PisAcqua Patologie delle specie ittiche, igiene degli allevamenti e sicurezza dei prodotti

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "PisAcqua 2010. Patologie delle specie ittiche, igiene degli allevamenti e sicurezza dei prodotti"

Transcript

1 PisAcqua 2010 Patologie delle specie ittiche, igiene degli allevamenti e sicurezza dei prodotti Patologie virali associate al consumo di molluschi bivalvi HAV e Norovirus Pisa 7 maggio 2010 Dr. Laura Serracca

2 Trasmissione di virus con gli alimenti: Sottostimata (inadeguata sorveglianza) Assenza di metodiche ufficiali legislazione Trend in aumento Maggiore invecchiamento della popolazione Globalizzazione del commercio

3 Virus negli alimenti Gli alimenti e l acqua sono veicoli dei virus Eliminati con le feci in grande quantità ( /g) Bassa dose infettante ( unità virali) Trasmissione oro fecale Sopravvivono nell ambiente (130 giorni acqua di mare HAV) Sopravvivenza ai trattamenti (clorazione acque, depurazione, congelamento, trattamenti termici domestici )

4 STABILITA DEI VIRUS NELL AMBIENTE Le particelle virali hanno proprietà che le rendono stabili alle condizioni ambientali, a valori estremi di ph ed a trattamenti enzimatici (TEMP >60 < 0 C) a disinf. Cloro sino a 100 ppm I virus resistono alle fasi di produzione, processazione e conservazione degli alimenti così possono essere veicolo di contaminazione Alimenti maggiormente coinvolti sono molluschi bivalvi e vegetali

5 Attività di filtrazione dei molluschi Mitilo Ostrica Europea Ostrica Americana C Litri/ora 1, litri/giorno

6 Virus trasmessi con gli alimenti: Virus responsabili di gastroenteriti (astrovirus, rotavirus, adenovirus, calicivirus) Virus responsabili di epatiti a trasmissione oro-fecale (HAV e HEV) Virus responsabili di altre manifestazioni cliniche (enterovirus)

7 CLASSIFICAZIONE ENTEROVIRUS HEPATOVIRUS CALICIVIRUS Virus N di sierotipi conosciuti Sintomatologia causata Poliovirus 3 Meningite, paralisi, febbre Echovirus 32 Meningite, diarrea, rash, febbre, malattie respiratorie Coxsackievirus A 23 Meningite, erpagina, febbre malattie respiratorie Coxsachievirus B 6 Miocarditi, anomalie cardiache congenite, pleurodinia, malattie respiratorie, febbre, rash, meningite Nuovi enterovirus >4 Meningiti, encefaliti, congiuntivite acuta (tipi 68-71) emorragica, febbre, malattie respiratorie Epatite A (ex enterovirus 72) 1 Epatite infettiva Rotavirus 6 Diarrea, sintomi respiratori Adenovirus 47 Febbre, sintomi respiratori, congiuntiviti, diarrea Reovirus 3 Non chiaramente stabilito Norovirus1 2 Diarrea, vomito, febbre Sapovirus2 2 Diarrea, vomito, in età pediatrica Epatite E 1 Epatite Astrovirus e altri piccoli virus a struttura rotondeggiante (SRSVs) 5+7 Gastroenteriti Coronavirus e altri possibili virus (torovirus, picobirnavirus, parvovirus, ecc)?? 1- anche conosciuti come Small-Round-Structured-Viruses o SRSV, prima definiti Norwalk-like 2- anche definiti come Calicivirus tipici, prima detti Sapporo-like

8 Problemi nell individuazione delle contaminazioni I prodotti contaminati appaiono normali alla vista ed all olfatto Scarsa disponibilità e di impiego routinario delle metodiche di analisi Mancanza correlazione con indicatori batterici

9 Gastroenteriti virali sono sottostimate: Tradizionalmente confermate da: Ricerca del virus nelle feci Sieroconversione Ricerca negli alimenti limitata da: Assenza di metodi Non idoneità del campione

10 Metodi tradizionalmente usati per la diagnosi di infezione da virus: Non applicabili alla matrice alimento Isolamento in colture cellulari Microscopia elettronica ELISA Immunofluorescenza

11 BGM FRHK4

12 Alcuni dati epidemiologici % delle infezioni enteriche negli USA sono virali 27% delle infezioni virali in UK sono attribuibili ad Norov. In Finlandia nel 56% dei casi di gastroenteriti umane virali è stata riscontrata presenza di Norov. 84 mila casi di HAV all anno in USA: il 5% di origine alimentare

13 Virus ed infezioni alimentari Italia: alcuni dati epidemiologici ITALIA: diminuzione dei casi di epatite A nel periodo (10/100 mila a 2/100 mila). Minimo storico nella II metà anni 80 e nel Aumento dell incidenza dopo il LA SPEZIA: (2002) focolaio di Noro per consumo di ostriche CAMPANIA nel casi di Epatite A EMILIA ROMAGNA: Aumento nel n di casi epatite A nel periodo Nel 1999 il 70% dei casi ha reso necessario il ricovero (almeno 10 giorni) TAORMINA: nel 2003 crociera con decine di gastroenteriti da Noro PUGLIA: 11 mila casi di epatite A nel 1997 (molluschi) Source - Koopmans 2002; Costa-Mattioli 2003 SEIEVA)

14 CASI NEL MONDO DI PATOLOGIE DA VIRUS PER CONSUMO DI MOLLUSCHI ANNO VIRUS LUOGO N. CASI BIVALVE 1991 HAV CINA VONGOLE (9 MORTI) 1996 HAV PUGLIA AQUA/ MOLLUSCHI 1996 HAV PUGLIA AQUA/ MOLLUSCHI 2000 HAV SPAGNA 183 OSTRICHE (IMP.PERU ) 2004 HAV ITALIA 800 MITILI

15 Norovirus Piccole dimensioni, sferici, senza envelope Calicivirus Genoma RNA a singola elica e a polarità positiva ( kb) Norovirus 5 genogruppi e 30 genotipi Insorgenza rapida ore Sintomatologia: vomito diarrea febbre bassa o asente

16 Norovirus Diagnosi tradizionale : Sequenziamento e analisi filogenetica dei prodotti della RT-PCR per evidenziare diversi genotipi Limiti: Costoso Non applicabile in tutti i laboratori Non idoneo allo screening di molti campioni Non evidenzia infettività

