promotori

9 GENE procariotico Sequenze codificanti ORF (Open Reading Frame) ATGGTATAT TAA MET VAL TYR STOP

10 GENE procariotico Promotore A B C Operone Sequenze codificanti Terminatore

11 GENE procariotico Promotore A B C Operone Sequenze codificanti Terminatore mrna mrna mrna Proteina Proteina Proteina

12 GENE procariotico Repressione Promotore A B C Operone Sequenze codificanti Terminatore Nessuna espressione

13 GENE EUCARIOTICO GENI DELLA I CLASSE RNA RIBOSOMIALE rrna (28S-5,8S e 18s) GENI DELLA II CLASSE RNA MESSAGGERO mrna Piccoli RNA nucleari snrna microrna - LncRNA GENI DELLA III CLASSE RNA TRANSFER trna Piccoli rna nucleolari snorna Piccoli rna citoplasmatici - scrna








21 Sequenza codificante modulare GENE EUCARIOTICO

22 GENE EUCARIOTICO Segnale di poliadenilazione

23 Organizzazione genica negli eucarioti I geni eucariotici sono monocistronici Eccezioni: Unità di trascrizione policistroniche risolte in mrna maturi monocistronici per trans-splicing splicing (es in tripanosomi, nematodi, platelminti); uso di IRES, reinizio della traduzione o frameshift traduzionale I geni eucariotici non mostrano nessuna evidente relazione tra localizzazione e l attivitl attività funzionale (functional clustering) o con l espressione l spazio- temporale Eccezioni: Raggruppamento di geni con funzione correlata, quali geni Hox, geni per emoglobine e geni per immunoglobuline (duplicazioni i in tandem?) 23


25 Organizzazione genica negli eucarioti Alcuni geni eucariotici sono policistronici Taxon Tripanosomi (Euglenozoa) Cnidari Platelminti (Metazoa Acoelomata) Nematodi (Metazoa Pseudocoelomata) Ciona intestinalis/oikopleura dioica Entità tutti gli RNA alcuni RNA pochi RNA molti RNA molti RNA Il processamento del precursore policistronico è associato al Trans Splicing delle estremità 5 degli mrna e alla poliadenilazione delle estremità 3 per generare i trascritti monocistronici. 25

26 Geni codificanti per proteine - geni presenti in unica copia (single( single-copy genes) - geni omologhi presenti in copie multiple ed organizzati in famiglie geniche I membri di una stessa famiglia genica possono essere localizzati i in unico cluster, dispersi, o localizzati in più cluster: Geni in cluster: α-globin (7), growth hormone (5), Class I HLA heavy chain (20),. Geni dispersi: Pyruvate dehydrogenase (2), Aldolase (5), PAX (>12),.. Geni localizzati in più cluster: HOX (38 4), Histones (61 2), Olfactory receptors (>900 25), 26


28 La struttura dei geni eucariotici Nel genoma umano non si osserva una distribuzione omogenea dei geni. La più alta densità genica si osserva nel chr 19, mentre il chr 13 e Y mostrano la più bassa densità. GENE esone introne esone introne esone TSS TRASCRIZIONE 5 UTR mrna CDS 3 UTR TRADUZIONE Caratteristiche dei geni umani Mediana Media Numero di esoni 7 8,8 L introni (bp) L 5'UTR (bp) L CDS (bp) L 3'UTR (bp) L gene (bp)

29 La struttura dei geni eucariotici I geni eucariotici presentano una grande varietà di strutture e dimensioni. Ad esempio nel genoma umano: Il più piccolo: trna GLU (69 bp) Il più grande: Distrofina (2.4 Mb, la sua trascrizione richiede circa 16h) Il numero di esoni può variare da 1 (geni privi di introni come molti geni per ncrna, interferoni, istoni, ribonucleasi, HSP, GPCR, ecc.) sino a 363 (Titina). Le dimensioni degli esoni e degli introni sono estremamente variabili. abili. A fronte di esoni costituiti da pochi nucleotidi, l esone l più grande è presente nel gene per ApoB (7.6 kbb). Anche le dimensioni degli introni possono variare da pochi nucleotidi fino a 800 kbp (gene WWOX). Le proteine codificate possono variare nelle dimensioni da pochi residui (piccoli ormoni) sino a molte migliaia (Titina( Titina,, aa). 29

