Identificazione e quantificazione degli acidi nucleici DNA RNA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Identificazione e quantificazione degli acidi nucleici DNA RNA"



2 Identificazione e quantificazione degli acidi nucleici DNA RNA


4 ESTRAZIONE DEGLI ACIDI NUCLEICI DNA genomico RNA totale messaggero 1) OMOGENIZZAZIONE LISI Soluzione alcalina concentrata (EDTA-SDS); Guanidina tiocianato per l RNA 2) DIGESTIONE CON DNase O RNase 3) ESTRAZIONE CON SOLVENTI ORGANICI fenolo, cloroformio, IAA 4) PRECIPITAZIONE IN ETANOLO ASSOLUTO 5) CENTRIFUGAZIONE DNA genomico, 5000xg, RT RNA 14000xg, 4 C

5 DNA genomico

6 ANALISI DEL DNA estrazione da tessuto cellule purificazione PCR southern blot

7 Polymerase Chain Reaction (PCR) quando abbiamo materiale da studiare in quantità molto piccola nella diagnosi di malattie genetiche nello studio di mutazioni genetiche che stanno alla base dello sviluppo di tumori nello studio di infezioni virali o batteriche

8 Polymerase Chain Reaction (PCR) DNA template dntp (datp, dctp, dgtp, dttp) Taq polimerasi Primer senso Primer antisenso Mg ++ H 2 O


10 P SENSO 5 acgtactgatcacgtgactgac 3 5 acgtgtcatacgtactgatcacgtgactgacctagcttcgactgactgtcaacgtgtcatgactgactcagtac tagctagcttcgactgactgtcaacgtgtcatgactgactgcagtcagctagctagcttcgactgactgtcaacg tgtcatgactgactgcagtcagctagctagcttcgactgactgtcaacgtgtcatgactgactgcagtcagctag ctagcttcgactgactgtcaactgactagctgcgtacgtacgtactgatcacgtgactgactgctagcgtcacgc 3 3 tgcatgactagtgcactgactg 5 P ANTISENSO

11 SCHEMA DI 1 CICLO DI PCR 94 C; 5min C; 30 sec PRIMER 1 (ANTISENSO) C; 2-3 min PRIMER 2 (SENSO)

12 Prodotto della PCR

13 Southern Blot è una tecnica usata per rivelare la presenza di specifiche sequenze di DNA in una miscela complessa - Estrazione e purificazione - Restrizione - Corsa elettroforetica

14 Southern blot

15 Southern blot

16 RNA elevata quantità di RNA in una cellula facilità nel purificare l RNA facilità nell ottenere la mappa dell RNA più facilmente decodificabile rispetto al DNA

17 mrna




21 RT-PCR RNA template Trascrittasi inversa (primer antisenso TTTTTTTTTTTT..) dntp (datp, dctp, dgtp, dttp) Taq polimerasi Primer antisenso Primer senso Mg ++ H 2 O


23 Northern Blot è l analogo del southern blot ma permette di evidenziare e studiare l mrna


25 Accorgimenti: Denaturare l mrna Sterilizzare Pulire gli strumenti con NaOH


27 IN SITU HYBRIDIZATION L ibridizzazione in situ è una metodica che utilizza delle sonde (probes) di mrna, marcate radioattivamente, che possono essere usate per ibridare l mrna direttamente sul tessuto.

28 IN SITU HYBRIDIZATION 1) PREPARAZIONE DEL TESSUTO - congelamento a -80 C - taglio al criostato (12 µm) - fissaggio del tessuto - trattamento con anidride acetica 2) IBRIDIZZAZIONE CON PROBE (RNA o cdna) MARCATO CON 35 S 3) RISCIACQUI PER RIDURRE IL BINDING ASPECIFICO 4) AUTORADIOGRAFIA




32 DIFFERENTIAL DISPLAY Tecnica che consente di amplificare e visualizzare tutto l mrna presente in un tessuto, permettendo l identificazione di geni non noti


34 Esempio di Differential Display tra due linee cellulari differenti di Candida albicans. L esperimento prevedeva l utilizzo di un primer 3 T11C e di nove differenti primer 5. I prodotti dell amplificazione sono fatti correre in parallelo nel gel. Le bande specifiche delle singole linee cellulari sono indicate da frecce rosse.