17 Calicivirus umani Genogruppi GGI Norovirus NV GGII Hawaii Snow Mountain Melksham HV SMA OTH-25 Mexico Toronto TV GG IV Camberwell Bristol Lordsdale LV

18 Metodi diagnostici per Norov. RT-PCR verso la regione pol del genoma (gene della RNA polimerasi) altamente conservata Sequenziamento della regione capsidica ORF 2 per distinguere i due genogruppi (GGI e GGII che possono diversificare sino al 50% dei nucleotidi) e per l assegnazione in cluster: sono stati descritti 7 genotipi in GGI e 8 in GGII

19 Picco di virus nelle feci Picco di virus nelle feci: 2 settimane prima della comparsa dei sintomi (ittero, febbre, spossatezza, inappetenza); Ep-A fulminante=morte Zoonosi virali e consumo molluschi Virus Epatite A Famiglia Picornaviridae, genere Hepatovirus Piccole dimensioni, sferici, senza envelope RNAss lineare a polarità positiva Ciclo oro-fecale Colonizzazione intestinale ed epatica Incubazione: 30 giorni

20 Epatite A: distribuzione mondiale Incidenza Italia: 7 casi / abitanti

21 EPIDEMIOLOGIA E PREVENZIONE Dati di letteratura evidenziano come circa il 25% dei campioni di molluschi epatite A -positivi in PCR contengano particelle infettanti (positivi sulle cellule) Migliori condizioni igienico sanitarie Prevenzione Controllo molluschi e catena di distribuzione Informazione modalità di consumo Profilassi immunizzante

22 Epatite A Virus sferico con un diametro di nm Genoma RNA a polarità positiva di circa 7.5 kb codificante poliproteina Regione 5 : proteine strutturali (4) (segmento A) Regione 3 : proteine non strutturali (7) (segmentob-c) A B C 5' UTR VP4 VP2 VP3 VP1 2A 2B 2C 3A 3B 3C 3D 3' UTR Fig. 1: Rappresentazione schematica del genoma dell Epatite A PRIMERS: Regione VP3-VP1 capside AV1: 5 GGAAATGTCTCAGGTACTTTCTTTG 3 AV2: 5 GTTTTGCTCCTCTTTATCATGCTATG 3 AV3: 5 TCCTCAATTGTTGTGATAGC 3

23 Determinazione del virus HAV Laboratorio Microbiologia Marina ESTRAZIONE 7-10 gg Retro trascrizione Rt-PCR HEMI-NESTED gg Laboratorio Biotecnologie Torino Frp3/Frhk4 Dopo 10/20/30 gg

24 VALIDAZIONE HAV SVILUPPO DI UN NUOVO METODO MESSA A PUNTO/OTTIMIZZAZIONE DEL METODO STUDIO PILOTA/PRE-VALIDAZIONE VALIDAZIONE VERIFICA DEGLI INDICI DI PERFORMANCE PROCEDURA DEL METODO VALIDATO RAPPORTO DI VALIDAZIONE

25 ALLERTA HAV Virus epatite A in telline dal Peru congelate via Spagna. Notifica 2008 n.1079 del 10/09/2008 Rintracciati e distrutti 2500 kg Allerta n 1387 del virus epatite A in Clam (Mercenaria mercenaria)

26 Grazie per l attenzione

I VIRUS NEI MOLLUSCHI BIVALVI:

I VIRUS NEI MOLLUSCHI BIVALVI: I VIRUS NEI MOLLUSCHI BIVALVI: M N Losio, P Boni Istituto Zooprofilattico Sperimentale della Lombardia e dell Emilia Romagna Brescia, e-mail: nlosio@bs.izs.it Brescia 15.04.2008 GLI ALIMENTI POSSONO TRASMETTERE

Dettagli

PERICOLI MICROBIOLOGICI: Virus Enterici trasmessi con gli alimenti. Simona Di Pasquale simona.dipasquale@iss.it

PERICOLI MICROBIOLOGICI: Virus Enterici trasmessi con gli alimenti. Simona Di Pasquale simona.dipasquale@iss.it PERICOLI MICROBIOLOGICI: Virus Enterici trasmessi con gli alimenti Simona Di Pasquale simona.dipasquale@iss.it Veicolo di patogeni (VIRUS) Substrato attivo per lo sviluppo di BATTERI Tossinfezioni Alimentari/Epatiti

Dettagli

Reovirus. Stabili in svariate condizioni di ph, T e negli aerosol.

Reovirus. Stabili in svariate condizioni di ph, T e negli aerosol. Orthoreovirus, Rotavirus, Orbivirus, Coltivirus Caratteri generali: Privi di mantello. Due involucri capsidici. 10-12 segmenti di RNA genomico a doppio filamento. Reovirus Stabili in svariate condizioni

Dettagli

MALATTIE A VEICOLO IDRICO: EVIDENZE EPIDEMIOLOGICHE

MALATTIE A VEICOLO IDRICO: EVIDENZE EPIDEMIOLOGICHE ACQUE DESTINATE AL CONSUMO UMANO:RISCHI MICROBIOLOGICI E MALATTIE A VEICOLO IDRICO: EVIDENZE EPIDEMIOLOGICHE PROF. G. Sansebastiano Dr.ssa R. Zoni Dr.ssa L. Bigliardi UNIVERSITA DI PARMA microrganismi

Dettagli

CARATTERIZZAZIONE MOLECOLARE DINOROVIRUS GIV ED ALTRI VIRUS ENTERICI IN MOLLUSCHI BIVALVI : UNO STUDIO PRELIMINARE

CARATTERIZZAZIONE MOLECOLARE DINOROVIRUS GIV ED ALTRI VIRUS ENTERICI IN MOLLUSCHI BIVALVI : UNO STUDIO PRELIMINARE CARATTERIZZAZIONE MOLECOLARE DINOROVIRUS GIV ED ALTRI VIRUS ENTERICI IN MOLLUSCHI BIVALVI : UNO STUDIO PRELIMINARE La Rosa G. (1); Fratini* M. (1); Spuri Vennarucci V. (1); Guercio, A. (2); Purpari, G.