30 GENE EUCARIOTICO Può un gene codificare per diverse proteine?

31 Uno stesso gene può codificare per proteine indirizzate a diversi compartimenti cellulari: l esempio l del gene NFS1 La proteina codificata dal gene NFS1 rimuove lo zolfo dalla cisteina formando alanina. Questo gene utilizza siti di inizio alternativi della trascrizione e quindi traduzione e per generare una isoforma mitocondriale ed una isoforma citoplasmatica. La selezione del sito di inizio della la traduzione è regolata dal ph citosolico. L isoforma che codifica per la proteina mitocondriale (457 aa) contiene un peptide segnale e un dominio aminotrasnferasico. L altra isoforma, che deriva sa un sito di inizio alternativo della a trascrizione codifica per una proteina piùcorta (397 aa) priva del peptide segnale ma contenente il dominio aminotransferasico.

32 GENE EUCARIOTICO Può un gene codificare per diverse proteine? X

33 Uno stesso gene può esprimere proteine con funzioni opposte: l esempio dell attivit attivitàdella Caspasi 9 (CASP9) La forma costitutiva della proteina (CASP9( CASP9,, 9 esoni, 416 aa) induce apoptosi. Essa contiene un Caspase recruitment domain (CARD) e un u dominio caspasi Peptidase_C14. L isoforma più corta della proteina (CASP9S( CASP9S,, 5 esoni, 266 aa) contiene un dominio Caspase recruitment domain (CARD) e un dominio tronco della Peptidase_C14. Questa isoforma èpriva dell attivit attivitàproteasica e agisce da inibitore dell apoptosi.

34 Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere più di un trascritto (ed è quindi soggetto a splicing alternativo). Le diverse isoforme di splicing possono avere specificità a livello di tessuto, di condizione fisiologica, o patologica. 17,635 Human genes >50 Number of Transcripts/ Gene

35 Splicing alternativo e duplicazione genica sono inversamente correlati

36 GENE EUCARIOTICO Può un gene codificare per diverse proteine?

37 Definizione di GENE La trascrizione di un gene si può arrestare in corrispondenza di diversi terminatori Il gene per tp73l codifica per 10 trascritti alternativi,, e utilizza 2 promotori e 3 diversi terminatori della trascrizione

38 I geni possono essere sovrapposti I geni possono essere sovrapposti tra loro, nello stesso orientamento o in orientamento opposto, o anche essere completamente contenuti in altri geni.

39 Geni dentro i geni GENE EUCARIOTICO Geni all interno di altri geni sono descritti per i genomi di organismi semplici e nei mitocondri Nei mammiferi sono descritti geni contenuti nei grandi introni di alcuni geni. A differenza dei genomi piu semplici in questi casi spesso viene utilizzato il filamento opposto al gene canonico Esempio: NF1: introne 26 (40Kb) contiene tre piccoli geni (2 esoni) che vengono trascritti dal filamento opposto

40 Geni dentro i geni GENE EUCARIOTICO NF1 Filamento di senso esone 26 Introne 26 esone Filamento antisenso 3 5 OGMP 2.2KB EVI2B 10 KB EVI2A 4 KB



43 GENE nei virus

44 GENE nei virus Virus a DNA VITA? Virus a RNA

45 GENE nei virus

46 GENE nei virus Geni sovrapposti Met Val proteina b Sequenza di DNA GTTTATGGTA Val Tyr Gly proteina A

47 Il genoma è fatto solo di geni?

48 Il genoma è fatto solo di geni? Anatomia del Genoma Umano

49 Il genoma è fatto solo di geni?

50 Pseudogeni Talvolta la copia di un gene non è funzionale, ovvero non viene trascritta in RNA, o viene trascritta in un RNA non funzionale. Le copie inattive di un gene vengono dette pseudogeni. Gli pseudogeni possono essere classificati in: 1) non processati; ; 2) processati. Nel primo caso il gene inattivo è originato dal gene funzionale e contiene la tipica struttura in esoni ed introni. La copia genica può essere completa o parziale. Gli pseudogeni di questo tipo si formano con maggiore probabilità nelle regioni pericentromeriche. Gli pseudogeni processati sono privi di introni in quanto derivano dalla retrotrasposizione di mrna (retropseudogeni( retropseudogeni). Il numero di copie di retropseudogeni è correlato al livello di espressione del gene da cui derivano.

