CITOGENETICA CITOGENOMICA

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "CITOGENETICA CITOGENOMICA"

Transcript

1 Corso TANDEM 2015 Genetica Umana e Medica Lezione 2 - Ven 30 gennaio 2015 Alberto Turco CITOGENETICA CITOGENOMICA

2

3 1953 La Doppia Elica! (J.Watson, F.Crick, M.Wilkins, Nobel 1962)

4 Citogenetica: un po di storia

5 PREPARAZIONE CARIOTIPO STANDARD (Citogenetica classica o convenzionale) -Cc somatiche nucleate (es.leucociti sangue periferico, fibroblasti) -Mitogeno (PHA fitoemoagglutinina) -Colchicina, inibitore del fuso mitotico (blocco in metafase) -Soluzione ipotonica (rigonfiamento cellulare) -Fissazione (su vetrino) -Colorazione (bandeggio)

6 Anatomia di un cromosoma

7 Morfologia dei cromosomi (dimensioni e posizione centromero)

8 Candy Chromosomes!

9 CARIOTIPO STANDARD UMANO (G-banding pattern) CROMOSOMI ACROCENTRICI Satelliti = geni in tandem per rrna

10

11

12 «Bandeggio» Braccio Regione Banda Sottobanda Sotto-sottobanda Es 12q qduequattropuntotredue

13 EVOLUZIONE DELLA CITOGENETICA La Citogenetica Classica (convenzionale, standard) permette di identificare riarrangiamenti cromosomici di non meno di 5 Mb La Citogenetica Molecolare (Citogenomica) permette di identificare riarrangiamenti fino a poche Kb 1Kb = mille coppie di basi (bp) 1Mb = 1 milione di bp

14 CITOGENETICA MOLECOLARE Livello di risoluzione < 4-5Mb (4-5 milioni di basi) F.I.S.H. (Fluorescent In Situ Hybridization) Array CGH (acgh) (array-based Comparative Genomic Hybridization)

15

16 TRISOMIA

17 FISHFISHFISHFISHFISHFISH A = painting B = sonde centromeriche nucleo interfasico Marcatura multipla (13, 18, 21, X, Y) G U L P!!! C = sonda telomerica cromosoma 2 (del 2q)

18 (MICRO)DELEZIONE

19 Comparative Genomic Hybridization (CGH) convenzionale e microarray Screening dell intero genoma Cianine, sostanze fluorescenti

20 Il DNA genomico (denaturato e marcato) del paziente viene aggiunto sul «vetrino» (chip o «array») Microarray Microarray chip is scanned by instrument. Gain Gain Loss Loss The data is transferred to computer for interpretation.

21

22 Microchip di DNA (Microarray) Permettono in tempi brevi e a costi bassissimi l analisi dell intero genoma Possono contenere fino a 1 milione di «sonde» (brevi sequenze di DNA) 22

23 Identificazione di una microdelezione nel cromosoma 11 del(11)(q13.2-q13.4) mediante acgh

24

25 ANOMALIE CROMOSOMICHE Cause importanti di: - abortività - malformazioni congenite - ritardo mentale -Frequenza alla nascita (nati vivi): ~1/

26

27

28

29

30 La grande importanza delle associazioni!

31

32 Anomalie cromosomiche nella s.di Down Trisomia libera Traslocazione 95% (rischio ricorrenza basso) 4% (rischio ricorrenza alto!) Mosaicismo 1%

33 Trisomia 13 (S.di Patau)* 1: nati vivi Elevata selezione prenatale Labiopalatoschisi, polidattilia, alter.emisferi cerebrali, Microftalmia, cardiopatie, grave ritardo psicomotorio, convulsioni Sopravvivemnza rara dopo il I anno di vita Correlazione positiva con EMA In circa il 90% dei casi si tratta di trisomia libera In circa il 10% dei casi si tratta di traslocazione robertsoniana 13;14 * = Klaus Patau, tedesco

34

35 Trisomia 18 (S.di Edwards)

36

37 1:7000 Il 95% degli embrioni è abortito spontaneamente Femmine più colpite Correlazione positiva con EMA Ritardo di crescita, microcefalia, tipico atteggiamento delle mani Piede a piccozza, malformazioni multiple Trisomy 18, 9-year-old girl. Profound mental and physical handicaps Grave ritardo PM

38

39 S.Turner trattata

40

41 S.Di Klinefelter (47,XXY)

42 TRISOMIA X 1/ , superfemmine, alta statura, acne, menopausa precoce o irregolarità mestruali, NO ritardo mentale. Fertili: figli euploidi..

