SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali"

Transcript

1 SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza di tutti i cromosomi. La genomica funzionale cerca di capire in che modo le sequenze genetiche producano le caratteristiche delle cellule e i caratteri degli organismi. Perlopiù la genomica funzionale ha lo scopo di comprendere la funzione dei geni. Tuttavia, essa cerca anche di capire i ruoli di altre sequenze genetiche come i centromeri e le sequenze ripetute. La proteomica si concentra sulle funzioni delle proteine. Lo scopo ultimo è di comprendere in che modo gruppi di proteine agiscano come unità integrate. C2. Ci sono due ragioni fondamentali per spiegare perché il proteoma è più grande del genoma. La prima riguarda la maturazione del pre-mrna, un fenomeno che avviene soprattutto nelle specie eucariotiche. Lo splicing e l editing possono alterare la sequenza codificante dell mrna e quindi produrre forme alternative delle proteine con diverse sequenze aminoacidiche. La seconda regione riguarda le modificazioni post-traduzionali. Ci sono molti modi con cui la struttura di una determinata proteina può essere modificata covalentemente mediante gli enzimi cellulari. Questi includono per esempio la maturazione mediante proteolisi, la formazione di legami disolfuro, la glicosilazione, l aggiunta di lipidi, la fosforilazione, la metilazione, e l acetilazione. C3. Un database è una raccolta di molti file in un singolo archivio elettronico. Questi dati sono solitamente sequenze di DNA, RNA oppure di proteine. I dati derivano dal lavoro di numerosi laboratori di ricerca. Lo scopo principale di un database genomico è quello di organizzare l'informazione genetica di una singola specie. Un database genomico identificherà tutti i geni noti e indicherà le loro localizzazioni di mappa nel genoma. Inoltre, un database genomico può contenere altri tipi di informazioni, come una breve descrizione della sequenza, il nome dell'organismo dal quale è stata ottenuta la sequenza, e la funzione della proteina codificata, se nota. C4. Le sequenze centromeriche, le origini di replicazione, le sequenze telomeriche, le sequenze ripetute, e gli enhancer. Sono possibili anche altri esempi. C5. Il riconoscimento di sequenza si riferisce all identificazione informatica di una particolare sequenza, la cui funzione è già nota. Per esempio, un programma può identificare il sito dei codoni d'inizio (ATG) in una sequenza di DNA. Per confronto il riconoscimento di un pattern si basa su di un insieme di simboli ma non è necessariamente legato a particolari sequenze. C6. Ci sono alcune osservazioni interessanti. Le sequenze 1 e 2 sono simili tra loro, come lo sono le sequenze 3 e 4. Ci sono alcuni siti in cui i residui aminoacidici sono conservati nelle cinque sequenze. Questi aminoacidi possono essere particolarmente importanti per la funzione. C7. In genetica, il termine similarità significa che due sequenze genetiche sono simili tra loro. Omologia significa che due sequenze genetiche si sono evolute a partire da una sequenza ancestrale comune. Le sequenze omologhe sono simili tra loro, ma non tutte le brevi sequenze simili sono attribuibili all'omologia.

2 C8. A. Corretto B. Corretto C. Errato. Queste sono brevi sequenze genetiche simili tra loro. L operone lac e l operone trp non sono derivati da uno stesso operone ancestrale. D. Errato. I due geni sono omologhi tra loro, è corretto dire che le loro sequenze sono identiche al 60%. C9. Un'interruzione è necessaria quando due sequenze omologhe non sono della stessa lunghezza. Siccome le sequenze omologhe sono derivate dallo stesso gene ancestrale, due sequenze omologhe erano in origine della stessa lunghezza. Tuttavia, durante l'evoluzione le sequenze possono andare incontro a delezioni e/o inserzioni che le rendono più lunghe oppure più corte rispetto al gene originale. Se un gene subisce una delezione, sarà necessario inserire un'interruzione nella sequenza genica per allinearla al gene omologo. Se avviene un'inserzione nella sequenza del gene, sarà indispensabile inserire un'interruzione in una sequenza genica omologa per allineare le due sequenze. Domande sperimentali S1. Una libreria sottrattiva di cdna contiene i cdna ottenuti dagli mrna prodotti in un insieme determinato di condizioni ma non in altre. Per esempio, come descritto nella Figura 21.1, una libreria sottrattiva di cdna può contenere solamente i cdna ottenuti dagli mrna prodotti da cellule esposte a un ormone. Questo rappresenta un modo per identificare i geni che sono stati indotti in presenza dell'ormone. S2. Come descritto nel problema risolto R1, una ragione per costruire una libreria di cdna è quella di determinare quali RNA vengono prodotti quando cambiano le condizioni ambientali. Devi caricare sulla colonna una piccola quantità di cdna derivante dalle cellule esposte al mercurio. Ricorda che il cdna derivato dall mrna che è stato prodotto in assenza di mercurio è già legato alla colonna. Desideri che il cdna sintetizzato in presenza di mercurio si leghi a questo cdna se esso è complementare. Se viene caricato troppo cdna, tutti i cdna saranno legati ai loro complementari, e alcuni non si legheranno alla colonna, anche se possono essere complementari ai cdna. In altre parole, se carichi troppo cdna (ottenuto a partire dalle cellule esposte al mercurio), avrai saturato i siti di legame per i cdna che sono stati ottenuti in assenza di mercurio. Questo non è ideale, perché desideri che attraversino la colonna solamente i cdna che sono derivati dagli mrna espressi specificamente in presenza di mercurio. Questi cdna non sono complementari a nessuna molecola di cdna legata alla colonna. S3. A. Un microarray di DNA è un piccolo vetrino sul quale sono stati deposti molti frammenti diversi di DNA. In alcuni microarray, i frammenti di DNA, che vengono prodotti per sintesi (cioè mediante PCR), vengono deposti singolarmente sul vetrino. I frammenti di DNA sono lunghi tipicamente dalle 500 alle 5000 bp, e ne vengono distribuiti da poche migliaia a decine di migliaia. Alternativamente, dei brevi oligonucleotidi possono essere sintetizzati direttamente sulla superficie del vetrino. In questo processo, la sequenza di DNA in un determinato spot viene prodotta mediante il controllo selettivo dell'allungamento dell'oligonucleotide usando precisi fasci di luce. In questo caso, possono essere deposti centinaia di migliaia di frammenti. B. Nella maggioranza dei casi, il cdna marcato con fluorescenza viene ibridato con il microarray, sebbene possano essere utilizzati anche DNA genomico oppure RNA.

3 C. Dopo l'ibridazione, l'array viene lavato e visualizzato mediante un microscopio confocale che scansiona ciascun pixel (l'elemento più piccolo di un'immagine). Dopo avere eliminato il segnale di fondo, l'intensità finale della fluorescenza di ogni spot viene calcolata come media dei pixel che costituiscono ciascuno spot. I risultati sono costituiti da un gruppo di macchie fluorescenti in posizioni definite del microarray. S4. Il cdna marcato con fluorescenza verde è derivato dall mrna ottenuto precocemente dalle cellule, quando i livelli di glucosio erano alti. Gli altri campioni di cdna sono derivati da cellule raccolte in momenti successivi, quando i livelli di glucosio stavano diminuendo e quando si stava verificando lo shift diauxico. Questi erano colorati con fluorescenza rossa. La fluorescenza verde fornisce il livello base di espressione quando il glucosio è elevato. Nelle fasi successive, se il rapporto rosso/verde è elevato (cioè maggiore di uno), questo significa che un gene risulta attivato al diminuire dei livelli di glucosio, perché ci sono più cdna rossi che verdi. Se il rapporto è basso (cioè inferiore a uno) questo significa che un gene viene represso. S5. L'analisi dei cluster è un modo per analizzare i dati dei microarray di DNA. Usando un computer, i dati vengono analizzati per determinare se alcuni gruppi di geni manifestano gli stessi profili di espressione in determinate condizioni, come è illustrato nella sezione Dati della Figura EG (Esperimento di genetica 21.1 sul sito internet). Alcuni gruppi di geni formano dei gruppi (cluster) che sono accomunati da profili di espressione molto simili. Questo è utile perché permette di identificare i geni che partecipano a una funzione cellulare comune. S6. Nella prima dimensione (quindi nel gel allungato), le proteine migrano verso il punto dove la loro carica netta è zero. Nella seconda dimensione, le proteine in presenza di SDS si separano secondo la loro massa molecolare. S7. Sì, l'elettroforesi bidimensionale può essere utilizzata come tecnica di purificazione. Uno spot in un gel bidimensionale può essere tagliato e asportato, e la proteina può esserne eluita. Questa proteina purificata può essere sottoposta alla spettrometria di massa in tandem per determinarne la sequenza. Deve essere ricordato, tuttavia, che l'elettroforesi bidimensionale non viene utilizzata per purificare le proteine nel loro stato funzionale. L'esposizione all'sds nella seconda dimensione denatura le proteine e probabilmente ne inattiva la funzione. S8. Nella spettrometria di massa in tandem, il primo spettrometro determina la massa di un frammento peptidico della proteina di interesse. Il secondo spettrometro determina le masse di frammenti progressivamente più piccoli derivanti da quel peptide. Dato che le masse di ciascun aminoacido sono note, le masse molecolari di questi frammenti più piccoli rivelano la sequenza aminoacidica del peptide. Con l informazione della sequenza del peptide, è possibile utilizzare il codice genetico e ottenere le sequenze di DNA che potrebbero codificare quel peptide. A causa della degenerazione del codice genetico è possibile più di una sequenza. Queste sequenze sono utilizzate per interrogare un database genomico, che fornirà con buone probabilità una sequenza corrispondente. La sequenza genomica può poi essere analizzata per determinare l intera sequenza codificante per la proteina di interesse. S9. I due tipi generali di microarray di proteine sono i microarray di anticorpi e gli array di proteine funzionali. In un microarray di anticorpi, vengono deposte numerose molecole di anticorpi diversi, ciascuna che riconosce una sequenza peptidica diversa. Le proteine cellulari vengono isolate, marcate con fluorescenza ed esposte al microarray. Quando una proteina viene riconosciuta da un anticorpo, sarà catturata e rimarrà legata allo spot. Dato che ogni anticorpo riconosce una diversa sequenza peptidica, questo microarray può essere utilizzato per monitorare i livelli di espressione proteica. Un microarray di proteine funzionali prevede la purificazione delle proteine funzionali e la loro deposizione su un vetrino. Questo tipo di

4 microarray può essere analizzato rispetto alla specificità di substrato, di legame a specifiche sostanze, e/o alle interazioni proteina/proteina. S10. Una strategia è quella di utilizzare la ricerca di segnale, che si basa su sequenze note come i promotori, i codoni d inizio e di stop, i siti di splicing, per aiutarci a predire se una sequenza contiene, o meno, un gene strutturale. L approccio cerca di identificare una regione che contiene una sequenza promotore, seguita da un codone d inizio, e un codone di stop. Una seconda strategia si basa sull approccio della ricerca per contenuto. Lo scopo è quello di identificare le sequenze il cui contenuto di nucleotidi si differenzi in modo significativo da una distribuzione casuale, che è solitamente attribuibile all uso preferenziale dei codoni. L approccio della ricerca per contenuto cerca di localizzare le regioni codificanti identificando le zone dove il contenuto di nucleotidi manifesta una preferenzialità di scelta. Un terzo metodo per localizzare i geni strutturali è quello di cercare lunghi moduli di lettura aperti (ORF) all interno di una sequenza di DNA. Un ORF è una sequenza che non contiene codoni di stop. S11. Un motivo è una sequenza che svolge una particolare funzione. Ci sono motivi promotore, motivi enhancer, e motivi aminoacidici che svolgono ruoli funzionali nelle proteine. In una lunga sequenza genetica, un computer può analizzare la sequenza e identificare i motivi con elevata velocità e accuratezza. L'identificazione dei motivi aminoacidici permette ai ricercatori di capire la funzione di una particolare proteina. S12. Interrogando un database, è possibile identificare le sequenze genetiche che sono omologhe a una sequenza appena determinata. Nella maggior parte dei casi, le sequenze omologhe svolgono funzioni identiche oppure molto simili. Perciò, se viene identificato un elemento di un database omologo la cui funzione è già nota, questo fornisce un informazione importante rispetto alla funzione della sequenza appena determinata. S13. In un approccio comparativo, si utilizzano le sequenze di molti geni omologhi. Questo metodo assume che gli RNA con sequenze e funzioni simili abbiano una struttura simile. Per esempio, i programmi informatici possono confrontare molte sequenze di RNA 16S per prevederne la struttura secondaria. S14. La base per la predizione della struttura secondaria è che alcuni aminoacidi tendono ad essere presenti più frequentemente nelle α eliche o nei foglietti β. Questa informazione è stata ottenuta dalla frequenza statistica degli aminoacidi nelle strutture secondarie che sono già state cristallizzate. L accuratezza dei metodi predittivi è circa del 60-70%, il che non è soddisfacente. S15. Prima di poter predire la struttura terziaria di una proteina di interesse sulla base della sua sequenza aminoacidica, la struttura tridimensionale di una proteina omologa deve essere già stata risolta mediante cristallografia ai raggi X. S16. Il programma BACKTRANSLATE si basa sulla conoscenza del codice genetico. Ogni aminoacido corrisponde a uno o più codoni (sequenze di tre basi) che sono specificate dal codice genetico. Questo programma produrrà un singolo file con una sequenza di basi nucleotidiche. Il programma BACKTRANSLATE produrrà una sequenza basica degenerata perché il codice genetico è degenerato. Per esempio, la lisina può essere specificata da AAA oppure AAG. Il programma probabilmente genera un file singolo con una base degenerata in quella posizione. Per esempio, se la sequenza aminoacidica fosse lisina-metionina-glicinaglutamina, il programma produrrebbe la seguente sequenza 5 AA(A/G)ATGGG(T/C/A/G)CA(A/G)

5 Le basi indicate tra parentesi sono le basi possibili a causa della degenerazione del codice genetico. S17. I vantaggi di utilizzare un programma informatico sono la velocità e l'accuratezza. Una volta realizzato il programma, e avere inserito la sequenza nel computer, il programma è in grado di analizzare lunghe sequenze genetiche velocemente e in modo accurato. S18. A. Per identificare uno specifico elemento trasponibile, il programma userà il riconoscimento di sequenza. La sequenza degli elementi P è già nota. Al programma sarà fornita questa informazione e analizzerà un file di sequenza per cercare una corrispondenza. B. Per identificare un codone di stop, il programma userà il riconoscimento di sequenza. Esistono tre codoni di stop, che sono specifiche sequenze di tre basi. Al programma saranno fornite queste sequenze di tre basi e il software analizzerà la sequenza per identificare una corrispondenza perfetta. C. Per identificare un inversione di qualsiasi tipo, il programma utilizzerà il riconoscimento di un pattern. In questo caso il programma cercherà un pattern nel quale la stessa sequenza sia presente in direzioni opposte rispetto ai due file di sequenza. D. Per identificare i geni, una ricerca mediante l approccio di segnale usa sia il riconoscimento di sequenza che il riconoscimento di un pattern. Esso cerca un organizzazione degli elementi funzionali che costituirebbero un gene funzionale. Un approccio della ricerca per contenuto identifica i geni sulla base dei pattern, non sulla base degli elementi funzionali specifici. Questo approccio cerca un pattern nel quale il contenuto in nucleotidi sia diverso da una distribuzione casuale. Il terzo approccio per identificare un gene è l analisi di una sequenza genetica per identificare un lungo modulo di lettura aperto. Questo approccio è una combinazione di un riconoscimento di sequenza e riconoscimento di un pattern. Il programma ricerca elementi funzionali specifici (per esempio codoni di stop), ma cerca anche un pattern nel quale i codoni di stop siano lontani tra loro. S19. Un elemento funzionale è una sequenza specializzata (ossia una sequenza di basi oppure di aminoacidi) con un particolare significato o funzione. Due esempi possono essere un codone di stop (per esempio UAA), che è un elemento funzionale di basi, e una sequenza di aminoacidi che rappresenta un sito di glicosilazione (per esempio asparagina-qualsiasi aminoacido-serina oppure treonina, che è un elemento funzionale di aminoacidi oppure un motivo. Il programma informatico non crea questi elementi funzionali. Al programma vengono fornite le informazioni riguardanti gli elementi funzionali, e quest'informazione deriva dalla ricerca genetica. Gli scienziati hanno svolto degli esperimenti per identificare le sequenze di basi che costituiscono un codone di stop e le sequenze di aminoacidi che vengono glicosilate. Dopo che queste informazioni si sono rese disponibili grazie alla ricerca, esse possono essere inserite nei programmi informatici, che possono quindi analizzare nuove sequenze genetiche e identificare la presenza e la posizione dei codoni di stop e dei siti di glicosilazione. S20. A. E più probabile che gli aminoacidi più conservati (gli stessi in tutti i membri della famiglia) siano importanti per la struttura e/o la funzione. Questo perché una mutazione che cambi l aminoacido potrebbe alterare la struttura e la funzione, e questi tipi di mutazioni saranno selezionati a sfavore. Aminoacidi completamente conservati sono presenti nelle seguenti posizioni: 101, 102, 105, 107, 108, 116, 117, 124, 130, 134, 139, 143, e 147.

6 S21. B. E più probabile che gli aminoacidi meno conservati non siano molto importanti perché le variazioni nell aminoacido non sembrano inibire la funzione (altrimenti, la selezione naturale avrebbe eliminato questa mutazione). In un sito, la posizione 118, ci sono cinque diversi aminoacidi. A. Siccome la maggior parte delle sequenze della famiglia contengono una istidina, questo sembra essere il codone ancestrale. Il codone per l'istidina è mutato in un codone per l'arginina dopo la duplicazione genica che ha generato il gene della ζ globina. Questo sarebbe avvenuto dopo la comparsa dei primati ossia tra 10 e i 20 milioni di anni fa. B. Non sappiamo se il gene della globina ancestrale avesse una glicina oppure una prolina in posizione 121. La mutazione probabilmente è avvenuta dopo la duplicazione che ha generato la famiglia delle globine α e delle globine β, ma prima delle duplicazioni geniche che ha prodotto le copie multiple delle α e β globine, rispettivamente nel cromosoma 16 e 11. Perciò, essa è avvenuta tra i 300 e i 200 milioni di anni fa. C. Tutte le globine β possiedono un acido glutammico in posizione 103, e tutte le α-globine, eccetto la θ globina, presentano una valina. Non sappiamo se il gene ancestrale della globina avesse una valina oppure un acido glutammico nel codone 121. Tuttavia, una mutazione, che ha convertito l'uno nell'altro, è probabilmente avvenuta dopo la duplicazione che ha generato la famiglia della α-globine e delle β-globine, ma prima delle duplicazioni geniche che hanno prodotto le copie multiple delle α e β globine, rispettivamente nel cromosoma 16 e 11. Perciò, essa è avvenuta tra 300 e i 200 milioni di anni fa. La mutazione che ha generato il codone per l'alanina nel gene della θ globina è probabilmente avvenuta dopo la duplicazione genica che ha prodotto questo gene. Ciò si sarebbe verificato dopo la comparsa dei mammiferi (cioè negli ultimi 200 milioni di anni). S22. Questa sequenza è all interno del gene lacy dell operone lac di E. coli. I nucleotidi sono descritti nel paragrafo S23. Come descritto nella parte C del problema risolto R2, è probabile che il codone ancestrale codificasse serina. Consultando la tabella del codice genetico, un codone AGU oppure AGC della serina potrebbero mutare, mediante la sostituzione di una sola base, nel codone per Asn, Thr, oppure Ile. Al contrario, i codoni UCU, UCC, UCA, e UCG, che codificano ugualmente per la serina, non possono mutare in codoni per Asn oppure Ile con la variazione di una sola base. Perciò, i due possibili scenari sono illustrati di seguito. La base mutata è sottolineata. Le mutazioni avvengono a livello del DNA, sebbene siano indicate le sequenze dei codoni di RNA. Codone ancestrale ACU (Thr) AGU (Ser) AAU (Asn) AUU (Ile) Codone ancestrale ACC (Thr) AGC (Ser) AAC (Asn)

7 S24. AUC (Ile) A. Questa sequenza ha due regioni molto idrofobiche e lunghe circa 20 aminoacidi. Perciò, è probabile che questo polipeptide abbia due segmenti transmembrana. B. Esterno Membrana plasmatica Citoplasma S25. La struttura secondaria di un RNA è basata sulla capacità delle sequenze complementari (cioè le sequenze che seguono la regola dell'appaiamento AU/GC) di formare una doppia elica. Il programma impiega un approccio di riconoscimento di un pattern. Esso cerca le sequenze complementari sulla base della regola dell'appaiamento AU/GC. S26. A. Vero B. Falso. I programmi sono accurati solamente per il 60-70%. C. Vero

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 2 Analisi del DNA e delle proteine 3 Analizzare DNA e proteine Per le applicazioni delle biotecnologie è di fondamentale importanza: 1. essere in grado di identificare

Dettagli

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica:

Cenni storici. Tale tecnica trova largo impiego in tutte le aree di ricerca biologica: DNA Microarray: griglia di DNA costruita artificialmente, in cui ogni elemento della griglia riconosce una specifica sequenza target di RNA o cdna. Tale tecnica trova largo impiego in tutte le aree di

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

V. TRASCRIZIONE E TRADUZIONE DEL DNA

V. TRASCRIZIONE E TRADUZIONE DEL DNA V. TRASCRIZIONE E TRADUZIONE DEL DNA 0) CONCETTI BASE La trasformazione delle informazioni genetiche in proteine richiede due passaggi: la trascrizione del DNA in mrna e la traduzione dell mrna in una

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Seminario. Domini modulari delle proteine 1

Seminario. Domini modulari delle proteine 1 Seminario Proteine della matrice DOMINI E MODULI Domini modulari delle proteine 1 La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette

Dettagli

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2

DOMINI E MODULI 02/04/2014. Domini modulari delle proteine 2 Domini modulari delle proteine 1 Proteine della matrice DOMINI E MODULI La maggior parte dei peptidi consiste in disposizioni lineari di regioni globulari, ripiegate in modo indipendente, dette domini,

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

SEQUENZIAMENTO DEL DNA

SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

Microarray. (in parte da Wikipedia)

Microarray. (in parte da Wikipedia) Microarray (in parte da Wikipedia) Un DNA microarray (comunemente conosciuto come gene chip, DNA chip, o biochip) è costituito da una collezione di microscopiche sonde di DNA attaccate ad una superficie

Dettagli

Bioinformatica. Marin Vargas, Sergio Paul

Bioinformatica. Marin Vargas, Sergio Paul Bioinformatica Marin Vargas, Sergio Paul 2013 Wikipedia: La bioinformatica è una disciplina scientifica dedicata alla risoluzione di problemi biologici a livello molecolare con metodi informatici. La bioinformatica

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i

Le pr p in i c n ip i ali ali st s rategie ie i d regola zio i n o e n d e d ll esp s re p ss s ion ion g ni n c i a n e n i i pr p oc o ariot i i Le principali strategie di regolazione dell espressione genica nei procarioti Regolazione metabolica Nel genoma di un microorganismo sono presenti migliaia di geni (3000-6000). Alcuni geni vengono espressi

Dettagli

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4

Indice. Dalla sequenza alla struttura. 1.0 Visione d insieme: funzione e architettura delle proteine 2. 1.1 Gli amminoacidi 4 Indice Prefazione XIII Protein Data Bank: una nota degli autori XIV Nota all edizione italiana XV Ringraziamenti XVI CAPITOLO 1 Dalla sequenza alla struttura 1.0 Visione d insieme: funzione e architettura

Dettagli

La sintesi delle proteine

La sintesi delle proteine La sintesi delle proteine Struttura del trna In che modo l informazione contenuta sotto forma di sequenze nucleotidiche nel DNA e nell RNA si traduce nella sequenza amminoacidica delle proteine? Esperimenti

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso

Dettagli

Diagnosi genetiche molecolari

Diagnosi genetiche molecolari Diagnosi genetiche molecolari INDICAZIONI per la diagnosi genetica Ricorrenza nella famiglia di una malattia genetica - identificazione dei portatori - confermare la diagnosi basata sul quadro clinico

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

Amminoacidi e Proteine

Amminoacidi e Proteine Amminoacidi e Proteine Struttura generale di un α-amminoacido R = catena laterale AMMINOACIDI (AA) CELLULARI Gli amminoacidi presenti nella cellula possono essere il prodotto di idrolisi delle proteine

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

Lezioni di biotecnologie

Lezioni di biotecnologie Lezioni di biotecnologie 2 Lezione 3 Biotecnologie avanzate 3 L evoluzione delle biotecnologie Le biotecnologie hanno conosciuto un evoluzione continua, grazie anche agli avanzamenti tecnologici. Infatti

Dettagli

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono

Nel 1997 un gruppo di ricercatori dell Università di Monaco, guidato. Genomi e genomica. DOMANDE CHIAVE Come si ottengono Genomi e genomica 14 DOMANDE CHIAVE Come si ottengono le sequenze del DNA genomico? Come viene decifrata l informazione contenuta nel genoma? Che cosa può rivelare la genomica comparata sulla struttura

Dettagli

Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia

Dettagli

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica

Maria Antonietta Lepore. Principali tecniche di biologia molecolare clinica Maria Antonietta Lepore Principali tecniche di biologia molecolare clinica Copyright MMIX ARACNE editrice S.r.l. www.aracneeditrice.it info@aracneeditrice.it via Raffaele Garofalo, 133 a/b 00173 Roma (06)

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente

. Per basse concentrazioni di substrato la velocità cresce proporzionalmente 21) Il ph influenza l'attività enzimatica modificando la struttura del sito attivo con il cambiamento della distribuzione delle cariche coinvolte nei legami tra il substrato e il sito attivo. L'intervallo

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012

La Proteomica e sue applicazioni in Microbiologia. M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 La Proteomica e sue applicazioni in Microbiologia M.FAVARATO ULSS 13 MIRANO (VE) Pordenone 05 maggio 2012 Dal gene alla proteina Sequenza nucleotidica Espressione genica Struttura terziaria taggattccggaaatttcgatttac

Dettagli

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario

Il DNA e la duplicazione cellulare. Acidi nucleici: DNA, materiale ereditario Il DN e la duplicazione cellulare Il DN, materiale ereditario Struttura del DN Replicazione del DN Dal DN alla proteina Il odice genetico iclo cellulare Mitosi Meiosi Da Figura 8-11 ampbell & Reece cidi

Dettagli

Gerarchia della struttura delle proteine

Gerarchia della struttura delle proteine Si indica con CONFORMAZIONE la disposizione tridimensionale degli atomi di una molecola, cioè la loro organizzazione spaziale. Gerarchia della struttura delle proteine struttura primaria: sequenza degli

Dettagli

Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato

Capitolo 17. Risposte alle domande interne al capitolo. 17.1 (p. 501) a. glicina. b. prolina. c. treonina. d. aspartato apitolo 17 Risposte alle domande interne al capitolo 17.1 (p. 501) a. glicina b. prolina c. treonina d. aspartato e. 17.2 (p. 501) a. La glicina è un aminoacido idrofobico. b. La prolina è un aminoacido

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

Codoni di STOP: UAA UAG UGA

Codoni di STOP: UAA UAG UGA PARTECIPANO ALLA TRADUZIONE: trna e aminoacidi Aminoacil-tRNA sintetasi Ribosomi mrna, che contiene una Open Reading Frame (ORF) CODONE DI INIZIO CODONE DI STOP 5 Cap NNNNNN AUG AAA GCA AUU----(n codoni)----uga

Dettagli

Biosintesi non ribosomiale di metaboliti peptidici bioattivi

Biosintesi non ribosomiale di metaboliti peptidici bioattivi Biosintesi non ribosomiale di metaboliti peptidici bioattivi Principali bersagli degli antibiotici Gli antibiotici derivano per la maggior parte da composti naturali Strutture di alcuni peptidi bioattivi

Dettagli

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo)

Regolazione della trascrizione. Operoni catabolici nei procarioti (controllo negativo) Regolazione della trascrizione Operoni catabolici nei procarioti (controllo negativo) I geni possono essere accesi e spenti In un organismo pluricellulare adulto, vi sono molti tipi di cellule differenti,

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare

Dettagli

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING

8-06-2010. BLOTTING degli acidi nucleici: RT-PCR SOUTHERN BLOTTING NORTHERN BLOTTING. BLOTTING delle proteine: NORTHERN BLOTTING SOUTHERN BLOTTING 8-06-2010 TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA BLOTTING degli acidi nucleici: RT-PCR REAL TIME PCR SOUTHERN BLOTTING NORTHERN BLOTTING NORTHERN BLOTTING BLOTTING delle proteine: MICROARRAYS MACROARRAYS

Dettagli

Continua. Peptidasi H 2 O

Continua. Peptidasi H 2 O Continua Peptidasi H 2 O Classificazione delle peptidasi 1. Meccanismo catalitico 2. Tipo di reazione catalizzata 3. Struttura molecolare e omologia 1. Meccanismo catalitico (mostrato per la chimotripsina)

Dettagli

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione

SINTESI PROTEICA. Replicazione. Trascrizione. Traduzione Replicazione SINTESI PROTEICA Trascrizione Traduzione 61 codoni codificanti 3 triplette non senso (STOP) AUG codone di inizio codone per Met Caratteristiche del codice genetico Specificità Il codice genetico

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale:

Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: Gli amminoacidi Gli amminoacidi sono dei composti polifunzionali che hanno formula generale: N 2 Il nome ordinario degli amminoacidi prevale su quello della nomenclatura IUPA. Si possono avere α-amminoacidi,

Dettagli

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA

I PROGETTI OMICI. Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA 1 I PROGETTI OMICI Studiano gli elementi biologici nel loro insieme TRASCRITTOMICA PROTEOMICA Studia il contenuto in mrna di una cellula (in differenti fasi di sviluppo, in risposta a vari stimoli o a

Dettagli

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA

DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? SI AUMENTA O SI DIMINUISCE L ESPRESSIONE DELLA PROTEINA DOMANDA FREQUENTE: QUALE E LA FUNZIONE DI UNA CERTA PROTEINA? OVERESPRESSIONE DELLA PROTEINA ESPRESSIONE ECTOPICA CON UN VETTORE DI ESPRESSIONE ABOLIZIONE DELLA ESPRESSIONE DELLA PROTEINA INTERFERENZA

Dettagli

Sequenziamento ed analisi dell esoma intero (All Exon)

Sequenziamento ed analisi dell esoma intero (All Exon) Sequenziamento ed analisi dell esoma intero (All Exon) Obiettivi La procedura ha l obiettivo di sequenziare solo le regioni trascritte e codificanti del genoma che rappresentano, almeno nell uomo, circa

Dettagli

Plasmidi come vettori di clonaggio

Plasmidi come vettori di clonaggio Plasmidi come vettori di clonaggio Un vettore plasmidico di buona qualità deve possedere le seguenti proprietà: 1. Piccole dimensioni (

Dettagli

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente

amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente Gli amminoacidi naturali sono α-amminoacidi : il gruppo amminico è legato all atomo di carbonio immediatamente adiacente al gruppo carbonilico e hanno la seguente formula generale: gruppo funzionale carbossilico

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio

LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni

Dettagli

Le proteine. Polimeri composto da 20 diversi aminoacidi

Le proteine. Polimeri composto da 20 diversi aminoacidi Le proteine Polimeri composto da 20 diversi aminoacidi (D. Voet, J.G. Voet, Biochemistry, 3 ed., John Wiley & Sons, 2004) PROTEINE come ATTUATORI nella cellula Trasporto elettronico Trasporto di ioni e

Dettagli

AMMINOACIDI E PROTEINE

AMMINOACIDI E PROTEINE AMMINOACIDI E PROTEINE Vengono chiamate amminoacidi quelle molecole organiche in cui sono contemporaneamente presenti sia un gruppo acido carbossilico -COO che un gruppo amminico -N2. Una molecola appartenente

Dettagli

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini

RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI E PROGNOSTICI DI MALATTIA. Marialuisa Zerbini Università di Bologna Dipartimento di Medicina Clinica Specialistica e Sperimentale Sezione di Microbiologia RUOLO DELL'HPV NELLA PATOGENESI DEL CARCINOMA DEL COLLO DELL'UTERO: FATTORI MOLECOLARI DIAGNOSTICI

Dettagli

Livello di organizzazione degli esseri viventi

Livello di organizzazione degli esseri viventi Livello di organizzazione degli esseri viventi _Organismo; _Apparato; _Organo; _Tessuti; _Cellule; _Organelli cellulari; _Molecole. Atomo, elemento, molecola, composto, formula, legame, elettronegativita.

Dettagli

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene

Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Sperimenta il BioLab Attività di Bioinformatica Caccia al gene Università degli Studi di Milano Settore Didattico, via Celoria 20, Milano Laboratorio 105 INTRODUZIONE Questa attività pratica ha come scopo

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI

Dettagli

Metodi di analisi mutazionale

Metodi di analisi mutazionale Metodi di analisi mutazionale I metodi impiegati per l analisi di mutazioni o polimorfismi nel DNA genomico possono essere suddivise in due principali categorie: (1) metodi per individuare mutazioni note,

Dettagli

RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Purificazione degli acidi nucleici

Purificazione degli acidi nucleici A cosa serve? Purificazione degli acidi nucleici DNA genomico: per costruire librerie genomiche e/o usato nell analisi d ibridazione Southern. mrna: sintesi del cdna; analisi d ibridazione Northern, o

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

Biosensori 3: Biosensori a DNA e Bio- Gene Chip

Biosensori 3: Biosensori a DNA e Bio- Gene Chip Biosensori 3: Biosensori a DNA e Bio- Gene Chip mazzei@di.unipi.it (materiale parzialmente tratto da: http://nestor.med.unibo.it/shared_files/seminari/sartini_21-10-2004.ppt) Biosensori ad affinità basati

Dettagli

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della

La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della La struttura dell RNA Struttura dell RNA mediante analisi comparativa Predizione della struttura secondaria: L algoritmo di Nussinov Predizione della struttura secondaria: Minimizzazione dell energia Un

Dettagli

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino

Strutture molecolari della cellula: Bio-macromolecole. Prof. C. Guarino Strutture molecolari della cellula: Bio-macromolecole Prof. C. Guarino INTRO Ogni cellula vivente racchiude una pluralità di molecole diverse L acqua è l elemento dominante, nelle cellule vegetali e nei

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 7 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 7 La struttura delle proteine Concetti chiave: La struttura terziaria di una proteina descrive il ripiegamentodei suoi elementi

Dettagli

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici

TECNICHE DI BIOLOGIA MOLECOLARE. LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici TECNICHE DI BIOLOGIA MOLECOLARE LA REAZIONE POLIMERASICA A CATENA Principi teorici e aspetti pratici POLYMERASE CHAIN REACTION (PCR) 1955 A. Kronembreg e coll. (Stanford University) scoprono la DNA-polimerasi

Dettagli

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b)

PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA

Dettagli

Analisi di sequenziamento degli acidi nucleici

Analisi di sequenziamento degli acidi nucleici Analisi di sequenziamento degli acidi nucleici In questa lezione darò qualche breve cenno sui metodi di sequenziamento del DNA e specialmente quelli con marcatura fluorescente che attualmente vengono effettuati

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il

Dettagli

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili.

Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. Meccanismi molecolari di trasduzione del segnale. Le vie di trasduzione del segnale sono molto specifiche ed estremamente sensibili. La sensibilita delle vie di trasduzione dipende da 3 fattori: -l affinita

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA)

ESPRESSIONE GENICA DOGMA CENTRALE DELLA BIOLOGIA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) ESPRESSIONE GENICA GENE (UNITÀ FUNZIONALE DEL DNA) (NUCLEO - NUCLEOIDE) mrna (CITOPLASMA) DOGMA CENTRALE DELLA BIOLOGIA ORGANIZZAZIONE GENE EUCARIOTICO PER UN mrna PROMOTORE TRASCRIZIONE 1) RNA POLIMERASI

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando

Dettagli

sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Corso di aggiornamento

Corso di aggiornamento I n t r o d u z i o n e a l l e t e c n i c h e d i bi o l o g i a m o l e c o l a r e e l o r o a p p l i c a z i o n i ne l L a b o r a t o r i o C l i n i c o Corso di aggiornamento Milano - Sabato

Dettagli

Bergamo 9 Ottobre. M.Scanziani Mfg Director Hospira S.p.A.

Bergamo 9 Ottobre. M.Scanziani Mfg Director Hospira S.p.A. Bergamo 9 Ottobre M.Scanziani Mfg Director Hospira S.p.A. Hospira Società Mondiale in specialità farmaceutiche e sistemi infusionali. Leader di mercato mondiale in: Farmaci generici iniettabili Sistemi

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.

Dettagli

Una proteina nella rete: Caccia al tesoro bioinformatica

Una proteina nella rete: Caccia al tesoro bioinformatica Una proteina nella rete: Caccia al tesoro bioinformatica Nel corso di questa attivita utilizzeremo alcune delle piu importanti banche dati disponibili in rete per cercare informazioni su una proteina.

Dettagli