51 Pseudogeni La Trascrittasi Inversa codificata da elementi LINE può retrotrascrivere un mrna in cdna che successivamente può essere integrato a caso in un cromosoma. Se sul sito di inserimento è casualmente presente un promotore il retrogene può essere eventualmente espresso e diventare funzionale. Normalmente, questo non accade e lo pseudogene comincia ad accumulare mutazioni casuali che distruggono la ORF funzionale (frameshifts, codoni di stop). 51

52 Pseudogeni Nel genoma umano sono stati descritti ~8.000 pseudogeni (~5.000 nel genoma del topo). Il maggior numero di pseudogeni processati deriva da geni per proteine ribosomiali; altri gruppi derivano da geni che codificano per proteine che legano il DNA e l RNA, l per molecole strutturali ed enzimi metabolici. Molti pseudogeni derivano da geni a cui non è stata attribuita una funzione. Oltre al livello di espressione dei geni, altri fattori gene-specifici sono responsabili dell origine degli pseudogeni, quali la lunghezza o il loro contenuto in G+C.

53 Il genoma è fatto solo di geni? Il DNA NON CODIFICANTE RIPETUTO IN TANDEM SATELLITE, tipico delle sequenze centromeriche (a-satellite, monomero di 171 bp) MINISATELLITE, monomero 6-64bp, altamente polimorfico. Utilizzato per esami di fingerprint del DNA. Es.DNA telomerico (TTAGGG) MICROSATELLITE, 2-4 bp ripetuti in tandem. Espansioni di triplette sono responsabili di alcune patologie (Distrofia Miotonica)

54 Microsatelliti e Minisatelliti I microsatelliti sono costituiti da unità di ripetizione lunghe da 1 a 10 pb, ripetute in tandem volte, che formano raggruppamenti molto corti, <150pb, di tipo (A)n, (CA)n, (CGG)n, ecc. Sono anche detti SSR (simple sequence repeats). Le ripetizioni possono essere perfette o presentare piccole variazioni. I minisatelliti sono costituiti da unità più lunghe (da 11 a 100pb) ripetute in tandem volte che formano raggruppamenti di lunghezza fino a 20kb Gli SSR costituiscono circa il 3% del genoma umano. Sono molto importanti nello studio delle malattie genetiche in quanto mostrano un elevato grado di polimorfismo nella popolazione umana. Da: Lander et al. Nature 2001, 409:

55 Gli SSR possono formarsi attraverso un meccanismo di scivolamento della replicazione Gli SSR sono presenti con una frequenza di almeno uno ogni circa 2 kb del genoma. Si originano da vari meccanismi tra cui il più importante è lo scivolamento della DNA polimerasi 55 durante la replicazione.

56 Microsatelliti: Genetic Fingerprint Caratteristiche degli SSRs Polimorfismo di lunghezza: DNA fingerprinting Spesso adoperati come marcatori genetici per la mappatura di geni associati a patologie.

57 Microsatelliti e malattie genetiche I microsatelliti, ed in particolare le ripetizioni di triplette sono associati a varie malattie genetiche

58 Il genoma è fatto solo di geni? Il DNA NON CODIFICANTE INTERSPERSO SINE, brevi elementi nucleari ripetuti (pseudogene processato di RNA7SL) Alu (300bp, copie nel genoma umano) MIR (130bp, copie nel genoma umano) LINE, lunghi elementi nucleari ripetuti (retrotrasposoni) L1 (6,1Kb a lunghezza completa, copie) Retrovirus endogeni, HERV Elementi simili retroviral tronchi, RTLV e LTR Trasposoni a DNA, Mariner