43 «Doppio Y» 1 su 1000 maschi, fenotipo maschile normale, alta statura, intelletto, sviluppo sex e fertilità normali. Figli euploidi

44 ANOMALIE CROMOSOMICHE DI STRUTTURA (RIARRANGIAMENTI) BILANCIATE (senza perdita e/o guadagno di materiale cromosomico) Fenotipo normale (a meno di interruzione/alteraz espressione genica) SBILANCIATE (con perdita e/ guadagno) Fenotipo patologico Traslocazioni (robertsoniane, reciproche) Inversioni (pericentriche, paracentriche) Delezioni

45 Traslocazione robertsoniana (Fusione centrica)

46 45,XY,t(14;21) portatore sano di t.robertsoniana 14/21

47 Anomalie cromosomiche nella s.di Down Trisomia libera Traslocazione 95% (rischio ricorrenza basso) 4% (rischio ricorrenza alto!) Mosaicismo 1%

48 Cariotipo fetale da L.A.(liquido amniotico) 46,XY, t(2;5)(q3.4;q2.4)

49

50 Traslocazione Reciproca (NON robertsoniana). Avviene tra cromosomi NON acrocentrici)

51 INVERSIONI CROMOSOMICHE

52 46,XY,inv(3)(p25;q21) NB: prodotti meiotici sbilanciati da inv.paracentrica: instabili e in genere non vitali. Prodotti meiotici sbilanciati da inv.pericentrica: stabili e potenzialmente vitali

53 DELEZIONI CROMOSOMICHE (es WHS) FISH acgh (CMA) Standard

54 Ipertelorismo Esiti di labioschisi WHS Fronte ampia, orecchie grande a basso impianto, RM

55 Delezioni cromosomiche Del 5p S.del Cri-du-chat

56 46, XX o XY, 5p-

57

58 TANDEM 2 S OVER C U Tuesday February 3rd Aula D Istituti Biologici

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

La Citogenetica nella Diagnosi Prenatale

La Citogenetica nella Diagnosi Prenatale La Citogenetica nella Diagnosi Prenatale Per diagnosi prenatale si intende l insieme delle indagini strumentali e di laboratorio finalizzate ad individuare determinate patologie su base : genetica infettiva

Dettagli

A cosa serve lo screening prenatale

A cosa serve lo screening prenatale Screening e Diagnosi prenatale della sindrome di Down ed altre anomalie cromosomiche fetali Lo scopo di questa nota è fornire in maniera chiara, semplice e per quanto possibile esaustiva le informazioni

Dettagli

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Introduzione Cromosoma Cellula Nucleo Ormai a tutti è noto il ruolo del

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

Prevenzione. Diagnosi prenatale. La consapevolezza di un accoglienza d amore

Prevenzione. Diagnosi prenatale. La consapevolezza di un accoglienza d amore Prevenzione Diagnosi prenatale La consapevolezza di un accoglienza d amore Bios International Holding La capillare rete di strutture di Bios International opera da anni nel campo della diagnostica con

Dettagli

ELENCO DELLE INDAGINI ESEGUIBILI

ELENCO DELLE INDAGINI ESEGUIBILI Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE n. nome TEST GENETICO metodo giorni TIPOLOGIA CAMPIONE 1 Acondroplasia

Dettagli

CLASSIFICAZIONE DELLE MALATTIE GENETICHE

CLASSIFICAZIONE DELLE MALATTIE GENETICHE CLASSIFICAZIONE DELLE MALATTIE GENETICHE - Malattie Monogeniche (Mendeliane) A.D., A.R., X-L. - Malattie Cromosomiche (Anomalie di numero e di struttura) - Malattie Multifattoriali (o Poligeniche) - Malattie

Dettagli

Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE

Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE TIPOLOGIA CAMPIONE n. nome TEST GENETICO metodo giorni 1 Acondroplasia

Dettagli

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY

LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY Laboratorio di Citogenetica Laboratorio di Biologia Molecolare LE ANALISI DI LABORATORIO PER LA DIAGNOSI PRENATALE: DALLA CITOGENETICA TRADIZIONALE AGLI ARRAY MODENA, 09 MARZO 2013 Dott.ssa Patrizia Caggiati