Dettagli

VIRUS DI INTERESSE CLINICO. ssrna(+) NO envelope

VIRUS DI INTERESSE CLINICO. ssrna(+) NO envelope VIRUS DI INTERESSE CLINICO ssrna(+) NO envelope Tutti i virus con ssrna(+), pur causando malattie molto diverse, condividono i seguenti aspetti: 1. La loro replicazione si svolge nel CITOPLASMA della cellula

Dettagli

La gestione di un caso di morbillo

La gestione di un caso di morbillo La gestione di un caso di morbillo Eziologia del morbillo L agente causale è un paramyxovirus (virus ad RNA) Il virus è rapidamente inattivato dal calore e dalla luce L uomo è l unico ospite Patogenesi

Dettagli

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona

Dettagli

Istituto Superiore di Sanità - Roma 1

Istituto Superiore di Sanità - Roma 1 Metodi analitici per la ricerca dei virus enterici negli alimenti Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Tor Vergata 15.04.2014

Dettagli

Problematiche di Laboratorio nell applicazione del Protocollo regionale

Problematiche di Laboratorio nell applicazione del Protocollo regionale Problematiche di Laboratorio nell applicazione del Protocollo regionale UOC di Microbiologia e Virologia DAI di Patologia e Diagnostica AOUI di Verona MALATTIE TRASMESSE DA VETTORI E SORVEGLIANZA DELLE

Dettagli

Fino al 1970 era possibile fare solo una diagnosi. 1970. Blumberg identifica l antigene Australia nei

Fino al 1970 era possibile fare solo una diagnosi. 1970. Blumberg identifica l antigene Australia nei STORIA DELL IDENTIFICAZIONE DEI VIRUS CHE CAUSANO EPATITE 1 Fino al 1970 era possibile fare solo una diagnosi generica di epatite, pur essendo distinti due tipi sul piano epidemiologico. 1970. Blumberg

Dettagli

L EPATITE VIRALE PUO ESSERE CAUSATA DA ALMENO SEI VIRUS DIVERSI E SPECIFICI PER GLI EPATOCITI NANB B D

L EPATITE VIRALE PUO ESSERE CAUSATA DA ALMENO SEI VIRUS DIVERSI E SPECIFICI PER GLI EPATOCITI NANB B D L EPATITE VIRALE PUO ESSERE CAUSATA DA ALMENO SEI VIRUS DIVERSI E SPECIFICI PER GLI EPATOCITI Infectious A E Enterically transmitted Viral hepatitis NANB F, G,? Other * Serum B D C Parenterally transmitted

Dettagli

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA

DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA CLM Biotecnologie per l Alimentazione CLM in Biotecnologie Sanitarie Corso di Chimica e certificazione degli alimenti DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA VIRUS ENTERICI virus escreti tramite

Dettagli

L epatite E nei suini domestici e selvatici in Italia

L epatite E nei suini domestici e selvatici in Italia ZOONOSI EMERGENTI E RIEMERGENTI: tra vecchie conoscenze e nuove realtà Torino, 26 febbraio 2013 L epatite E nei suini domestici e selvatici in Italia Fabio Ostanello Dipartimento di Scienze Mediche Veterinarie

Dettagli

INFORMAZIONI DI BASE DELLA MALATTIA

INFORMAZIONI DI BASE DELLA MALATTIA SOMMARIO Dal 1 gennaio 2013 15 casi confermati in laboratorio di virus dell epatite A sono stati segnalati in Germania, Olanda e Polonia. Tutti i casi hanno storie di viaggi nelle provincie autonome di

Dettagli

UNIVERSITÀ DEGLI STUDI DI ROMA "TOR VERGATA"

UNIVERSITÀ DEGLI STUDI DI ROMA TOR VERGATA UNIVERSITÀ DEGLI STUDI DI ROMA "TOR VERGATA" FACOLTÀ DI MEDICINA E CHIRURGIA DOTTORATO DI RICERCA IN MICROBIOLOGIA MEDICA ED IMMUNOLOGIA XXI CICLO Duplex Real Time RT-PCR per la determinazione del Virus

Dettagli

Che cos è la celiachia?

Che cos è la celiachia? Che cos è la celiachia? La celiachia è una malattia infiammatoria cronica dell intestino tenue, dovuta ad una intolleranza al glutine assunto attraverso la dieta. Il glutine è una proteina contenuta in

Dettagli

A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.)

A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.) A cura di: Direzione Sanitaria Aziendale Direzione Medica di Polo Ospedaliero Comitato Infezioni Ospedaliere (C.I.O.) Si espongono, per opportuna conoscenza, gli ultimi aggiornamenti disponibili al 12/10/2014

Dettagli

L'epatite virale acuta è un processo necrotico infiammatorio del fegato indotto da virus, dovuto alla risposta immune.

L'epatite virale acuta è un processo necrotico infiammatorio del fegato indotto da virus, dovuto alla risposta immune. L'epatite virale acuta è un processo necrotico infiammatorio del fegato indotto da virus, dovuto alla risposta immune. Virus Epatici Maggiori HAV,HBV,HCV,HDV,HEV Virus Epatici Minori EBV, CMV,HSV Alterazioni

Dettagli

Metodi: CEN/TC275/WG6/TAG4

Metodi: CEN/TC275/WG6/TAG4 Determinazione di HAV e Norovirus in molluschi bivalvi mediante Real time PCR Elisabetta Suffredini Istituto Superiore di Sanità Dipartimento di Sanità Pubblica Veterinaria e Sicurezza Alimentare Ancona

Dettagli

Come e quando fare i test. Antonino Di Caro INMI

Come e quando fare i test. Antonino Di Caro INMI Come e quando fare i test Antonino Di Caro INMI Come e quando fare il test Antonino Di Caro, antonino.dicaro@inmi.it Maria Rosaria Capobianchi, maria.capobianchi@inmi.it Concetta Castilletti, concetta.castilletti@inmi.it

Dettagli

RISCHI DA AGENTI BIOLOGICI

RISCHI DA AGENTI BIOLOGICI RISCHI DA AGENTI BIOLOGICI definizione Rischio da agenti biologici Si sviluppa in seguito all esposizione a microorganismi: BATTERI VIRUS PARASSITI .Le malattie infettive Il rapporto che l agente infettivo

Dettagli

SORVEGLIANZA DELLE MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2011 -

SORVEGLIANZA DELLE MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2011 - SORVEGLIANZA DELLE MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2011 - Malattie infettive nell ASL di Brescia anno 2011- Pag. 1 MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2011 - I dati estratti dal

Dettagli

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Prof. Giorgio Gallinella Prof.ssa Giovanna Gentilomi Dott.ssa Francesca Bonvicini (ricercatore) Dott.ssa Elisabetta Manaresi

Dettagli

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI

INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI INFEZIONI VIRALI A TRASMISSIONE MATERNO-FETALI Alcune malattie infettive ad eziologia virale e andamento benigno nei soggetti immunocompetenti, se sono contratte durante la gravidanza, possono rappresentare

Dettagli

Dal prelievo alla diagnosi: Descrizione del percorso diagnostico

Dal prelievo alla diagnosi: Descrizione del percorso diagnostico Schmallenberg virus: l ennesima emergenza sanitaria per la zootecnia della Sardegna? Nuoro, 20 dicembre 2012 Dal prelievo alla diagnosi: Descrizione del percorso diagnostico Annalisa Oggiano Dipartimento

Dettagli

Prevenzione e terapia Delle Salmonellosi

Prevenzione e terapia Delle Salmonellosi Prevenzione e terapia Delle Salmonellosi Prof. Paolo Cadrobbi; Dott. Giovanni Carretta Salmonellosi tifoidee e non tifoidee E fondamentale distinguere tra: febbre tifoide, grave infezione che interessa

Dettagli

La catena Epidemiologica

La catena Epidemiologica La catena Epidemiologica STORIA NATURALE DELLE MALATTIE esposizione al/ai fattori di rischio insorgenza della malattia esito guarigione cronicizzazione decesso Principali differenze tra malattie infettive

Dettagli

CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE

CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE CORSO REGIONALE SULLA ROSOLIA CONGENITA E NUOVE STRATEGIE DI PREVENZIONE Padova 11 giugno 2007 Conferma di Laboratorio della Rosolia e Significato del Dosaggio degli Anticorpi Anna Piazza Giorgio Palù

Dettagli

Virus delle febbri emorragiche. 4 distinte famiglie: Arenaviridae Filoviridae Bunyaviridae Flaviviridae

Virus delle febbri emorragiche. 4 distinte famiglie: Arenaviridae Filoviridae Bunyaviridae Flaviviridae Virus delle febbri emorragiche 4 distinte famiglie: Arenaviridae Filoviridae Bunyaviridae Flaviviridae Hemorrhagic Fever Viruses JAMA, 2002; 287:2391 Family Disease Vector in Nature Geographic Distribution

Dettagli

UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012.

UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012. UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012 Rhabdovirus Rhabdoviridae: Virus della rabbia a) Vesiculovirus - virus della stomatite

Dettagli

Oggetto: relazione attività anno 2014 -consuntivo malattie trasmesse con gli alimenti (MDA).

Oggetto: relazione attività anno 2014 -consuntivo malattie trasmesse con gli alimenti (MDA). Oggetto: relazione attività anno 2014 -consuntivo malattie trasmesse con gli alimenti (MDA). Le malattie veicolate da alimenti continuano ad essere anche nei paesi industrializzati un rilevante problema

Dettagli

PESTIVIRUS. fam. FLAVIVIRIDAE. Suddivisa in tre generi Flavivirus. Pestivirus. Hepacivirus

PESTIVIRUS. fam. FLAVIVIRIDAE. Suddivisa in tre generi Flavivirus. Pestivirus. Hepacivirus PESTIVIRUS fam. FLAVIVIRIDAE Suddivisa in tre generi Flavivirus Pestivirus Hepacivirus 1 CLASSIFICAZIONE DEI PESTIVIRUS Un tempo classificati in BVDV, CSFV, BDV Questo schema tiene conto SOLO dello spettro

Dettagli

05/06/2014. Tracheobronchite infettiva del cane Kennel cough

05/06/2014. Tracheobronchite infettiva del cane Kennel cough LA TOSSE DEI CANILI Tracheobronchite infettiva del cane Kennel cough DEFINIZIONE Malattia infettiva contagiosa ad andamento acuto del cane, caratterizzata da tosse e scolo oculo-nasale Malattia ad eziologia

Dettagli

UNIVERSITÀ DEGLI STUDI DI PARMA

UNIVERSITÀ DEGLI STUDI DI PARMA UNIVERSITÀ DEGLI STUDI DI PARMA FACOLTÀ DI AGRARIA DOTTORATO DI RICERCA IN SCIENZE E TECNOLOGIE ALIMENTARI XXI CICLO INDAGINE SUI PROCESSI DI DISINFEZIONE NELL INDUSTRIA ALIMENTARE CON PARTICOLARE RIGUARDO

Dettagli

La conferma di laboratorio della rosolia

La conferma di laboratorio della rosolia La conferma di laboratorio della rosolia La risposta anticorpale all infezione post-natale da rosolia IgG Rash IgM Prodromi INCUBAZIONE 0 7 14 15 16 17 18 19 20 21 22 23 24 27 35 42 VIREMIA ESCREZIONE

Dettagli

La sindrome dell intestino irritabile post-infettiva

La sindrome dell intestino irritabile post-infettiva La sindrome dell intestino irritabile post-infettiva Dr.ssa Chiara Ricci Università di Brescia Spedali Civili, Brescia Definizione La sindrome dell intestino irritabile Disordine funzionale dell intestino

Dettagli

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B

Streptococcus. Streptococcus. pneumoniae. Neisseria meningitidis. coltura positiva. coltura negativa. gruppo B Diagnosi e tipizzazione di IPD in biologia molecolare direttamente da campione clinico in pazienti con terapia antibiotica in atto Cristina Massai Clinica Pediatrica II Ospedale Meyer Università di Firenze

Dettagli

Arterite Virale Equina (AVE)

Arterite Virale Equina (AVE) Arterite Virale Equina (AVE) Prof. Vincenzo Cuteri Dipartimento Scienze Veterinarie Università degli Studi di Camerino 27/04/2009 1 Introduzione Evidenziata alla fine del 19 secolo Denominata: Congiuntivite

Dettagli

MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2012 -

MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2012 - MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2012 - Malattie infettive nell ASL di Brescia anno 2012- Pag. 1 MALATTIE INFETTIVE NELL ASL DI BRESCIA - ANNO 2012 - Il controllo reale della diffusione delle

Dettagli

INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT

INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT INFEZIONE DA HIV ED AIDS HIV 1 ed HIV 2 appartengono alla famiglia dei Retroviridae, genere lentovirus. L infezione da HIV provoca nell ospite una progressiva compromissione delle difese immunitarie, soprattutto

Dettagli

Norovirus e molluschi bivalve: dati epidemiologici e attività di ricerca

Norovirus e molluschi bivalve: dati epidemiologici e attività di ricerca UNIVERSITÀ DEGLI STUDI DI NAPOLI FEDERICO II FACOLTÀ DI MEDICINA VETERINARIA SCUOLA DI SPECIALIZZAZIONE IN ISPEZIONE DEGLI ALIMENTI DI ORIGINE ANIMALE Norovirus e molluschi bivalve: dati epidemiologici

Dettagli

EPATITI ACUTE E CRONICHE IL CONCETTO DI EPATITE

EPATITI ACUTE E CRONICHE IL CONCETTO DI EPATITE EPATITI ACUTE E CRONICHE IL CONCETTO DI EPATITE Epatite = epatocitonecrosi + flogosi in tutto il fegato EPATITE ACUTA CRONICA da varie cause EPATITI ACUTE: EZIOLOGIA NON INFETTIVA ALCOOL TOSSICI - funghi

Dettagli

Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM)

Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM) II Corso Nazionale Teorico Pratico Emergenze in Infettivologia Ferrara, 30 Settembre 2009 Il supporto del Laboratorio Regionale nelle Emergenze Microbiologiche (CRREM) Vittorio Sambri Laboratorio CRREM

Dettagli

Herpesviridae: Malattia nel cane - CaHV1

Herpesviridae: Malattia nel cane - CaHV1 Herpesviridae: Malattia nel cane - CaHV1 Eziologia CaHV1 Genoma DNA, lineare, doppia elica, simmetria icosaedrica 162 capsomeri Dimensioni 120-200 nm Colture cellule omologhe, testicolari, macrofagi replica

Dettagli

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica Silvio Pascucci 1 Anamnesi Sintomi Lesioni Esami : Istologici Virologici Sierologici Diagnosi Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica 2

Dettagli

Malattie idrotrasmesse. Massimo Ciccozzi Istituto Superiore di Sanità. Inalazione di acqua Poliovirus Poliomielite

Malattie idrotrasmesse. Massimo Ciccozzi Istituto Superiore di Sanità. Inalazione di acqua Poliovirus Poliomielite Malattie idrotrasmesse Massimo Ciccozzi Istituto Superiore di Sanità Contatto con l'acqua Ingestione di acqua Actinomyces Attinomicosi Aeromonas hydrophila Gastroenterite Aeromonas hydrophila Infezioni

Dettagli

Le esperienze dei CCIO locali: ESPERIENZA DELL AZIENDA 18

Le esperienze dei CCIO locali: ESPERIENZA DELL AZIENDA 18 Convegno La prevenzione delle infezioni nelle strutture sanitarie della Regione Veneto: i progetti regionali e le esperienze locali Castelfranco Veneto, 18 novembre 2005 Le esperienze dei CCIO locali:

Dettagli

IL MEDICO DI MEDICINA GENERALE E MEDICINA GENERALE L ALLARME EBOLA: CLINICA E MANAGEMENT DELLE EPIDEMIE DEL TERZO MILLENNIO NEL SETTING DELLA

IL MEDICO DI MEDICINA GENERALE E MEDICINA GENERALE L ALLARME EBOLA: CLINICA E MANAGEMENT DELLE EPIDEMIE DEL TERZO MILLENNIO NEL SETTING DELLA IL MEDICO DI MEDICINA GENERALE E L ALLARME EBOLA: CLINICA E MANAGEMENT DELLE EPIDEMIE DEL TERZO MILLENNIO NEL SETTING DELLA MEDICINA GENERALE CORSO DI FORMAZIONE A DISTANZA I CRITERI PER LA CLASSIFICAZIONE

Dettagli

Dipartimento di Prevenzione U.O.C. Epidemiologia e Prevenzione BOLLETTINO EPIDEMIOLOGICO MALATTIE INFETTIVE AZIENDA SANITARIA LOCALE AVELLINO

Dipartimento di Prevenzione U.O.C. Epidemiologia e Prevenzione BOLLETTINO EPIDEMIOLOGICO MALATTIE INFETTIVE AZIENDA SANITARIA LOCALE AVELLINO AZIENDA SANITARIA LOCALE AVELLINO DIRETTORE GENERALE Ing. Sergio Florio Dipartimento di Prevenzione U.O.C. Epidemiologia e Prevenzione BOLLETTINO EPIDEMIOLOGICO MALATTIE INFETTIVE AZIENDA SANITARIA LOCALE

Dettagli

Ministero della Salute

Ministero della Salute ALLEGATO 1 N. Ministero della Salute DIPARTIMENTO DELLA PREVENZIONE E DELLA COMUNICAZIONE DIREZIONE GENERALE DELLA PREVENZIONE SANITARIA Ufficio V - Malattie Infettive e Profilassi Internazionale DGPREV.V/19262/P/I.4.c.a.9

Dettagli

Diagnosi di infezione da West Nile virus (WNV)

Diagnosi di infezione da West Nile virus (WNV) Il ruolo del laboratorio nella diagnosi delle zoonosi e delle malattie trasmesse da vettori Roma, 1-2 Ottobre 2014 Diagnosi di infezione da West Nile virus (WNV) Giada Rossini Centro Riferimento Regionale

Dettagli

I compiti del Servizio Igiene Pubblica nell ambito della sorveglianza sanitaria delle malattie infettive trasmesse da vettori.

I compiti del Servizio Igiene Pubblica nell ambito della sorveglianza sanitaria delle malattie infettive trasmesse da vettori. West Nile Disease e altre malattie a trasmissione vettoriale nel territorio regionale. I compiti del Dipartimento di Sanità Pubblica Venerdì 15 aprile 2011 Sala Galloni I compiti del Servizio Igiene Pubblica

Dettagli

Legionella: il controllo e la gestione dei rischi

Legionella: il controllo e la gestione dei rischi Ospitalità e sicurezza per tutti 22/04/2015 Legionella: il controllo e la gestione dei rischi Centro per la cultura della prevenzione nei luoghi di lavoro e di vita Aula grande SC Igiene e Sanità Pubblica

Dettagli

Parvovirus in gravidanza

Parvovirus in gravidanza Azienda Ospedaliero-Universitaria Careggi D.A.I. Specialità Medico-Chirurgiche S.O.D. Malattie infettive e Tropicali C.R.R. Malattie Infettive in Gravidanza Parvovirus in gravidanza Beatrice Borchi - EZIOLOGIA

Dettagli

Aspetti preventivi clinici e gestionali della malattia da virus Ebola. Definizione di contatto e sua gestione Toni Francesco

Aspetti preventivi clinici e gestionali della malattia da virus Ebola. Definizione di contatto e sua gestione Toni Francesco Aspetti preventivi clinici e gestionali della malattia da virus Ebola Definizione di contatto e sua gestione Toni Francesco 15 Novembre 2014 Migranti che arrivano con gli sbarchi via mare 1- La grande

Dettagli

ALLEGATO A. Cadenza consegna: da concordare con il capotecnico del Laboratorio

ALLEGATO A. Cadenza consegna: da concordare con il capotecnico del Laboratorio ALLEGATO A Durata della fornitura: un (1) anno. Quantità: kit necessari ad analizzare circa 300/350 campioni l anno Importo a base d asta: 20.000,00 s/iva Scadenza reattivi: almeno sei mesi Cadenza consegna:

Dettagli

11 settembre 2001. Niente sarà più come prima

11 settembre 2001. Niente sarà più come prima 11 settembre 2001 Niente sarà più come prima Alle 8,45 un Boeing 767 dell American Airlines si schianta contro la torre Nord del World Trade Center, nel cuore del quartiere finanziario di New York. Alle

Dettagli

Corso di formazione: Le malattie a trasmissione alimentare Alba, 28 ottobre 2014

Corso di formazione: Le malattie a trasmissione alimentare Alba, 28 ottobre 2014 Corso di formazione: Le malattie a trasmissione alimentare Alba, 28 ottobre 2014 Virus ed alimenti: il caso Epatite A Franco Giovanetti Dipartimento di Prevenzione ASL CN2 Alba Bra Hepatitis A Virus -

Dettagli

Rischi da esposizione ad agenti biologici

Rischi da esposizione ad agenti biologici Rischi da esposizione ad agenti biologici Dott. Sergio Biagini Tecnico della Prevenzione D.Lgs. 81/08 Titolo X Esposizione ad agenti biologici Campo di applicazione Tutte le attività lavorative nelle quali

Dettagli

Tossinfezioni alimentari e HACCP

Tossinfezioni alimentari e HACCP Tossinfezioni alimentari e HACCP INTOSSICAZIONI ALIMENTARI Cosa sono? Le intossicazioni alimentari sono manifestazioni patologiche che si determinano in seguito al consumo di alimenti contenenti tossine

Dettagli

Buone pratiche di produzione di insaccati e prodotti lavorati pronti al consumo

Buone pratiche di produzione di insaccati e prodotti lavorati pronti al consumo Buone pratiche di produzione di insaccati e prodotti lavorati pronti al consumo Prevenire la listeriosi Potenza, 31 ottobre 2013 Dr.ssa Carla Brienza Dr.ssa Nunzia Damiani Nel 2012 sono state 3436 le notifiche

Dettagli

LA GASTROENTERITE EMORRAGICA DEL CANE

LA GASTROENTERITE EMORRAGICA DEL CANE LA GASTROENTERITE EMORRAGICA DEL CANE DEFINIZIONE La gastroenterite emorragica del cane è una malattia infettiva altamente contagiosa, caratterizzata generalmente da diarrea emorragica, vomito incoercibile

Dettagli

CORSO DI PERFEZIONAMENTO IN SICUREZZA AGROALIMENTARE ORGANIZZATO DALL UNIVERSITA DEGLI STUDI DI PERUGIA

CORSO DI PERFEZIONAMENTO IN SICUREZZA AGROALIMENTARE ORGANIZZATO DALL UNIVERSITA DEGLI STUDI DI PERUGIA CORSO DI PERFEZIONAMENTO IN SICUREZZA AGROALIMENTARE ORGANIZZATO DALL UNIVERSITA DEGLI STUDI DI PERUGIA Corso di perfezionamento in: IGIENE DELLE PRODUZIONI ANIMALI E ALIMENTARI: RUOLO DEL MEDICO VETERINARIO

Dettagli

REPORT WEST NILE DISEASE (WND) Anno 2014. Aprile 2014

REPORT WEST NILE DISEASE (WND) Anno 2014. Aprile 2014 REPORT WEST NILE DISEASE (WND) Anno 2014 Aprile 2014 1 Sorveglianza West Nile Disease Anno 2014 Il presente report ha l obiettivo di fornire un aggiornamento dei risultati della sorveglianza integrata

Dettagli

Uova e prodotti a base di uova Dott.ssa Cristina Leonardi

Uova e prodotti a base di uova Dott.ssa Cristina Leonardi LA SICUREZZA ALIMENTARE IN GRAVIDANZA E NELLE ALTRE FASCE A RISCHIO: CONSIGLI E PRECAUZIONI Uova e prodotti a base di uova Dott.ssa Cristina Leonardi Novara, 29 settembre 2012 Borgomanero, 13 ottobre 2012

Dettagli

Indice. PARTE I Igiene generale. Autore. Prefazione

Indice. PARTE I Igiene generale. Autore. Prefazione Indice I Autore Prefazione XI XIII PARTE I Igiene generale CAPITOLO 1 Medicina clinica, preventiva e predittiva 1 1.1 Concetto di salute 1 1.2 Determinanti della salute 3 1.2.1 Modelli concettuali 3 1.3

Dettagli

Classificazione dei virus

Classificazione dei virus Classificazione dei virus Criteri di classificazione International Committee on Taxonomy of Viruses Ospiti: animali, piante, batteri. Natura dell acido nucleico nel virione : RNA o DNA Simmetria del capside:

Dettagli

sanità Avvertenze Azienda Sanitaria Locale (A.S.L.) interruzioni volontarie di gravidanza malattie infettive

sanità Avvertenze Azienda Sanitaria Locale (A.S.L.) interruzioni volontarie di gravidanza malattie infettive capitolo 3 sanità Avvertenze Le informazioni statistiche contenute nel presente capitolo provengono dall Agenzia di Sanità Pubblica della Regione Lazio e riguardano dati rilevati presso le strutture sanitarie

Dettagli

Diarrea da tossinfezione

Diarrea da tossinfezione d origine infettiva: percorsi a b comunitaria del Viaggiatore acuta protratta c nosocomiale persistente d in immunocompromesso e da tossinfezione a d origine comunitaria Acuta Protratta Persistente Moderata/

Dettagli

IL RISCHIO BIOLOGICO

IL RISCHIO BIOLOGICO LA SICUREZZA E LA SALUTE SUL LAVORO cominciamo a SCUOLA IL RISCHIO BIOLOGICO protocollo d intesa 5 febbraio 2015 ASL Brescia ASL Vallecamonica Sebino - Direzione Territoriale del Lavoro Ufficio Scolastico

Dettagli

Sicurezza e salute in piscina

Sicurezza e salute in piscina Scienze Motorie Corso di Igiene ed Educazione Sanitaria Sicurezza e salute in piscina Università degli Studi di Pavia Dipartimento di Medicina Preventiva, Occupazionale e di Comunità Sezione Igiene Normativa

Dettagli

IGIENE. disciplina che studia i mezzi e definisce le norme atte a conservare la salute fisica e mentale dell individuo e della collettività

IGIENE. disciplina che studia i mezzi e definisce le norme atte a conservare la salute fisica e mentale dell individuo e della collettività IGIENE branca della medicina che ha lo scopo di promuovere e mantenere lo stato di salute della popolazione disciplina che studia i mezzi e definisce le norme atte a conservare la salute fisica e mentale

Dettagli

VIRUS. Struttura Anatomica

VIRUS. Struttura Anatomica VIRUS 1 I virus sono parassiti intercellulari composti da materiale genetico (DNA o RNA) non protetto da alcun rivestimento proteico. Inerti finché si trovano all'esterno della cellula ospite, diventano

Dettagli

LE IDONEITÀ DIFFICILI

LE IDONEITÀ DIFFICILI LE IDONEITÀ DIFFICILI Il giudizio di idoneità in operatori sanitari HBV, HCV, HIV positivi Giantommaso Pagliaro - AO Ordine Mauriziano di Torino - APAMIL APAMIL - Associazione Piemontese e Aostana di Medicina

Dettagli

NOME: Citomegalovirus PATOLOGIA PROVOCATA. GENERE:Cytomegalovirus DECORSO CLINICO DELLA MALATTIA SOTTOFAMIGLIA: HERPESVIRUS UMANO TERAPIA

NOME: Citomegalovirus PATOLOGIA PROVOCATA. GENERE:Cytomegalovirus DECORSO CLINICO DELLA MALATTIA SOTTOFAMIGLIA: HERPESVIRUS UMANO TERAPIA Citomegalovirus NOME: Citomegalovirus PATOLOGIA PROVOCATA GENERE:Cytomegalovirus SOTTOFAMIGLIA: HERPESVIRUS UMANO DECORSO CLINICO DELLA MALATTIA TERAPIA DIMENSIONI: 25-35 MICRON DIAGNOSI SIMMETRIA: ICOSAEDRICA

Dettagli

LA MENINGITE Sintomi e diagnosi

LA MENINGITE Sintomi e diagnosi LA MENINGITE La meningite è una infiammazione delle membrane che avvolgono il cervello e il midollo spinale (le meningi). La malattia generalmente è di origine infettiva e può essere virale o batterica.

Dettagli

LISTERIA MONOCYTOGENES Dott.ssa Manuela Cagnoli

LISTERIA MONOCYTOGENES Dott.ssa Manuela Cagnoli LA SICUREZZA ALIMENTARE IN GRAVIDANZA E NELLE ALTRE FASCE A RISCHIO: CONSIGLI E PRECAUZIONI LISTERIA MONOCYTOGENES Dott.ssa Manuela Cagnoli Novara, 29 settembre 2012 Borgomanero,, 13 ottobre 2012 1924

Dettagli

UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012.

UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012. UNIVERSITA' degli STUDI di PERUGIA Facoltà di MEDICINA e CHIRURGIA Corso di Laurea in Medicina e Chirurgia AA 2011-2012 Picornavirus Famiglia Picornaviridae Genere Specie Sierotipi Stabilità-pH Enterovirus

Dettagli

Orthomyxovirus. G. Di Bonaventura Università di Chieti-Pescara

Orthomyxovirus. G. Di Bonaventura Università di Chieti-Pescara G. Di Bonaventura Università di Chieti-Pescara Caratteri generali I virus dell influenza A, B, C sono gli unici membri della Famiglia Orthomyxoviridae Tutti patogeni per l uomo (A anche per animali) Virione

Dettagli

Roma, 5 luglio 2013. A cura di:

Roma, 5 luglio 2013. A cura di: CENTRO NAZIONALE DI EPIDEMIOLOGIA SORVEGLIANZA E PROMOZIONE DELLA SALUTE EPIDEMIOLOGIA DELLE MALATTIE INFETTIVE VIALE REGINA ELENA, 299-00161 ROMA TEL. 0649902273 - FAX 0649387292 A cura di: Roma, 5 luglio

Dettagli

West Nile Disease in Italia nel 2012

West Nile Disease in Italia nel 2012 19 luglio n. 3, 2012 West Nile Disease in Italia nel 2012 Introduzione Sorveglianza nelle specie avicole Situazione epidemiologica Sorveglianza entomologica Sorveglianza negli equidi Sorveglianza sulla

Dettagli

VIRUS ENTERICI NEGLI ALIMENTI. Simona Di Pasquale

VIRUS ENTERICI NEGLI ALIMENTI. Simona Di Pasquale VIRUS ENTERICI NEGLI ALIMENTI Simona Di Pasquale (simona.dipasquale@iss.it) Centro Nazionale per la Qualità degli Alimenti e per i Rischi Alimentari Alimenti responsabili della trasmissione dei Virus

Dettagli

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana

Dettagli

SARS: Clinica, diagnosi, trattamento e prevenzione

SARS: Clinica, diagnosi, trattamento e prevenzione SARS: Clinica, diagnosi, trattamento e prevenzione Alberto E. Tozzi Centro Nazionale di Epidemiologia, Prevenzione e Promozione della Salute I.S.S. - Roma Manifestazioni cliniche della SARS Definizione

Dettagli

NOROVIRUS: STUDIO DI DIFFUSIONE NEGLI ALLEVAMENTI SUINICOLI PIEMONTESI. C. Caruso, L. Masoero

NOROVIRUS: STUDIO DI DIFFUSIONE NEGLI ALLEVAMENTI SUINICOLI PIEMONTESI. C. Caruso, L. Masoero NOROVIRUS: STUDIO DI DIFFUSIONE NEGLI ALLEVAMENTI SUINICOLI PIEMONTESI C. Caruso, L. Masoero Liguria e Valle d Aosta S.C. Virologia Devono essere so)oposte a sorveglianza in tu2 i Paesi comunitari Altri

Dettagli

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO

GENERALITA PARASSITA INTRACELLULARE OBBLIGATO GENERALITA A causa della natura di PARASSITA INTRACELLULARE OBBLIGATO, il virus può esprimere la sua attività biologica solo all interno di una CELLULA OSPITE che permetta la completa espressione del suo

Dettagli

PICORNAVIRUS (= piccoli RNA virus) Sono i ribovirus più piccoli ( 28 nm). Capside icosaedrico privo di inviluppo pericapsidico.

PICORNAVIRUS (= piccoli RNA virus) Sono i ribovirus più piccoli ( 28 nm). Capside icosaedrico privo di inviluppo pericapsidico. PICORNAVIRUS (= piccoli RNA virus) Sono i ribovirus più piccoli ( 28 nm). Capside icosaedrico privo di inviluppo pericapsidico. GENOMA: (+)RNA, singola elica, non segmentato. Codifica 4 proteine strutturali

Dettagli

Picornavirus. Picornaviridae famiglia. 5 generi. enterovirus cardiovirus rhinovirus aphthovirus hepatovirus

Picornavirus. Picornaviridae famiglia. 5 generi. enterovirus cardiovirus rhinovirus aphthovirus hepatovirus Picornavirus Picornaviridae famiglia 5 generi enterovirus cardiovirus rhinovirus aphthovirus hepatovirus specie poliovirus mengovirus rinovirus FMDV-C virus dell epatite A coxsackievirus > 100 sierotipi

Dettagli

AZIENDA ULSS 20 DI VERONA Dipartimento di Prevenzione. G. Napoletano

AZIENDA ULSS 20 DI VERONA Dipartimento di Prevenzione. G. Napoletano AZIENDA ULSS 20 DI VERONA Dipartimento di Prevenzione Indicatori di performance e di risultati nei programmi di controllo della diffusione delle malattie infettive Regione Veneto G. Napoletano Padova 04.11.2011

Dettagli

Orthopoxvirus. Categoria A: virus. Vaiolo. Famiglia Poxviridae. Vaiolo

Orthopoxvirus. Categoria A: virus. Vaiolo. Famiglia Poxviridae. Vaiolo Categoria A: virus Orthopoxvirus A. Azzi-Firenze, 21 febbraio 2005 Facilità di diffusione e trasmissione interumana Letalità elevata Capacità di suscitare panico e disordini Necessità di predisporre piani

Dettagli

Febbre del Nilo occidentale (West Nile Virus - WNV)

Febbre del Nilo occidentale (West Nile Virus - WNV) FSME (Frühsommermeningoenzephalitis) Febbre del Nilo occidentale (West Nile Virus - WNV) 95 West Nile Virus Foto: CNN Febbre del Nilo occidentale (West Nile Virus - WNV) DEFINIZIONE La febbre del Nilo

Dettagli

Report Malattie infettive situazione gennaio-maggio 2009

Report Malattie infettive situazione gennaio-maggio 2009 NUOVA INFLUENZA DA VIRUS A/H1N1 Le ultime settimane hanno visti impegnati molti operatori del SSR nella pandemia da nuovo virus influenzale A H1N1 : ciò ha consentito di verificare i percorsi e attuare

Dettagli

Nella figura A si vede la distribuzione mensile dei casi (picco nel mese di luglio)

Nella figura A si vede la distribuzione mensile dei casi (picco nel mese di luglio) La Spezia 08/11/2005 critica Al Direttore Sanitario Ai Dirigenti Dipartimenti Ai Direttori Area Medica, specialistica e OGGETTO : Legionellosi Premessa La sorveglianza della legionella permette di effettuare

Dettagli

Igiene degli alimenti

Igiene degli alimenti Igiene degli alimenti definizioni epidemiologia e prevenzione delle tossinfezioni alimentari bonifica del latte e principi di conservazione degli alimenti Malattie infettive ed alimentazione Le modifiche

Dettagli

Prevenzione generale delle malattie infettive

Prevenzione generale delle malattie infettive Prevenzione generale delle malattie infettive la sorveglianza epidemiologica l indagine epidemiologica isolamento e contumacia disinfezione e sterilizzazione Sorveglianza epidemiologica: definizione La

Dettagli

Campylobacter spp. e Igiene degli Alimenti. Valerio Giaccone Dipartimento di Sanità pubblica, Patologia comparata e Igiene veterinaria di Padova

Campylobacter spp. e Igiene degli Alimenti. Valerio Giaccone Dipartimento di Sanità pubblica, Patologia comparata e Igiene veterinaria di Padova Campylobacter spp. e Igiene degli Alimenti Valerio Giaccone Dipartimento di Sanità pubblica, Patologia comparata e Igiene veterinaria di Padova Famiglia Campylobacteraceae tre generi: Campylobacter, Arcobacter,

Dettagli

Bluetongue: malattia e situazione epidemiologica

Bluetongue: malattia e situazione epidemiologica Bluetongue: malattia e situazione epidemiologica Stefano Marangon Istituto Zooprofilattico Sperimentale delle Venezie AGRICOLTURA. Il Ministero ha ridotto l area soggetta a restrizioni per contenere la

Dettagli

IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino

IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino IL RUOLO DEL LABORATORIO DI RIFERIMENTO REGIONALE Anna Barbui S.C. Microbiologia e Virologia U Città della Salute e della Scienza di Torino Torino 17 febbraio 2016 RISULTATI DI 11 ANNI DI ATTIVITÀ (2005-2015)

Dettagli

DECRETO DEL PRESIDENTE DELLA REPUBBLICA 7 novembre 2001, n.465 Regolamento che stabilisce le condizioni nelle quali è obbligatoria la vaccinazione antitubercolare, a norma dell'articolo 93, comma 2, della

Dettagli