59 Porzione non codificante:ripetizioni intersperse Costituite da sequenze di DNA ripetute, disperse in tutto il genoma. Sono definite anche Elementi mobili del DNA, perché derivano da elementi trasponibili (sequenze di DNA che si muovono o sono duplicate da una posizione ad un altra nel genoma) Classe I o Retrotrasposoni si originano per eventi di retrotrasposizione, attraverso un intermedio ad RNA elementi LTR LINEs: : long interspersed nuclear elements SINEs: : short interspersed nuclear elements Classe II o Trasposoni a DNA si originano attraverso un intermedio a DNA, secondo meccanismo di trasposizione conservativa o replicativa 59

60 Retrotrasposoni La caratteristica di tutti i retrotrasposoni è la presenza di brevi ripetizioni dirette alle estremità 3 e 5 5, copia della sequenza del sito d integrazione. d

61 Ripetizioni Intersperse nel Genoma Umano Gli elementi ripetuti interspersi costituiscono cirva il 45% del genoma umano. LINE (Long interspersed nuclear elements) L1, L2, L3 LINE ( ~21% del genoma, ~100,000 copie) SINE (Short interspersed nuclear elements) Alu (~10,7% del genoma, ~1,200, 000 copie) MIR, MIR3 (~3% del genoma, ~500,000 copie) Elementi LTR (Long Terminal Repeats) ERV, MalR (8% del genoma, ~500,000 copie) Transposoni a DNA MER1 (Charlie), MER2 (Tigger), others (2,8% del genoma, ~350, 000 copie)

62 Elementi LTR Gli elementi LTR o retrotrasposoni virali (6-7kb) presentano analogie con i retrovirus. Caratteristici degli invertebrati (piante, funghi, insetti) dove sono presenti in gran numero di copie env e non Elementi Ty ins. cerevisiae mancano del gene env elementi copia in Drosophila possono formare particelle virali pb

63 LINEs:long interspersed nuclear elements promotore Pol II RNA binding anche endonucleasi ripetizioni dirette Gli elementi LINEs o trasposoni non-ltr hanno una lunghezza di circa 6-7kb, 6 contengono un promotore per l RNA l polimerasi II (derivano da trascritti della l RNA pol II), una o due ORF e un segnale di poliadenilazione all estremit estremità 3. ORF1 codifica per una proteina a funzione ignota ( lega l RNA?), l ORF2 codifica per un enzima che possiede sia un attivit attività di trascrittasi inversa (RT), simile a quella dei retrovirus e dei retrotrasposoni virali, i, che un attivit attività di DNA endonucleasi (EN). Vi sono tre famiglie principali di elementi LINES: L1 (incluse copie tuttora attive e moltissime copie inattive troncate all estremit estremità 5 ); L2 e L3 (inattive). Le copie attive inserendosi in punti critici del genoma possono inattivare dei geni con conseguente insorgenza di patologie. Le LINEs si inseriscono preferibilmente nelle regioni eucromatiche ricche in A+T. 63

64 Meccanismo di trasposizione degli elementi LINEs 1. Generazione di un trascritto LINE full-length length a partire dal promotore. 2. ORF1 e ORF2 vengono tradotte e legano il LINE mrna. orf2 5 orf Il complesso LINE mrna/orf1/orf2 si sposta nel nucleo, dove l attivitl attività endonucleasica di ORF2 taglia il dsdna. L estremitl estremità libera al 3 3 (sul DNA) funge da innesco per la retrotrascrizione a partire dal 3 UTR. 3 5 orf1 orf Il sito di taglio di ORF1 è TTTT A, e questo spiega l integrazione l preferenziale nelle regioni genomiche ricche in AT. Dato che la LINE RT ha una bassa processività molte delle copie integrate sono tronche (solo 1/100 è completa).

65 SINEs: : short interspersed nuclear elements A B AAAA SINE Gli elementi SINEs sono elementi non-autonomi, hanno una lunghezza compresa tra 0.1 e 0.4 kb. Hanno un promotore (interno) per L RNA L polimerasi III (derivano da trascritti della l RNA l pol III), e una regione ricca in A all estremit estremità 3 ma non contengono un segnale di poliadenilazione. Gli elementi SINEs non contengono alcuna ORF codificante per una a trascrittasi inversa, ma sono in grado di trasporre utilizzando la trascrittasi si inversa sintetizzata da altri retroelementi (trasposizione( LINEs-dipendente dipendente).