Dettagli

La consulenza alla paziente che richiede l analisi del DNA fetale

La consulenza alla paziente che richiede l analisi del DNA fetale La consulenza alla paziente che richiede l analisi del DNA fetale Bertinoro, 19 Ottobre 2013 Eva Pompilii eva_pompilii@yahoo.it Limiti attuali del Non invasive Prenatal Testing/ Non Invasive Prenatal

Dettagli

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre più di non conoscere, nell avvedersi di saper sempre meno,

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

LABORATORIO DI GENETICA MEDICA CARTA DEI SERVIZI // 3 1. PRESENTAZIONE E MISSION // 4 2. COME RAGGIUNGERE L ISTITUTO // 5 3. ORGANIZZAZIONE // 6

LABORATORIO DI GENETICA MEDICA CARTA DEI SERVIZI // 3 1. PRESENTAZIONE E MISSION // 4 2. COME RAGGIUNGERE L ISTITUTO // 5 3. ORGANIZZAZIONE // 6 LABORATORIO DI GENETICA MEDICA CARTA DEI SERVIZI // 3 1. PRESENTAZIONE E MISSION // 4 2. COME RAGGIUNGERE L ISTITUTO // 5 3. ORGANIZZAZIONE // 6 4. INFORMAZIONI SUI SERVIZI FORNITI // 7 4.1 CONSULENZA

Dettagli

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale

Dettagli

ALTERAZIONI CROMOSOMICHE STRUTTURALI

ALTERAZIONI CROMOSOMICHE STRUTTURALI Cos è PrenatalSAFE? PrenatalSAFE è un esame prenatale non invasivo che, analizzando il DNA fetale libero circolante isolato da un campione di sangue materno, valuta la presenza di aneuploidie fetali comuni

Dettagli

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI Ogni individuo possiede un proprio patrimonio genetico che lo rende unico e diverso da tutti gli altri. Il patrimonio genetico è costituito da

Dettagli

DIAGNOSTICA FISH SU SEZIONI DI TESSUTO IN PARAFFINA: DALLA METODICA ALLA LETTURA DEI RISULTATI

DIAGNOSTICA FISH SU SEZIONI DI TESSUTO IN PARAFFINA: DALLA METODICA ALLA LETTURA DEI RISULTATI DIAGNOSTICA FISH SU SEZIONI DI TESSUTO IN PARAFFINA: DALLA METODICA ALLA LETTURA DEI RISULTATI C. BOTTA L. VERDUN di CANTOGNO Dipartimento di Scienze Biomediche ed Oncologia Umana, sezione di Anatomia

Dettagli

ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN

ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN Sinonimi: Trisomia 21 Frequenza : 1/750 nati vivi ANOMALIE CROMOSOMICHE UMANE: Patologie derivate da alterazioni del numero o della struttura dei cromosomi SINDROME DI DOWN La sindrome di Down (detta anche

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Come si forma il ring?

Come si forma il ring? La sindrome ring del cromosoma 14 è una patologia rara che si manifesta principalmente con ritardo psicomotorio, crisi epilettiche ad esordio molto precoce, anomalie retiniche e una facies caratteristica.

Dettagli

Documenti Scientifici

Documenti Scientifici RICERCA SCIENTIFICA E APPLICAZIONI SANITARIE inserto redazionale Inserto redazionale di ANALYSIS n. 2/3.2007 - Documenti Scientifici SDS-Snabi 1/2007 - Direttore Responsabile: Giampiero Storti LINEE GUIDA

Dettagli

MEDICO / CENTRO INVIANTE

MEDICO / CENTRO INVIANTE Pag. 1 di 2 MODULO DI RICHIESTA ESAME PRENATALSAFE MEDICO / CENTRO INVIANTE Nome / Timbro Punto Prelievo DATI DELLA PAZIENTE Prot. No.: (uso interno) Nome Cognome Data di nascita Luogo di nascita Codice

Dettagli

Poligeniche multifattoriali

Poligeniche multifattoriali PATOLOGIA EZIOLOGIA (scienza che studia le cause delle malattie) Agenti di malattia Estrinseci (raggruppano le patologie ambientali e le patologie infettive) Intrinseci (patologia genetica, alterazioni

Dettagli

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y

MICRODELEZIONI DEL BRACCIO LUNGO DEL CROMOSOMA Y L infertilità è considerata dall Organizzazione Mondiale della Sanità una patologia. Per infertilità si intende l assenza di concepimento dopo 12/24 mesi di rapporti mirati non protetti. Il fenomeno dell