36 CLONAZIONE DI GENI Isolare e riprodurre un gene PCR Inserzione in un plasmide Studi successivi



39 Aggiungere ampicillina al mezzo di coltura

40 Struttura dei plasmidi Vengono utilizzati vettori contenenti: - il gene per la resistenza all ampicillina

41 i batteri che hanno inglobato il plasmide sopravvivono in presenza di ampicillina i batteri che non hanno inglobato il plasmide non sopravvivono in presenza di ampicillina

42 Struttura dei plasmidi Vengono utilizzati vettori contenenti: - il gene per la resistenza all ampicillina - il gene Lac Z (gene per la β-galattosidasi)

43 in presenza di IPTG e XGAL Plasmidi con esatta inserzione del cdna Gene LacZ interrotto: no produzione β-galattosidasi Plasmidi con mancata inserzione del cdna Gene LacZ intatto: produzione β-galattosidasi colorazione blu delle colonie batteriche

44 - L insulina è prodotta delle cellule β del pancreas e regola il metabolismo dei carboidrati - Prima dell 82 era possibile somministrare solo insulina dal pancreas di bovino o suino PRODUZIONE DELL INSULINA UMANA CON LA TECNOLOGIA DEL DNA RICOMBINANTE 1. produzione di proinsulina, inserendo nei batteri il gene completo e quindi convertendo la proinsulina, prodotta dai batteri, in insulina, come avviene nelle cellule normalmente; 2. produzione da parte di due colture batteriche separate (rispettivamente ingegnerizzate con i geni che codificano per le catene (A e B) delle singole catene polipeptidiche e quindi legandole chimicamente tra loro per ottenere la molecola attiva. Per ottenere il gene dall insulina umana: - isolare l RNA messaggero che codifica per l ormone insulina dalle cellule del pancreas che lo contengono in gran quantità e usare la trascrittasi inversa per fare una stampo di cdna; -sintetizzare chimicamente in laboratorio il gene della proinsulina umana o delle singole catene dell insulina umana legando nel corretto ordine le basi nucleotidiche desunte dalla sequenza di amminoacidi nella molecola della proinsulina e insulina. Dopo aver ottenuto il gene, questo viene inserito nel batterio Escherichia coli. I batteri ricombinanti coltivati nei bireattori producono l insulina umana e la secernono all esterno, facilitandone l'estrazione.

45 Il primo vaccino ricombinante è stato quello dell'epatite B. Applicando le tecniche dell'ingegneria genetica è stato clonato in un vettore il gene che codifica per l'antigene di superficie del virus e quindi trasferito ed espresso in un lievito, il Saccharomyces cerevisiae: il prodotto presenta tutte le caratteristiche dell'antigene.

46 TERAPIA GENICA Terapia mirata a sostituire geni malati o a impedire il funzionamento di un determinato gene OLIGONUCLEOTIDI ANTISENSO

47 OLIGONUCLEOTIDI ANTISENSO bloccare mrna e traduzione di proteine

48 L oligonucleotide antisenso si lega in modo specifico alla sequenza complementare dell mrna. Il tratto di catena ibrida che così si forma determina per impedimento sterico l inattivazione dell intero messaggero.

49 Dimensione minima per inibire la traduzione: oligomeri E necessario conoscere la sequenza nucleotidica dell mrna Regioni di mrna in cui il legame con l antisenso provoca un arresto più efficiente della traduzione

50 OLIGONUCLEOTIDI ANTISENSO in oncologia nella terapia antivirale ricerca

51 VANTAGGI efficacia semplicità progettazione selettività SVANTAGGI scarsa stabilità chimica (bersaglio nucleasi) difficoltà attraversamento membrane (dimensione, meccanismi di trasporto) alti costi di produzione

52 ANIMALI TRANSGENICI - Aggiunta di nuovi geni - Eliminazione di uno o più geni (KO)

53 APPLICAZIONI: - modelli di patologie umane - produzione di farmaci ricombinanti. Es. tpa (attivatore tissutale del plasminogeno) secreto nel latte di una topina - donatori di tessuti e organi da trapiantare

54 Producing transgenic mice The gene of interest is injected into one of two pronuclei of fertilized eggs. The injected eggs are trasferred to a pseudopregnant female mice. Tree weeks after the birth, the offspring are cheked for the presence of the transgene by Southern blotting of DNA extracted from a small piece of the tail. Screening can be performed rapidly using the polymerase chain reaction.