66 SINEs: : short interspersed nuclear elements Gli elementi SINEs sono distribuiti ad alta densità nelle regioni ricche in CG del genoma (isocore H), perché hanno un più elevato contenuto C+G (~57%) rispetto agli elementi LINEs ( 40%). Nel genoma dei primati sono presenti tre differenti famiglie di elementi SINEs: l elemento Alu,, ancora attivo, e gli elementi inattivi MIR e Ther2/MIR3. L elemento Alu, il più comune nei primati, è lungo 0,3kb; è presente in circa di copie nel genoma umano e rappresenta quindi oltre il 10% di tutto il genoma. Presenta una regione ricca in A/T all estremit estremità 3,, coinvolta nel meccanismo di retrotrasposizione. Le sequenze Alu sono localizzate a monte o a valle dei geni, negli introni, nelle regioni 5 5 e 3 3 non tradotte dell mrna. Non è noto il loro ruolo funzionale, nonostante siano molto diffuse nel genoma di tutti i primati. Le sequenze Alu presentano analogie con l RNA l 7SL, componente di una particella ribonucleoproteica coinvolta nel meccanismo di secrezione dei polipeptidi di nuova sintesi attraverso le membrane del reticolo endoplasmatico. Si ritiene che il primo elemento Alu si è originato per un evento di retrotrascrizione di una molecola di RNA 7SL e successiva integrazione della copia nel genoma.

67 Meccanismo di retroposizione dell elemento elemento Alu Si pensa che il taglio al sito di inserimento sia opera della L1 endonucleasi Target-primed reverse transcription (TPRT) Il promotore pol III è necessario ma non sufficiente per la trascrizione che richiede anche sequenze fiancheggianti appropriate. La maggior parte degli elementi Alu integrati non è attiva in quanto non viene integrata in un contesto favorevole e muta rapidamente sia nelle sequenze CpG che nella regione ricca in A.

68 Evoluzione e classificazione degli elementi Alu Gli elementi Alu sono classificati in sottofamiglie che si differenziano per l epoca l della loro integrazione nel genoma, dalle più antiche (Sx, J) alle più recenti (Yc1, etc.). da: Batzer and Deininger, Nature Rev. Gen. 3:370380, 2002)

69 Danni genomici indotti da Alu Numerose patologie sono provocate dall'integrazione casuale di Alu A (Neurofibromatosi, haemophilia, sindrome di Apert, ecc.) o da ricombinazione disuguale (diabete di tipo II, sindrome di Lesch Nyhan, malattia di Tay Sachs, ipercolesterolemia familiare, α-thalassaemia, ecc.). 69

70 Trasposoni a DNA I Trasposoni a DNA sono elementi mobili distinti in due categorie: e: Trasposoni a DNA che si spostano replicandosi: una copia rimane nel sito originale, mentre la nuova copia si inserisce altrove nel genoma Trasposoni a DNA che si spostano in maniera conservativa, da un sito all altro altro del genoma senza aumentare il numero di copie Sono caratterizzati da una sequenza codificante la trasposasi contenente introni, fiancheggiata da ripetizioni terminali invertite, simili a quelle e dei trasposoni batterici. Sono meno comuni negli eucarioti (3% nel genoma umano, raggruppati in 7 classi principali) rispetto ai retrotrasposoni. I più noti sono gli Elementi Ac e Ds del granturco, i primi elementi mobili identificati negli anni 50 da B. McClintock e gli elementi P di Drosophila. Traspongono T mediante il meccanismo di trasposizione conservativa 70

71 Funzione degli elementi ripetuti Punti caldi per ricombinazione (duplicazioni, inversioni, traslocazioni; creazione di nuovi geni per shuffling esonici) Alterazione della espressione genica in quanto portatori di segnali trascrizionali (es. promotori e enhancer di LTR; promotori di Alu; siti di terminazione deboli della trascrizione di elementi L1; segnali di d poliadenilazione) Presenza in geni per proteine (Le Alu contengono siti criptici di splicing; fonte di domini proteici; contributo a variabilità delle proteine) Reclutamento come elementi regolatori (es. BC200 di primati deriva da Alu monomerica) Fonte di pseudogeni processati (ritorno in vita come lunghi esoni? Come nuovi geni? ) Fonte di plasticità del genoma e quindi ruolo attivo nel rimodellamento genomico (riarrangiamenti cromosomici, reshuffling di geni, etc)