Dettagli

INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI

INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI CONSULENZA GENETICA La consulenza genetica è un processo medico-clinico che ha lo scopo di definire il percorso diagnostico in caso di sospetto di malattia

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo e secondo globulo polare (PB) Diagnosi Preimpianto delle alterazioni cromosomiche mediante array-cgh La sottoscritta (partner femmiile).. Data

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

18 Aprile 2013 LE MERAVIGLIE DELLA GENETICA NEGLI ANNI 2000. Un Seminario dedicato agli Allievi delle Classi IV dell Istituto Superiore Elsa Morante

18 Aprile 2013 LE MERAVIGLIE DELLA GENETICA NEGLI ANNI 2000. Un Seminario dedicato agli Allievi delle Classi IV dell Istituto Superiore Elsa Morante 18 Aprile 2013 LE MERAVIGLIE DELLA GENETICA NEGLI ANNI 2000 Un Seminario dedicato agli Allievi delle Classi IV dell Istituto Superiore Elsa Morante Prof. Maria Luisa Giovannucci Uzielli Docente di Genetica

Dettagli

Diagnosi genetica preimpianto- nuovo metodo di screening di 24 cromosomi tramite il metodo Array CGH...2

Diagnosi genetica preimpianto- nuovo metodo di screening di 24 cromosomi tramite il metodo Array CGH...2 Agosto 2012 contenuto 8 Diagnosi genetica preimpianto- nuovo metodo di screening di 24 cromosomi tramite il metodo Array CGH...2 Mantenimento di fertilitá-nuove possibilitá presso il GENNET...3 Isteroscopia

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIFETTI CONGENITI Le anomalie congenite sono condizioni che si instaurano tra il momento del concepimento e la nascita. LA DIAGNOSI PRENATALE insieme di tecniche

Dettagli

Studio dell infertilità maschile: dall esame seminale alle microdelezioni del cromosoma Y

Studio dell infertilità maschile: dall esame seminale alle microdelezioni del cromosoma Y Studio dell infertilità maschile: dall esame seminale alle microdelezioni del cromosoma Y Domenico Saverio MATAROZZO Claretta MARCHI Anatomia Patologica S. Anna - Torino Premessa L esame seminale è il

Dettagli

L analisi del DNA fetale libero da sangue materno

L analisi del DNA fetale libero da sangue materno L analisi del DNA fetale libero da sangue materno Cos è PrenatalSafe Esame prenatale non invasivo (NIPT) che, analizzando il DNA fetale libero circolante isolato da un campione di sangue materno, valuta

Dettagli

Il ruolo del genetista nei programmi di diagnosi prenatale

Il ruolo del genetista nei programmi di diagnosi prenatale Il ruolo del genetista nei programmi di diagnosi prenatale Dr.ssa Eva Pompilii GynePro Medical Group Bologna U.O. Ostetricia e Ginecologia Policlinico S. Orsola Malpighi Bologna www.gynepro.it Consulenza

Dettagli

LUCA ROCCHETTI U.O. GENETICA MEDICA AVR SINDROME DI BLOCH SULTZBERGER O INCONTINENTIA AI PIGMENTI DI TIPO 2

LUCA ROCCHETTI U.O. GENETICA MEDICA AVR SINDROME DI BLOCH SULTZBERGER O INCONTINENTIA AI PIGMENTI DI TIPO 2 LUCA ROCCHETTI U.O. GENETICA MEDICA AVR SINDROME DI BLOCH SULTZBERGER O INCONTINENTIA AI PIGMENTI DI TIPO 2 PRIMA INFANZIA: LESIONI CUTANEE DALLO SVILUPPO CARATTERISTICO ( dermatite bollosa congenita )

Dettagli

Diagnosi Prenatale I

Diagnosi Prenatale I Diagnosi Prenatale I Lezione 15 Diagnosi prenatale nata nel 1966 (Steele e Breg); richiede l intervento di numerose discipline: ostetricia, ultrasonografia, genetica clinica, diagnosi e consulenza genetica

Dettagli

Elenco degli esami molecolari prescrivibili e a carico del SSN

Elenco degli esami molecolari prescrivibili e a carico del SSN Fondazione IRCCS Istituto Nazionale dei Tumori 02 20133 milano - via venezian, 1 - tel. 02 23901 - telex 333290 tumist I - codice fiscale 80018230153 - partita i.v.a. 04376350155 Dipartimento di Patologia