55 Animali geneticamente modificati per produrre biofarmaci: - Tracey, pecora che codifica l antitripsina, una sostanza chiave dell organismo che in una persona su 2000 risulta carente provocando gravi malattie come la fibrosi polmonare, enfisema e cirrosi epatica. - Herman, toro transgenico le cui figlie mucche producono latte con lattoferrina, proteina molto rara in grado di curare numerosi mali, dai tumori alle malattie del sistema immunitario, che solo la specie umana era in grado finora di produrre nel latte materno. - Genie, scrofa transgenica il cui latte contiene la proteina C del sangue umano. - Rosie, mucca transgenica il cui latte contiene una proteina umana utile ai nati prematuri. - Grace, capra transgenica nel cui latte è presente una proteina antitumorale. - Polly, clone transgenico che contiene il gene per una proteina umana, il fattore IX.

56 Animali KNOCK - OUT Gli animali Knock-out sono considerati una tecnica investigativa che tiene conto dell eliminazione di un gene in particolare, nel tentativo di definire che effetto ha nell organismo


58 Animali conditional Knock-out out Lo scopo dei Knock-out condizionali è eliminare un gene in un tessuto, in un organo o in una fase particolare di sviluppo. VANTAGGI: -topi Knock-out conditional sopravvivono più a lungo -i metodi sono anche più precisi




Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi



PURIFICAZIONE DI DNA PURIFICAZIONE DI DNA Esistono diverse metodiche per la purificazione di DNA da cellule microbiche, più o meno complesse secondo il grado di purezza e d integrità che si desidera ottenere. In tutti i casi


Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS


Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. via Raffaele Garofalo, 133 a/b 00173 Roma (06)


Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni



PLASMIDI puc ALTRI TIPI DI VETTORI. VETTORI λ 17-06-2010 PLASMIDI puc ALTRI TIPI DI VETTORI VETTORI λ (15-20 Kb) = vettori ottenuti apportando delle modifiche al genoma del batteriofago λ. COSMIDI (40-45 Kb) = plasmidi che contengono i siti cos di λ utili per


Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici



AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita


Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (



PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA





immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il



SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI



METODI DI MARCATURA DEGLI ACIDI NUCLEICI METODI DI MARCATURA DEGLI ACIDI NUCLEICI Marcatura di acidi nucleici Una sonda per ibridazione è una molecola di DNA marcata, con una sequenza complementare al DNA bersaglio da individuare. Poiché la sonda


Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione


PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you


Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,



LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni


PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica



MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza


La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica



TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi





Soluzioni e tamponi utilizzati per la PCR, senza DNA

Soluzioni e tamponi utilizzati per la PCR, senza DNA Materiali biologici In questo file sono elencati, capitolo per capitolo, i materiali biologici da richiedere al CusMiBio (o centro simile) per realizzare gli esperimenti che abbiamo illustrato (


Metodiche di analisi del DNA (cenni) (Ingegneria genetica)

Metodiche di analisi del DNA (cenni) (Ingegneria genetica) DNA Metodiche di analisi del DNA (cenni) (Ingegneria genetica) Principali tecniche di base Enzimi di restrizione (Endonucleasi) Gel elettroforesi Ibridizzazione PCR (Polymerase Chain Reaction) Sequenziamento


La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo


Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi

Indice. Prefazione. Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Indice IX X Prefazione Il codice genetico e la nomenclatura a singola lettera degli aminoacidi Capitolo 1 LA MANIPOLAZIONE GENICA, UNA TECNICA DALLE VASTE 1 APPLICAZIONI 1 Introduzione 1 Sequenziamento


Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di


Ibridizzazione in situ

Ibridizzazione in situ ANALISI DELL RNA Northen blot E un metodo simile a quello di traferimento e di ibridizzazione del DNA (Southern blot) e si usa per sondare molecole di RNA. Gli mrna sono molecole brevi, in genere meno


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte


Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA

Sequenziamento del DNA. Preparazione di librerie. Library di cdna e di DNA genomico. Analisi di librerie. Sequenziamento del DNA Sequenziamento del DNA Preparazione di librerie Library di cdna e di DNA genomico Analisi di librerie Sequenziamento del DNA 1) Metodo di Maxam&Gilbert (taglio chimico): il DNA viene marcato ad un estremità


RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.