72 Qual è l origine di tutto questo? Come si sono evoluti i genomi?

73 Origine ed evoluzione dei genomi

74 Origine ed evoluzione dei genomi Mondo a RNA Nascita di molecole autoreplicanti

75 Origine ed evoluzione dei genomi Mondo a RNA Protogenomi a RNA Compartimentalizzazione all interno di membrane lipidiche Prime strutture di tipo cellulare

76 Origine ed evoluzione dei genomi Come si è evoluto il genoma a DNA? Nascita di enzimi proteici

77 Origine ed evoluzione dei genomi Come si è evoluto il genoma a DNA? Trasferimento della funzione codificante dall RNA al DNA (chimicamente piu stabile)

78 Origine ed evoluzione dei genomi Primi Genomi a DNA (3,8 miliardi di anni fa) Ogni molecola di DNA rappresenta un singolo gene che codifica per una singola proteina singolo gene singola proteina

79 Origine ed evoluzione dei genomi Acquisizione di nuovi geni 1. Duplicazione di alcuni o tutti i geni del genoma 2. Acquisizione di geni da altre specie

80 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di un intero genoma Genoma duplicato

81 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Crossing-over disuguale Scambio disuguale tra cromatidi fratelli

82 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Gene A1 Duplicazione Gene A1 Gene A2 Pressione selettiva Nessuna pressione selettiva Gene A1 Gene B Divergenza Nuova funzione o Funzione simile

83 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Duplicazione di geni Famiglie geniche


85 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Riarrangiamento genico Duplicazione dei domini Rimescolamento di domini

86 Origine ed evoluzione dei genomi Acquisizione di nuovi geni ESONI = MOTIVI PROTEICI MOTIVI N α β β α β β α β C Proteina Gene ESONI

87 Origine ed evoluzione dei genomi Acquisizione di nuovi geni Acquisizione di geni da altre specie Il trasferimento di geni tra batteri è un fenomeno comune in natura che avviene ancora oggi I retrovirus sono capaci di spostare geni animali tra individui della stesse specie e tra specie diverse

88 EVOLUZIONE DEI GENI Maria C. Rivera & James A. Lake The ring of life provides evidence for a genome fusion origin of eukaryotes NATURE VOL SEPTEMBER 2004

89 Origine ed evoluzione dei genomi INTRONI? UN MISTERO 1. IPOTESI INTRONI ANTICHI: gli introni sono molto antichi e si stanno gradualmente perdendo nei genomi degli eucarioti 2. IPOTESI INTRONI RECENTI: gli introni si sono evoluti di recente e si stanno gradualmente accumulando nei genomi degli eucarioti

90 Origine ed evoluzione dei genomi INTRONI? UN MISTERO Teoria esonica dei geni

91 Origine ed evoluzione dei genomi INTRONI? UN MISTERO Le evidenze attuali non inficiano alcuna ipotesi

92 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI

93 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI Uomo Scimpanzè= 98,5% di omologia

94 Origine ed evoluzione dei genomi IL GENOMA UMANO: GLI ULTIMI 5 MILIONI DI ANNI Che cosa ci rende diversi dalle scimmie?


STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI STRUTTURA E FUNZIONE DEL GENE EVOLUZIONE DEI GENOMI Lodish Molecular Cell Biology GENOME: total genetic information carried by a cell or organism GENE: physical and functional unit of heredity, which carries


Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso



GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici



GENI GENOMI e GENOMICA GENI GENOMI e GENOMICA L analisi dei complessi genomici eucariotici ha ormai raggiunto la dignita di una nuova scienza, infatti si parla di GENOMICA La nascita della genomica e stata la diretta conseguenza


Tipi di ricombinazione

Tipi di ricombinazione Tipi di ricombinazione Omologa tra sequenze molto simili (durante la meiosi) Sito-Specifica tra sequenze con limitata similarità. Coinvolge siti specifici Transposizione movimento di elementi di DNA da


Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione


La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di


Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina


DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti


Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei



REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.


Elementi ripetuti del Genoma Umano. Milioni di anni

Elementi ripetuti del Genoma Umano. Milioni di anni Elementi ripetuti del Genoma Umano Patologia Milioni di anni Evoluzione Un gene è duplicato Un gene è riarrangiato Genoma Il Genoma è l intero DNA contenuto in una Cellula Geni Sequenze Intergeniche Sequenze


DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA


eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni


La ricombinazione del DNA

La ricombinazione del DNA La ricombinazione del DNA Ricombinazione omologa I modelli di Halliday e di Meselson-Redding. Il complesso RecBCD genera il filamento di DNA invasore. La proteina RecA promuove lo scambio dei filamenti


Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi.

Next-generation sequencing, annotazione, ed espressione genica. Giulio Pavesi Dip. Bioscienze Università di Milano giulio.pavesi@unimi. Next-generation sequencing, annotazione, ed espressione genica Giulio Pavesi Dip. Bioscienze Università di Milano Il primo passo... Abbiamo la sequenza completa del DNA di un organismo:


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%





Seconda lezione 2009: GENOMA UMANO e sua organizzazione

Seconda lezione 2009: GENOMA UMANO e sua organizzazione DIAGNOSTICA MOLECOLARE E GENETICA MEDICA Seconda lezione 2009: GENOMA UMANO e sua organizzazione Prof. Massimo Zollo E-mail : Riceve il venerdi dalle 15:00 alle 16:00 Libri da consultare:


Elementi di Bioinformatica. Genomica. Introduzione

Elementi di Bioinformatica. Genomica. Introduzione Corso di Elementi di Bioinformatica Ingegneria Biomedica AA 2013-14 Elementi di Bioinformatica Genomica Introduzione Genomica Genomica (genomics) Riguarda lo studio del genoma degli organismi viventi e,


Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello


Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione


LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,


Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione

Biologia Molecolare. CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione Biologia Molecolare CDLM in CTF 2010-2011 La modificazione dell RNA e la traduzione La maturazione del trascritto primario I microrna Le componenti del macchinario di traduzione Il meccanismo della traduzione





La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione


La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per


Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto


Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere


Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione



LA TRADUZIONE E IL CODICE GENETICO LA TRADUZIONE E IL CODICE GENETICO La traduzione La traduzione è il processo di sintesi di una catena polipeptidica, un polimero costituito da amminoacidi legati insieme da legami peptidici Le molecole


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi



MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e


Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,


La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo


RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.



IL GENOMA DELLA CELLULA VEGETALE IL GENOMA DELLA CELLULA VEGETALE I GENOMI DELLE CELLULE VEGETALI Genoma nucleare Geni per il funzionamento globale della cellula vegetale Condivisi o specifici per la cellula vegetale Genoma plastidiale



REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma


Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei


Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna

Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Gli RNA non codificanti (ncrna) giocano un ruolo fondamentale nei sistemi biologici complessi, pur non codificando alcuna proteina. Tra



DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac





Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte

Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a Università di Catania. La stru(ura del gene. Stefano Forte Corso di Laurea in Chimica e Tecnologie Farmaceu6che a.a. 2014-2015 Università di Catania La stru(ura del gene Stefano Forte I Geni Il gene è l'unità ereditaria e funzionale degli organismi viventi. La


Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1

Struttura e funzioni della cellula. Corso di Biofisica, Università di Cagliari 1 Struttura e funzioni della cellula 1 Riferimenti Books and others Biological Physics (updated 1 st ed.), Philip Nelson, Chap. 2 Physical Biology of the Cell, Phillips et al., Chap. 2 Movies Exercise 2


26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1)

26/11/2014 CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi CITOSOL (2) CITOSOL (1) CITOSOL (3) Citosol Ribosomi Sintesi delle proteine nei ribosomi http://hyperphysics.phy



TRASCRIZIONE DEL DNA. Formazione mrna TRASCRIZIONE DEL DNA Formazione mrna Trascrizione Processo mediante il quale l informazione contenuta in una sequenza di DNA (gene) viene copiata in una sequenza complementare di RNA dall enzima RNA polimerasi


L adattamento dei batteri. Strategie di adattamento

L adattamento dei batteri. Strategie di adattamento L adattamento dei batteri Strategie di adattamento mutazione trasferimento genico orizzontale regolazione dell espressione genica regolazione della trascrizione regolazione della traduzione regolazione


SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico


Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di


Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila

Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila Molecular basis of the X-linked Dyskeratosis disease: insights from Drosophila La ricerca è stata finalizzata allo studio della Discheratosi congenita X-linked (X-DC), una malattia genetica caratterizzata


Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)


La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:


Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,





Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna

Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna Eredità mitocondriale Si tratta di una eredità non mendeliana con una trasmisione matrilineare I caratteri si trasmettono principalmente per via materna I mitocondri dello spermatozoo non entrano a far


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte


Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come


In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide.

In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. In molecular terms, a gene commonly is defined as the entire nucleic acid sequence that is necessary for the synthesis of a functional polypeptide. Lodish et al. Molecular Cell Biology In molecular terms,


Dimensioni dei Genomi Eucariotici

Dimensioni dei Genomi Eucariotici Dimensioni dei Genomi Eucariotici plasmids viruses bacteria fungi plants algae insects mollusks bony fish amphibians Il Genoma umano è costituito da circa 3 miliardi di bp e contiene un numero di geni


Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e


Traduzione dell informazione genetica (1)

Traduzione dell informazione genetica (1) Traduzione dell informazione genetica (1) 1 Traduzione dell informazione genetica (2) Il processo negli eucarioti richiede: 70 diverse proteine ribosomiali >20 enzimi che attivano i precursori degli amminoacidi



GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo


INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi


A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla


Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule


La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:


Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente!

LEUCEMIE tessuto ematopoieitico MIELOMI. più precisamente! LEUCEMIE tessuto ematopoieitico MIELOMI più precisamente! TUMORI EVOLUZIONE E SELEZIONE CLONALE Cambiano: Velocita proliferazione Velocità di mutazione Stabilità genetica Attività telomerasica Vantaggi


sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come


Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni


Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine

Prof.ssa Gamba Sabrina. Lezione 7: IL DNA. Duplicazione e sintesi delle proteine Prof.ssa Gamba Sabrina Lezione 7: IL DNA Duplicazione e sintesi delle proteine concetti chiave della lezione Costituzione fisico-chimica del DNA Basi azotate Duplicazione Concetto di geni Rna Trascrizione


Genoma Umano 3200 Mb. Codificante 10% Ripetuto in tandem Altamente ripetuto. Satellite

Genoma Umano 3200 Mb. Codificante 10% Ripetuto in tandem Altamente ripetuto. Satellite Genoma Umano 3200 Mb Geni e sequenze gene-associate 25% DNA extragenico 75% Non codificante 90% Codificante 10% DNA unico e a basso numero di copie 60% DNA ripetitivo 40% Regioni spaziatrici Introni Seq.


Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni

Anomalie. Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni Anomalie Transcrittasi inversa Codice genetico mitocondriale RNA splicing RNA editing RNA interference RNA switch Pseudogeni Trasposoni 17 Transcrittasi inversa 18 Codice genetico mitocondriale 19 Codone


7. Gruppi genici e sequenza ripetute

7. Gruppi genici e sequenza ripetute 7. Gruppi genici e sequenza ripetute contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale La duplicazione e la delezione di



LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi


La nuova biologia.blu

La nuova biologia.blu David Sadava, David M. Hillis, H. Craig Heller, May R. Berenbaum La nuova biologia.blu Genetica, DNA ed evoluzione PLUS 2 Capitolo B4 La regolazione genica 3 Il genoma procariotico /1 I genomi procariotici


Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti


Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà

Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica. Dott. Alessandro Laganà Bioinformatica (2) Genomi, DNA, RNA e Sintesi Proteica Dott. Alessandro Laganà Genomi, DNA, RNA e Sintesi Proteica Il Genoma I Geni Il Dogma della Biologia Molecolare 2 Bioinformatica (2): Genomi, DNA,