Dettagli

Tranquility. Test non invasivo del DNA fetale per trisomie e aneuploidie sessuali. Medical Information

Tranquility. Test non invasivo del DNA fetale per trisomie e aneuploidie sessuali. Medical Information Tranquility Test non invasivo del DNA fetale per trisomie e aneuploidie sessuali Medical Information www.genoma.com Tranquility Medical Information Copyright 2015 Genoma SA Tutti i diritti riservati Supervisione

Dettagli

La patologia cromosomica WWW.FISIOKINESITERAPIA.BIZ

La patologia cromosomica WWW.FISIOKINESITERAPIA.BIZ La patologia cromosomica WWW.FISIOKINESITERAPIA.BIZ LO STUDIO DEI CROMOSOMI: CITOGENETICA alcuni concetti di citogenetica classificazione la frequenza delle malattie cromosomiche ed alcune patologie più

Dettagli

DIAGNOSI PRENATALE DELLE ANOMALIE CROMOSOMICHE

DIAGNOSI PRENATALE DELLE ANOMALIE CROMOSOMICHE SERVIZIO DI ECOGRAFIA E DIAGNOSI PRENATALE DIAGNOSI PRENATALE DELLE ANOMALIE CROMOSOMICHE 1 CROMOSOMI Cosa sono i cromosomi? I cromosomi si trovano nel nucleo della cellula, sono costituiti da proteine

Dettagli

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione 1. Crea variabilità sulla quale agisce

Dettagli

Diagnosi delle aneuploidie

Diagnosi delle aneuploidie Diagnosi delle aneuploidie DIAGNOSI PRENATALE NON INVASIVA: UNA RIVOLUZIONE La diagnosi prenatale delle malattie monogeniche e delle aneuploidie Bologna, è attualmente 6 Giugno eseguita2014 nel I-II trimestre

Dettagli

Cor o t r e t e C os o t s it i uzi uz o i na U f f i f c i io i o S ta t mpa L g e ge e s ulla f e f c e o c ndazione e a ssist s ita

Cor o t r e t e C os o t s it i uzi uz o i na U f f i f c i io i o S ta t mpa L g e ge e s ulla f e f c e o c ndazione e a ssist s ita La diagnosi pre-impianto Claudia Livi Centro DEMETRA Firenze www.centrodemetra.com Corte Costituzionale Ufficio Stampa Legge sulla fecondazione assistita La Corte ha dichiarato l illegittimità costituzionale

Dettagli

Her-2 nel carcinoma mammario

Her-2 nel carcinoma mammario Her-2 nel carcinoma mammario Piera Balzarini U.O. Anatomia Patologica Università degli Studi di Brescia Spedali Civili di Brescia Il gene ERBB2 dà origine ad un recettore tirosin-chinasico appartenente

Dettagli

La diagnosi prenatale presso l'ospedale Val d'elsa

La diagnosi prenatale presso l'ospedale Val d'elsa AZIENDA OSPEDALIERA UNIVERSITARIA SENESE U.O.C. Genetica Medica AZIENDA USL 7 DI SIENA U.O. Ginecologia e Ostetricia Val d'elsa La diagnosi prenatale presso l'ospedale Val d'elsa Cristina Ferretti Indicazioni

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

geni e dintorni piccola guida alle malattie ereditarie

geni e dintorni piccola guida alle malattie ereditarie 2 geni e dintorni piccola guida alle malattie ereditarie A cura Regione Toscana Giunta Regionale Dipartimento del diritto alla salute e delle politiche di solidarietà Uoc Sviluppo delle risorse professionali

Dettagli

GENETICA MEDICA. Analisi genetiche per oltre 400 geni testabili vengono inviati a strutture pubbliche esterne, ospedaliere e universitarie.

GENETICA MEDICA. Analisi genetiche per oltre 400 geni testabili vengono inviati a strutture pubbliche esterne, ospedaliere e universitarie. GENETICA MEDICA PRESENTAZIONE DELLA STRUTTURA L ambulatorio di Genetica Medica fa parte del Dipartimento Materno Infantile. Essa collabora ed interagisce strettamente con le Strutture del Dipartimento

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule.

Figura 1 : organizzazione del materiale genetico nel nucleo delle cellule. Il patrimonio genetico, base della vita Il patrimonio genetico (genoma) è l insieme di tutte le informazioni necessarie per costruire ogni embrione, attraverso complessi meccanismi di moltiplicazione delle

Dettagli

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi

Chimica Biochimica Biologia. Biologia Molecolare. Decodificazione Genoma Umano. Post-Genomica Medicina Molecolare. Patogenesi Terapia Diagnosi Patogenesi Terapia Diagnosi Dalla Genomica alla Medicina Molecolare Chimica Biochimica Biologia Biologia Molecolare Decodificazione Genoma Umano Post-Genomica Medicina Molecolare La CELLULA Nasce Si sviluppa

Dettagli

CENNI DI CITOGENETICA

CENNI DI CITOGENETICA CENNI DI CITOGENETICA CARIOTIPO: definisce il numero e la morfologia dei cromosomi di un individuo. Nell uomo tutte le cellule (ad eccezione delle cellule germinali) hanno cariotipo diploide (23 coppie

Dettagli

Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO

Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO PRESENTAZIONE DELLA STRUTTURA La Struttura Semplice Dipartimentale di genetica medica fa parte del Dipartimento di Medicina dei

Dettagli

IBRIDAZIONE IN SITU FLUORESCENTE (FISH)

IBRIDAZIONE IN SITU FLUORESCENTE (FISH) IBRIDAZIONE IN SITU FLUORESCENTE (FISH) L ibridazione in situ fluorescente (FISH), è una tecnica di citogenetica molecolare che permette di visualizzare la localizzazione e il numero di copie di una sequenza

Dettagli

I test rapidi per aneuploidie in diagnostica prenatale mediante QF-PCR e/o FISH

I test rapidi per aneuploidie in diagnostica prenatale mediante QF-PCR e/o FISH I test rapidi per aneuploidie in diagnostica prenatale mediante QF-PCR e/o FISH Luca Sbaiz, Silvia Cavalchini, Isabella Battistella, Sabina Siviero, Valentina Asnaghi, Maria Grazia Bonissone, Cristina

Dettagli

Cosa puo dirci il Laboratorio?

Cosa puo dirci il Laboratorio? Societa Italiana di Genetica Umana MALFORMAZIONI CARDIACHE PRIMA E DOPO LA NASCITA: SINERGIA TRA CLINICA E DIAGNOSI GENETICA VERSO UN COUNSELLING EFFICACE Cosa puo dirci il Laboratorio? Corso post congressuale

Dettagli

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA.

ANALISI POST-GENOMICHE TRASCRITTOMA: CONTENUTO DI RNA DI UNA CELLULA. TECNICHE PER L ANALISI DELL ESPRESSIONE GENICA RT-PCR REAL TIME PCR NORTHERN BLOTTING ANALISI POST-GENOMICHE Conoscere la sequenza genomica di un organismo non è che l inizio di una serie di esperimenti

Dettagli

Tranquility. Il più Accurato Test Prenatale Non Invasivo per le Trisomie Evita l amniocentesi quando non è necessario

Tranquility. Il più Accurato Test Prenatale Non Invasivo per le Trisomie Evita l amniocentesi quando non è necessario Tranquility Il più Accurato Test Prenatale Non Invasivo per le Trisomie Evita l amniocentesi quando non è necessario Un test del sangue semplice, sicuro e sensibile, dalle elevate performance predittive

Dettagli

LA NUOVA GENERAZIONE DELLO SCREENING PRENATALE NON INVASIVO SU DNA FETALE

LA NUOVA GENERAZIONE DELLO SCREENING PRENATALE NON INVASIVO SU DNA FETALE LA NUOVA GENERAZIONE DELLO SCREENING PRENATALE NON INVASIVO SU DNA FETALE Tecnologia SNP assay per l analisi diretta del DNA fetale per le principali aneuploidie cromosomiche Strettamente confidenziale

Dettagli

Consenso Informato per l esecuzione di Diagnosi Genetica Preimpianto e Screening (PGD/PGS) MO.101.OCT.DMI. FIR

Consenso Informato per l esecuzione di Diagnosi Genetica Preimpianto e Screening (PGD/PGS) MO.101.OCT.DMI. FIR pag 1 di 5 Il sottoscritto Luogo e Data di nascita Residente a Via Documento e numero Malattia genetica Mutazione La sottoscritta Luogo e Data di nascita Residente a Via Documento e numero Malattia genetica

Dettagli

Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB)

Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Scelta informata relativa alle analisi preimpianto sul primo globulo polare (PB) Screening Preimpianto delle alterazioni cromosomiche numeriche mediante array-cgh La sottoscritta (partner femmile).. Data