Tecniche Diagnostiche molecolari

Tecniche Diagnostiche molecolari Tecniche Diagnostiche molecolari Tecniche di Biologia Molecolare La scoperta che il DNA è alla base di tutte le funzioni della cellula ha aperto la strada allo sviluppo di una disciplina denominata biologia


di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento


Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione

Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3. Criteri di identificazione Identificazione dei microrganismi mediante tecniche di biologia molecolare Esercitazione n 3 Criteri di identificazione Tradizionale (fenotipo) Tecniche di biologia molecolare Il livello di risoluzione


PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92

PROGETTO BIOFORM Corso didattico sperimentale. Esercizio. Tipizzazione del gene PV92 PROGETTO BIOFORM Corso didattico sperimentale Esercizio Tipizzazione del gene PV92 Elementi trasponibili Che cosa sono gli elementi trasponibili? Sono segmenti di DNA che sono in grado di trasferirsi in


PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi

PROGETTO DNA chiavi in mano. Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano Le Biotecnologie in classe e in laboratorio 11/03/2015 Prof.ssa Paola Cazzani I.T.E. A. Bassi - Lodi PROGETTO DNA chiavi in mano PROGETTO DNA chiavi in mano IFOM PROGETTO DNA



DNA RICOMBINANTE E BIOTECNOLOGIE DNA RICOMBINANTE E BIOTECNOLOGIE INDICE DNA ricombinante e sue applicazioni Tecniche del DNA ricombinante Inserzione di un gene in un plasmide Progetto Genoma Umano Biotecnologie e loro applicazioni Organismi


Esperienza 3: clonaggio di un gene in un plasmide

Esperienza 3: clonaggio di un gene in un plasmide Esperienza 3: clonaggio di un gene in un plasmide Il clonaggio molecolare è una delle basi dell ingegneria genetica. Esso consiste nell inserire un frammento di DNA (chiamato inserto) in un vettore appropriato


Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi


Retrovirus, DNA ricombinante e PCR (seconda parte). LA LEZIONE

Retrovirus, DNA ricombinante e PCR (seconda parte). LA LEZIONE Retrovirus, DNA ricombinante e PCR (seconda parte). LA LEZIONE Polymerase chain reaction (PCR) Il metodo della reazione a catena della polimerasi è stato ideato nel 1983 da Kary B. Mullis, che nel 1993


CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi


Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA

Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010. Percorso nº 3: Clonaggio di segmenti di DNA Corso di Laurea in Biotecnologie Anno-Accademico 2009-2010 Percorso nº 3: Clonaggio di segmenti di DNA 11-5-2010 I plasmidi: un mondo da esplorare. Elementi genetici capaci di replicarsi autonomamente





Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di


Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)


Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando


Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica



LA TECNOLOGIA DEL DNA RICOMBINANTE UNITÀ VET. DIDATTICA DI BIOLOGIA MOLECOLARE LA TECNOLOGIA DEL DNA RICOMBINANTE Roberto Giacominelli Stuffler 1. Gli enzimi di restrizione 2. La trascrittasi inversa 3. Il DNA ricombinante 4. La PCR 2 GLI





SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Dott.ssa Quintarelli Concetta

Dott.ssa Quintarelli Concetta Dott.ssa Quintarelli Concetta Estrazione e quantizzazione degli acidi nucleici Pre-PCR Accetazione Post-PCR Refertazione Area PCR GUANTI MONOUSO PUNTALI CON FILTRO CESTELLO PER GHIACCIO TUBINI PCR Materiale


Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 3 Biotecnologie avanzate 3 L evoluzione delle biotecnologie Le biotecnologie hanno conosciuto un evoluzione continua, grazie anche agli avanzamenti tecnologici. Infatti


I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene



REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità


SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno


U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test

U.O.C. di Epatologia Clinica e Biomolecolare. Unità di misura. Repertorio. 200 ml 10.000 U. 500 test U.O.C. di Epatologia Clinica e Biomolecolare Lotto N. DESCRIZIONE PRODOTTO Quantità annua richiesta Unità di misura Repertorio CND Codice Prodotto, Confezione Offerta e nome commerciale Prezzo unitario



DNA - DENATURAZIONE E RIASSOCIAZIONE DNA - DENATURAZIONE E RIASSOCIAZIONE Il doppio strand della molecola di DNA può denaturarsi dando due singoli strand ad alte temperature (>90 C). Due strand di DNA complementari possono accoppiarsi dando


Genotipizzazione virale

Genotipizzazione virale Genotipizzazione virale Typing Separazione basata su maggiori differenze genetiche tra i membri di una singola specie virale Subtyping Individuazione di differenze stabili all interno di un gruppo di virus


Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Prof. Giorgio Gallinella Prof.ssa Giovanna Gentilomi Dott.ssa Francesca Bonvicini (ricercatore) Dott.ssa Elisabetta Manaresi


Esperienza 2: gli enzimi di restrizione

Esperienza 2: gli enzimi di restrizione Esperienza 2: gli enzimi di restrizione Gli enzimi di restrizione sono delle proteine sintetizzate dai batteri per proteggersi dalle infezioni virali (batteriofagi). Questi enzimi tagliano il DNA virale


Un nuovo approccio: la VEQ in biologia molecolare

Un nuovo approccio: la VEQ in biologia molecolare Un nuovo approccio: la VEQ in biologia molecolare Il crescente interesse nella biologia molecolare applicata alla diagnostica è il risultato dei profondi progressi ottenuti nelle conoscenze scientifiche


Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria


Ibridazione degli acidi nucleici

Ibridazione degli acidi nucleici Ibridazione degli acidi nucleici L ibridazione consiste nel porre a contatto acidi nucleici a singolo filamento provenienti da fonti diverse: Sonda di solito una popolazione omogenea di molecole note.


Campi di applicazione degli animali transgenici. Miglioramento delle caratteristiche produttive delle specie da allevamento

Campi di applicazione degli animali transgenici. Miglioramento delle caratteristiche produttive delle specie da allevamento Campi di applicazione degli animali transgenici Miglioramento delle caratteristiche produttive delle specie da allevamento Bioreattori per la produzione di proteine di interesse biotecnologico e farmaceutico






ELETTROFORESI SU GEL ELETTROFORESI SU GEL Permette la separazione di frammenti di DNA/RNA da una miscela complessa E una tecnica fondamentale per: l analisi (elettroforesi analitica) la purificazione degli acidi nucleici (elettroforesi


Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o


Polimorfismi LEZIONE 6. By NA 1

Polimorfismi LEZIONE 6. By NA 1 Polimorfismi LEZIONE 6 By NA 1 * Polimorfismo Variazione presente nella popolazione con una frequenza superiore a 1% Variazioni nell aspetto By NA 2 Polimorfismo proteico Variazione presente nella popolazione


Analisi del DNA genomico mediante Southern Blot Hybridization

Analisi del DNA genomico mediante Southern Blot Hybridization Analisi del DNA genomico mediante Southern Blot Hybridization Permette la mappatura dei siti di restrizione attorno al frammento di DNA genomico per il quale si dispone di una sonda specifica a) Il DNA


C.d.L. Scienze Biosanitarie e Farmaceutiche Corso di Microbiologia e Biotecnologie dei Microrganismi

C.d.L. Scienze Biosanitarie e Farmaceutiche Corso di Microbiologia e Biotecnologie dei Microrganismi C.d.L. Scienze Biosanitarie e Farmaceutiche Corso di Microbiologia e Biotecnologie dei Microrganismi AA 2007 2008 BIOTECNOLOGIE DEI MICRORGANISMI Università degli Studi di Bari - Scienze Biosanitarie e


Protocollo Crime Scene Investigation

Protocollo Crime Scene Investigation Protocollo Crime Scene Investigation Precauzioni da adottare in laboratorio: - non mangiare o bere - indossare sempre i guanti quando si maneggiano i tubini, i gel, le micropipette - nel dubbio, chiedere!


Le biotecnologie e l ingegneria genetica 1

Le biotecnologie e l ingegneria genetica 1 Le biotecnologie e l ingegneria genetica 1 Le biotecnologie... Molti prodotti alimentari, come il pane, il vino e lo yogurt, da migliaia di anni presenti sulle nostre tavole, sono vivi, perché nella loro


Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi


Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1

Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1 Uso di vettori lentivirali per trasdurre linee cellulari di adenocarcinoma colorettale con shrnas silenzianti il gene herg1 e loro applicazione in studi pre-clinici. Il trasferimento genico è una tecnologia


la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357.

la probabilità q di avere un ricombinante è 0,286/2 = 0,143; la probabilità p di avere un parentale è quindi (1-0,286)/2 = 0,714/2 = 0,357. Analizziamo i figli: per 3 volte A è stato trasferito insieme a B e per 2 volte a insieme a b (5 parentali); per 2 volte A con b e B con a (2 ricombinanti). Secondo l ipotesi dell indipendenza, ci aspettiamo


Ingegneria Genetica e Microbiologia Applicata

Ingegneria Genetica e Microbiologia Applicata Corso di Laurea in Biotecnologie Anno Accademico 2009-2010 Ingegneria Genetica e Microbiologia Applicata Percorso n 3: Clonaggio di segmenti di DNA Settima esercitazione - 13 maggio 2010 F 1 1 1: taglio


Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica

Biologia molecolare clinica. Organizzazione del laboratorio di biologia molecolare clinica Biologia molecolare clinica Organizzazione del laboratorio di biologia molecolare clinica Le tecniche di biologia molecolare negli ultimi anni si sono diffuse nei laboratori di diagnostica clinica dove



ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo ISOLAMENTO E PURIFICAZIONE DEGLI ACIDI NUCLEICI prof.ssa Daniela Gallo INTRODUZIONE Acidi nucleici Gli acidi nucleici sono una famiglia eterogenea di macromolecole distribuite all interno di tutte le cellule


Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,



INFEZIONE DA HIV ED AIDS WWW.SLIDETUBE.IT INFEZIONE DA HIV ED AIDS HIV 1 ed HIV 2 appartengono alla famiglia dei Retroviridae, genere lentovirus. L infezione da HIV provoca nell ospite una progressiva compromissione delle difese immunitarie, soprattutto


LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,



DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac



DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA CLM Biotecnologie per l Alimentazione CLM in Biotecnologie Sanitarie Corso di Chimica e certificazione degli alimenti DETERMINAZIONE DI ENTEROVIRUS IN CAMPONI DI ACQUA VIRUS ENTERICI virus escreti tramite


Esperienza 10: la PCR

Esperienza 10: la PCR Esperienza 10: la PCR La tecnica della polimerizzazione a catena (in inglese polymerase chain reaction) o PCR, permette di amplificare milioni di volte un unico frammento di DNA. Questo metodo è diventato


Lezione XLI-XLII martedì 17-1-2012

Lezione XLI-XLII martedì 17-1-2012 Lezione XLI-XLII martedì 17-1-2012 corso di genomica aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 Esami 31- gennaio 2012 7- febbraio 2012 28 - febbraio 2012 D. Frezza Esercitazione II


PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993).

PCR - Polymerase Chain Reaction. ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). End point PCR vs quantitative Real-Time PCR PCR - Polymerase Chain Reaction ideata nel 1983 da Kary B. Mullis il quale ottenne, per questo, il premio Nobel per la chimica (1993). Questa tecnica, utilizzando


DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi.

DNA footprinting. Interazioni DNA-proteine. Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. Interazioni DNA-proteine Il promotore è la regione di DNA al 5 di un gene, dove si lega la RNA polimerasi. L analisi della sequenza dei primi promotori nei batteri non rivelò, come atteso, la stessa sequenza


Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona