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Emiatrofia cerebrale e microftalmia

Emiatrofia cerebrale e microftalmia Emiatrofia cerebrale e microftalmia TROMBOSI TROMBOSI Prevenzione dell handicap congenito Nel 1 gruppo di casi genetici con rischio di ricorrenza, la prevenzione può attuarsi attraverso una corretta diagnosi

Dettagli

La concezione del ritardo mentale/disabilità intellettiva

La concezione del ritardo mentale/disabilità intellettiva La concezione del ritardo mentale/disabilità intellettiva Definizione (Associazione Americana Ritardo Mentale 2002): il ritardo mentale è una disabilità caratterizzata da limitazioni significative sia

Dettagli

DISCREPANZA CVSc vs CVSm PER TRISOMIA 21 DA RESCUE INVERSO.

DISCREPANZA CVSc vs CVSm PER TRISOMIA 21 DA RESCUE INVERSO. DISCREPANZA CVSc vs CVSm PER TRISOMIA 21 DA RESCUE INVERSO. E-mail: asensi@ausl-cesena.emr.it Turci A.*, Racalbuto E., Innoceta A.M.*,Camurri L.,Marongiu A.#, Rosato S,Voglino G.#, Sensi A.* *UO Genetica

Dettagli

DIAGNOSI PRENATALE DI MALATTIE RARE: IL FETO COME PAZIENTE

DIAGNOSI PRENATALE DI MALATTIE RARE: IL FETO COME PAZIENTE PROF. GIOVANNI NERI Istituto di Genetica Medica, Università Cattolica del S. Cuore, Roma DIAGNOSI PRENATALE DI MALATTIE RARE: IL FETO COME PAZIENTE La diagnosi prenatale di malattie genetiche rare è pratica

Dettagli

Caso clinico traslocazione criptica t (1;10) U.O. Neonatologia TIN Azienda Ospedaliera BologninI Seriate (BG) Direttore Dott.ssa A.

Caso clinico traslocazione criptica t (1;10) U.O. Neonatologia TIN Azienda Ospedaliera BologninI Seriate (BG) Direttore Dott.ssa A. Caso clinico traslocazione criptica t (1;10) U.O. Neonatologia TIN Azienda Ospedaliera BologninI Seriate (BG) Direttore Dott.ssa A. Auriemma INTRODUZIONE La monosomia distale del braccio corto del cromosoma

Dettagli

Modulo 2 Genetica e genomica: come migliorare il trattamento per l'infertilità

Modulo 2 Genetica e genomica: come migliorare il trattamento per l'infertilità Modulo 2 Genetica e genomica: come migliorare il trattamento per l'infertilità Autore: Dr. Alessio Paffoni, Specialista in Specialista in Genetica Medica, Ospedale Maggiore Policlinico Mangiagalli e Regina

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Metodi di diagnosi prenatale per le anomalie fetali WWW.FISIOKINESITERAPIA.BIZ

Metodi di diagnosi prenatale per le anomalie fetali WWW.FISIOKINESITERAPIA.BIZ Metodi di diagnosi prenatale per le anomalie fetali WWW.FISIOKINESITERAPIA.BIZ 1 Frequenza delle anomalie cromosomiche alla nascita in funzione dell età materna anomalie/1000 nati 40 35 30 25 20 15 10

Dettagli

LA DIAGNOSTICA PRENATALE: dal Test Combinato alle ecografie di routine

LA DIAGNOSTICA PRENATALE: dal Test Combinato alle ecografie di routine LA DIAGNOSTICA PRENATALE: dal Test Combinato alle ecografie di routine ECOGRAFIA FETO NUMERO e VITALITA CORIONICITA AMBIENTE FETALE ACCRESCIMENTO MORFOLOGIA e FUNZIONALITA PLACENTA LOCALIZZAZIONE FUNZIONALITA

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

Parentale Ricombinante Ricombinante Parentale

Parentale Ricombinante Ricombinante Parentale I risultati ottenuti da Morgan confermano quindi l ipotesi fatta da Bateson e Punnett, secondo la quale non sempre due geni si assortiscono in maniera indipendente. Morgan effettuò anche l incrocio tra

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

CONSENSO INFORMATO ALL ESECUZIONE DEL TEST GENETICO PER LA DIAGNOSI DI ALTERAZIONI CROMOSOMICHE NUMERICHE MEDIANTE TECNICA ARRAY-CGH

CONSENSO INFORMATO ALL ESECUZIONE DEL TEST GENETICO PER LA DIAGNOSI DI ALTERAZIONI CROMOSOMICHE NUMERICHE MEDIANTE TECNICA ARRAY-CGH CONSENSO INFORMATO ALL ESECUZIONE DEL TEST GENETICO PER LA DIAGNOSI DI ALTERAZIONI CROMOSOMICHE NUMERICHE MEDIANTE TECNICA ARRAY-CGH Il sottoscritto (partner maschile) Data di nascita Luogo di nascita

Dettagli

Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA

Dettagli

Riarrangiamenti cromosomici e polimorfismi del numero di copie: alterazioni dell espressione genica nella patologia umana.

Riarrangiamenti cromosomici e polimorfismi del numero di copie: alterazioni dell espressione genica nella patologia umana. Riarrangiamenti cromosomici e polimorfismi del numero di copie: alterazioni dell espressione genica nella patologia umana. Emiliano Giardina emiliano.giardina@uniroma2.it Paradosso del valore K: La complessità

Dettagli

IL PUNTO DI PARTENZA

IL PUNTO DI PARTENZA IL PUNTO DI PARTENZA Convocare o ricevere una convocazione durante l attesa di un esito di diagnosi prenatale è sempre difficile, fonte di angoscia o perlomeno di preoccupazione. Obiettivo delle donne:

Dettagli

Informazioni generali sulla diagnosi genetica preimpianto (PGD) a) Diagnosi preimpianto di aneuploidie cromosomiche (PGS) Pagina 2 di 10

Informazioni generali sulla diagnosi genetica preimpianto (PGD) a) Diagnosi preimpianto di aneuploidie cromosomiche (PGS) Pagina 2 di 10 CONSENSO INFORMATO ALL ESECUZIONE DEL TEST GENETICO PER LA DIAGNOSI DI ALTERAZIONI CROMOSOMICHE NUMERICHE E/O STRUTTURALI SBILANCIATE MEDIANTE TECNICA ARRAY-CGH Il sottoscritto (partner maschile) Data

Dettagli

Prodotti Elucigene QST*R Istruzioni per l uso

Prodotti Elucigene QST*R Istruzioni per l uso Prodotti Elucigene QST*R Istruzioni per l uso Prodotto Quantità Codice catalogo Elucigene QST*Rplusv2 50 test AN0PLB2 Elucigene QST*R 50 test AN003B2 Elucigene QST*R-XYv2 50 test AN0XYB2 Elucigene QST*R-13

Dettagli

SCOPO DELLA DIAGNOSI PRENATALE (DP)

SCOPO DELLA DIAGNOSI PRENATALE (DP) DIAGNOSI PRENATALE SCOPO DELLA DIAGNOSI PRENATALE (DP) offrire ai genitori e al medico le migliori informazioni possibili sui rischi di dare alla luce un bambino affetto da un'anomalia congenita o da una

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

Elementi scientifici di base delle patologie a componente genetica

Elementi scientifici di base delle patologie a componente genetica BRUNO DALLAPICCOLA Elementi scientifici di base delle patologie a componente genetica Il sequenziamento del genoma umano ha contribuito a rafforzare il processo di genetizzazione e il concetto di determinismo

Dettagli

Malattie genetiche. Il genoma umano e formato da 23 paia di cromosomi (1 paio di eterocromosomi, 22 paia di autosomi).

Malattie genetiche. Il genoma umano e formato da 23 paia di cromosomi (1 paio di eterocromosomi, 22 paia di autosomi). Malattie genetiche Il patrimonio genetico e contenuto nel DNA. Il genoma umano e formato da 23 paia di cromosomi (1 paio di eterocromosomi, 22 paia di autosomi). La sequenza di tutto il genoma umano e

Dettagli

Diagnosi di portatrice e diagnosi prenatale: counselling genetico

Diagnosi di portatrice e diagnosi prenatale: counselling genetico Diagnosi di portatrice e diagnosi prenatale: counselling genetico Emofilia L emofilia è una malattia autosomica recessiva legata al cromosoma X Meccanismo ereditario dell Emofilia A e B 50% 50% 100% 100%

Dettagli

Traslocazioni cromosomiche

Traslocazioni cromosomiche 16 Traslocazioni cromosomiche Testo modificato dagli opuscoli prodotti dall ospedale Guy s and St Thomas di Londra e dal Parco tecnologico di Londra IDEAS Genetic Knowledge Park in accordo alle loro norme

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli