La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione"


1 La diagnostica biomolecolare a supporto dei controlli ufficiali per le api regine d importazione Raniero Lorenzetti Biotecnologie Istituto Zooprofilattico Sperimentale delle Regioni Lazio e Toscana

2 PREMESSA La disponibilità di importanti apparecchiature di laboratorio, come i sequenziatori di DNA, unitamente alla crescente diffusione di strumenti informatici per la condivisione ed il confronto dei dati analitici con essi prodotti, ha contribuito in modo fondamentale allo sviluppo di nuovi approcci d indagine laboratoristica. Un esempio pratico, che coinvolge il nostro Istituto ed il settore dell apicoltura, è relativo all identificazione di un importante parassita degli alveari, lo scarabeo Aethina tumida. Nella presentazione, verrà illustrato l approccio biomolecolare sviluppato per il riconoscimento, soprattutto negli stadi larvali, di questo insetto

3 Biotecnologie IZSLT Strumentazione ad elevato contenuto tecnologico: -Un sequenziatore di DNA, monocapillare -Un pirosequenziatore di DNA -Due amplificatori per PCR Real Time -Pacchetti software di bioinformatica e, in fase di acquisizione - Un sequenziatore di DNA, 8 capillari

4 Biotecnologie IZSLT PRINCIPALI ATTIVITA : - Centro di Referenza Nazionale per la ricerca di OGM - Caratterizzazioni genetiche (in specie animali, batteriche, virali) - Sviluppo e produzione di ibridomi, cellule staminali e proteine ricombinanti - Isolamenti virali - Diagnostica molecolare - Promozione e partecipazione ad attività di ricerca - Identificazione molecolare di specie animali -Supporto ad altre strutture dell Istituto, soprattutto per lo sviluppo di protocolli diagnostici.

5 Attività a sostegno dell unità operativa Apicoltura Attivazione di protocolli di Polymerase Chain Reaction (PCR, sia end point che Real Time ) per il rilevamento dei seguenti patogeni: -ABPV (Acute Bee Paralysis Virus) -CBPV (Chronic Bee Paralysis Virus) -DWV (Deformed Wing Virus) -SBV (Sacbrood Virus) -KBV (Kashmir Bee Virus) -IAPV (Israeli Acute Paralysis Virus)..e, relativamente ai controlli ufficiali sulle api regine d importazione, l attivazione di un protocollo di PCR- sequenziamento del DNA per l identificazione del coleottero Aethina tumida. -BQCV (Black Queen Cell Virus) -Nosema ceranae -Nosema apis

6 Necessità di una diagnosi differenziale negli stadi adulti e/o larvali Aethina tumida Cryptophagus hexagonalis Cychramus luteus Galleria mellonella

7 Approcci possibili Morfologico Anatomico Etologico Biochimico Biomolecolare Multidisciplinare

8 Alcune identificazioni condotte presso l IZSLT



11 Approccio biomolecolare: la scelta per Aethina tumida Si è optato per lo sviluppo di un metodo di PCR classico (end point), seguito dal sequenziamento del prodotto di amplificazione e dal confronto di questo con le sequenze depositate in banche dati pubbliche. In particolare, la strumentazione di laboratorio ed i supporti informatici (commerciali e/o pubblici) a disposizione hanno contribuito a

12 Approccio biomolecolare: la scelta per Aethina tumida individuare la regione bersaglio della PCR e a definire una coppia di primer in grado di rilevarla (applicazione WEB pubblica primerblast-ncbi). definire le condizioni ottimali per l esecuzione del metodo di PCR (software commerciale Oligo 6, MBI, USA). applicare e verificare la bontà del saggio, su larve del coleottero. sequenziare (ed analizzare) il prodotto di amplificazione, (sequenziatore automatico monocapillare ABI310, Applied Biosystems). confrontare le sequenze ottenute con quelle depositate in banche dati pubbliche (applicazioni WEB pubbliche: nblast-ncbi e BOLD Identification System- BOLD)

13 Approccio biomolecolare: quale regione bersaglio? CITOCROMO-C OSSIDASI subunità I ( COI ) rdna 16s CITOCROMO b ( Cyt b ) ITS-1 rbcl & matk.

14 COI come bersaglio d elezione Sufficientemente stabile a livello intraspecifico Sufficientemente variabile a livello interspecifico Consente lo sviluppo di protocolli di PCR trasversali, in grado cioè di essere applicati, potenzialmente, su gruppi tassonomici distanti (es: mammiferi ed echinodermi) Riassumendo: la COI possiede le caratteristiche ideali per assumere il ruolo di marker genetico d elezione nell identificazione biomolecolare di specie.

15 Sequenziamento con il metodo CHAIN TERMINATION (o metodo di Sanger) DNA stampo E una PCR asimmetrica condotta in presenza di una opportuna miscela di dntp/ddntp-fluorescenti L incorporazione di un ddntpfluorescente, nel filamento di DNA in estensione, determina sia l interruzione della sintesi di quest ultimo, sia la sua marcatura. Le condizioni di reazione solo tali per cui, statisticamente, si ottiene una popolazione di filamenti marcati, ciascuno dei quali interrotto in una posizione specifica: nel loro insieme, queste interruzioni, interessano tutta (entro certi limiti) la regione da sequenziare. La successiva separazione e caratterizzazione (della fluorescenza) dei filamenti, mediante elettroforesi (capillare o gel), consente di determinare la sequenza del DNA oggetto dello studio..... ACGCAGGTGTTGCGATGTCCAC Primer T G C GTCCA C A


17 STANDARD DI RIFERIMENTO PER L APPROCCIO BIOMOLECOLARE Sono le sequenze di DNA bersaglio, ottenute dalle specie d interesse, raccolte in basi dati proprie e/o pubbliche e utilizzate per il confronto (mediante applicazione WEB o software di laboratorio) con le sequenze ottenute nel corso delle analisi.






23 GenBank NCBI s GenBank database is a collection of publicly available annotated nucleotide sequences, including mrna sequences with coding regions, segments of genomic DNA with a single gene or multiple genes, and ribosomal RNA gene clusters. GenBank is specifically intended to be an archive of primary sequence data. Thus, to be included, the sequencing must have been conducted by the submitter. NCBI does some quality control checks and will notify a submitter if something appears amiss, but it does not curate the data; the author has the final say on the sequence and annotation placed in the GenBank record. Authors are encouraged to update their records with new sequence or annotation data, but in practice records are seldom updated.




27 Grazie per




Controllo ufficiale degli OGM nel settore agroalimentare

Controllo ufficiale degli OGM nel settore agroalimentare Controllo ufficiale degli OGM nel settore agroalimentare Ugo Marchesi Istituto Zooprofilattico Sperimentale Lazio e Toscana Centro di Referenza Nazionale per la ricerca di OGM ORGANISMI


Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno

Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo. alla realtà di ogni giorno Editoriale n.10 Newsletter aprile 2013 Come si traccia un alimento di origine animale? Dalle lasagne con carne di cavallo alla realtà di ogni giorno Identificare la specie, un obiettivo fondamentale quando



SEQUENZIAMENTO DEL DNA SEQUENZIAMENTO DEL DNA Il metodo di Sanger per determinare la sequenza del DNA Il metodo manuale La reazione enzimatica Elettroforesi in gel denaturante di poliacrilammide Autoradiografia Il metodo automatico


Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli

Aggiornamenti di biologia molecolare nella diagnostica microbiologica. Pier Sandro Cocconcelli Aggiornamenti di biologia molecolare nella diagnostica microbiologica Pier Sandro Cocconcelli Istituto di Microbiologia Centro Ricerche Biotecnologiche Università Cattolica del Sacro Cuore Piacenza-Cremona



REAZIONE A CATENA DELLA POLIMERASI. ( PCR =Polymerase Chain Reaction) REAZIONE A CATENA DELLA POLIMERASI ( PCR =Polymerase Chain Reaction) Verso la metà degli anni 80, il biochimico Kary Mullis mise a punto un metodo estremamente rapido e semplice per produrre una quantità


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo HUMAN GENOME PROJECT



PATOLOGIA APISTICA: PREVENZIONE, DIAGNOSI E CONTROLLO Corso pratico-teorico LE VIROSI DELLE API. Antonella Cersini Giusy Cardeti PATOLOGIA APISTICA: PREVENZIONE, DIAGNOSI E CONTROLLO Corso pratico-teorico LE VIROSI DELLE API Antonella Cersini Giusy Cardeti IZSLT, D.O. Biotecnologie 1963: evidenziazione primo virus delle api (CBPV)


La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino

La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La reazione a catena della polimerasi (PCR) di Ofelia Leone e Vincenzo Mandarino La Polymerase Chain Reaction (PCR) o reazione di amplificazione a catena è una tecnica che permette di amplificare una specifica



PRINCIPALI TIPI DI PCR a) PRINCIPALI TIPI DI PCR b) PRINCIPALI TIPI DI PCR a) RT-PCR: serve a valutare l espressione di un gene tramite l amplificazione dell mrna da esso trascritto PCR COMPETITIVA: serve a valutare la concentrazione iniziale di DNA o RNA


PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte

PCR. PCR o reazione di polimerizzazione a catena. Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte PCR Prof.ssa Flavia Frabetti PCR o reazione di polimerizzazione a catena Fine anni 80 Amplificazione esponenziale di DNA. Puo amplificare un tratto di DNA per piu di 1 milione di volte Permette di estrarre


Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici

Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici "Focus su sicurezza d'uso e nutrizionale degli alimenti" 21-22 Novembre 2005 Applicazione dei metodi rapidi alla microbiologia alimentare: Real Time PCR per la determinazione dei virus enterici Simona





Le attività di ricerca in ambito virologico condotte nell apiario sperimentale

Le attività di ricerca in ambito virologico condotte nell apiario sperimentale DIPARTIMENTO DI MEDICINA VETERINARIA Sezione Sicurezza degli Alimenti Responsabile scientifico: Prof.ssa G. Tantillo Evento Formativo VARROATOSI: INNOVAZIONE, INTERAZIONE OSPITE/PARASSITA E AMBIENTE Venerdi,


Diagnostica Biomolecolare: Tecnologie e Applicazioni

Diagnostica Biomolecolare: Tecnologie e Applicazioni Diagnostica Biomolecolare: Tecnologie e Applicazioni Preparazione dei campioni: (Estrazione del DNA o dell RNA dal tessuto di interesse) Analisi delle mutazioni: SSCP DHPLC Dot blot - Southern - PCR (ARMS


Lo stato sanitario del patrimonio apistico dell Europa e dell Italia

Lo stato sanitario del patrimonio apistico dell Europa e dell Italia Lo stato sanitario del patrimonio apistico dell Europa e dell Italia Franco Mutinelli Istituto Zooprofilattico Sperimentale delle Venezie CRN per l apicoltura 1) Spagna Francia Grecia Romania Italia Polonia


Le virosi delle api. Marco Pietropaoli Antonella Cersini. Istituto Zooprofilattico Sperimentale Regioni Lazio e Toscana

Le virosi delle api. Marco Pietropaoli Antonella Cersini. Istituto Zooprofilattico Sperimentale Regioni Lazio e Toscana Le virosi delle api Marco Pietropaoli Antonella Cersini Istituto Zooprofilattico Sperimentale Regioni Lazio e Toscana 1963: evidenziazione primo virus delle api (CBPV) Anni successivi: identificati e caratterizzati


Polymerase Chain Reaction - PCR

Polymerase Chain Reaction - PCR Polymerase Chain Reaction - PCR Real-Time PCR Saggio Saggio di PCR monitorato di continuo Tubi Tubi chiusi Nessuna analisi post PCR Nessuna elettroforesi Caratterizzazione del prodotto Possibilità di quantificare



BEENET: ITALIAN BEEKEEPING MONITORING NETWORK BEENET: ITALIAN BEEKEEPING MONITORING NETWORK Porrini C 1, Lodesani M 2,Libertà A 3, Bortolotti L 2, Gallina A 4, Colombo R 2, Sgolastra F 1,Medrzycki P 2, Bozza MA 4, Mutinelli F 4 1 DipSA, Università



METODI GENETICI NELLA IDENTIFICAZIONE DI METODI GENETICI NELLA IDENTIFICAZIONE DI CIANOBATTERI Susanna Vichi, Simonetta Gemma, Emanuela Testai Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Convegno Cianobatteri


Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA

Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Laboratorio di Metodologie e Tecnologie Genetiche ESERCITAZIONE DI BIOINFORMATICA Bioinformatica - Scienza interdisciplinare coinvolgente la biologia, l informatica, la matematica e la statistica per l



AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) AMPLIFICAZIONE IN VITRO DEL DNA REAZIONE A CATENA DELLA POLIMERASI (PCR) PCR: reazione polimerasica a catena Inventata da Kary Mullis negli anni 80 (premio Nobel 1993) Serve per ottenere una grande quantita


Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo TECNICHE PER L ANALISI


Metodiche Molecolari

Metodiche Molecolari Metodiche Molecolari La rivelazione degli acidi nucleici virali è un altro saggio che può essere utilizzato sia per verificare la presenza di un virus in un determinato campione biologico, sia per studiare





di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro

di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro di Milazzo Gabriele Mangiagli Graziella Paternò Valentina Lomagno Valeria Mangione Enza Prof. C. Di Pietro Polymerase Chain Reaction Inventata a metà degli anni 80 da Kary Mullis, è a tutt oggi uno strumento


Servizio fitosanitario regionale

Servizio fitosanitario regionale Regione Toscana Servizio fitosanitario regionale Il laboratorio di diagnostica fitopatologica e biologia molecolare Direzione generale Competitività del sistema regionale e sviluppo delle competenze Sviluppo


Replicazione del DNA

Replicazione del DNA Replicazione del DNA la replicazione del DNA viene effettuata da ENZIMI: DNA-polimerasi (catalizza la formazione del legame fosfodiestere) ogni filamento fa da stampo (enzima diretto dallo stampo) le DNA-polimerasi


Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati.

Biotecnologie ed OGM. Prima parte: DNA ricombinante e microorganismi geneticamente modificati. Biotecnologie ed OGM Prima parte: DNA ricombinante e microorganismi geneticamente modificati. COSA SONO LE BIOTECNOLOGIE? Si dicono Biotecnologie i metodi tecnici che permettono lo sfruttamento di sistemi


Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E

Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E Si può ottenere un a grande quantità di copie di DNA a partire da una singola molecola di DNA stampo La reazione è semplice ed automatizzabile E possibile scegliere selettivamente cosa amplificare (specificità)



LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR. Dott. Paolo Cascio LEZIONE X FUNZIONAMENTO E APPLICAZIONI DELLA PCR Dott. Paolo Cascio Tecnica della reazione a catena della DNA polimerasi o PCR (Polymerase Chain Reaction) 1) Introdotta da Kary Mullis alla metà degli anni


Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine)

Isolamento e purificazione di DNA e RNA. -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) Isolamento e purificazione di DNA e RNA -Rompere la membrana cellulare -Separare gli acidi nucleici da altri componenti cellulari (lipidi e proteine) -Separare gli acidi nucleici tra loro -Rompere la membrana


PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita





Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata

Metodologie citogenetiche. Metodologie molecolari. Formulare la domanda Utilizzare la metodica appropriata In base al potere di risoluzione della tecnica Metodologie citogenetiche Metodologie molecolari Formulare la domanda Utilizzare la metodica appropriata 1 DNA RNA PROTEINE DNA Cromosomi (cariotipo, FISH,


I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA


Considerazioni all approccio veterinario sulla genetica delle api

Considerazioni all approccio veterinario sulla genetica delle api III Convegno del Centro Apistico Regionale UN ISTANTANEA SANITARIA DEL SETTORE APISTICO Asti, 23 ottobre 2012 Considerazioni all approccio veterinario sulla genetica delle api Dott.ssa Alessandra Giacomelli


I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta

I marcatori genetici e loro applicazioni nelle produzioni animali. Dott.ssa Chiara Targhetta I marcatori genetici e loro applicazioni nelle produzioni animali Dott.ssa Chiara Targhetta LOCUS localizzazione genomica unica all interno di un cromosoma; permette di definire la posizione di un gene





HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie




Dettagli Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze Assegnista di ricerca Università degli Studi di Parma Dipartimento di Bioscienze Curriculum Vitae SARA GRAZIANO Informazioni personali Cognome Nome Indirizzo Telefono E-mail Cittadinanza Data di nascita Sesso Settore professionale Graziano Sara Italiana


Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi


L utilizzo dell approccio integrato è applicato in particolare per l identificazione di:

L utilizzo dell approccio integrato è applicato in particolare per l identificazione di: Lo ZooPlantLab, nasce all inizio del 2007, dall incontro di due ricercatori del Dipartimento di Biotecnologie e Bioscienze dell Università degli Studi di Milano Bicocca, Massimo Labra e Maurizio Casiraghi.


Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di

Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di Dopo aver effettuato la PCR, all interno della soluzione oltre al tratto amplificato sono presenti: primers, dntps, Taq polimerasi e tampone di reazione Inizialmente i 20 µl dell amplificato vengono


Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario

Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Un codice genetico per i mangimi, a tutela della qualità e della sicurezza nella produzione di latte, formaggi e carni Diego Breviario Istituto di Biologia e Biotecnologia Agraria (IBBA) Tuesday, October


Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte



BIOLOGA e BIOLOGO MOLECOLARE Copyright Università degli Studi di Torino, Progetto Atlante delle Professioni 2009 BIOLOGA e BIOLOGO MOLECOLARE Aggiornato il 6 luglio 2009 1. CARTA D IDENTITÀ... 2 2. CHE COSA FA... 4 3. DOVE LAVORA...


PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani,

PCR. (Reazione a catena della polimerasi) ESTRAZIONE del DNA da gel di AGAROSIO. Corso di INGEGNERIA GENETICA, Prof. Renato Fani, PCR (Reazione a catena della polimerasi) & ESTRAZIONE del DNA da gel di AGAROSIO Corso di INGEGNERIA GENETICA, Prof. Renato Fani, ESERCITAZIONE DI LAB. N.2 La PCR (Polymerase Chain Reaction) è una tecnica



VERBALE DI DETERMINA ISTITUTO ZOOPROFILATTICO SPERIMENTALE DELLA SARDEGNA "G. Pegreffi" SASSARI VERBALE DI DETERMINA N. 834 del 23/09/2013 OGGETTO: Acquisto di un sistema PCR Real Time per il Laboratorio Microbiologia degli


Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C

Pellet cellulare. Vortexare per 10-30 sec. Riscaldare il campione in un termoblocco per 10 min a 100 C PrepMan Ultra Sample Preparation Reagent Guida Rapida Per informazioni sulla sicurezza far riferimento alla sezione Safety del PrepMan Ultra Sample Preparation Reagent Protocol (PN 4367554). Per tutti


Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri).

Il primer utilizzato può essere specifico per il gene che si intende amplificare oppure aspecifico (oligo (dt) oppure random esameri). Retrotrascrizione l mrna viene convertito in cdna per mezzo dell enzima trascrittasi inversa (DNA polimerasi RNAdipendenti ricavate dai virus della mieloblastosi aviaria AMV o della leucemia murina di


Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica

Anamnesi Sintomi Lesioni. Diagnosi. Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica Silvio Pascucci 1 Anamnesi Sintomi Lesioni Esami : Istologici Virologici Sierologici Diagnosi Il ricorso agli esami di laboratorio è enormemente ingigantito, in particolare per la diagnosi virologica 2


SAGE: Serial Analysis of Gene Expression

SAGE: Serial Analysis of Gene Expression SAGE: Serial Analysis of Gene Expression L insieme di tutti gli mrna presenti in una cellula si definisce trascrittoma. Ogni trascrittoma ha una composizione complessa, con migliaia di mrna diversi, ciascuno


PATOLOGIE E AVVERSITA DELLE API: tecniche diagnostiche e di campionamento. Dr. Emanuele Carpana

PATOLOGIE E AVVERSITA DELLE API: tecniche diagnostiche e di campionamento. Dr. Emanuele Carpana PATOLOGIE E AVVERSITA DELLE API: tecniche diagnostiche e di campionamento Dr. Emanuele Carpana Ispezioni diagnostiche nella profilassi delle malattie infettive e parassitarie delle api Diagnosticare in


Strumenti e Tecniche di studio in patologia

Strumenti e Tecniche di studio in patologia Strumenti e Tecniche di studio in patologia Gli strumenti della patologia: Microscopia Biologia molecolare Indagini biochimiche Microscopia Ottica citopatologia ed istopatologia citochimica ed istochimica


LOTTO 2 (indivisibile)



Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma

Biologia Molecolare. CDLM in CTF 2010-2011 L analisi del genoma Biologia Molecolare CDLM in CTF 2010-2011 L analisi del genoma L analisi del genoma n La tipizzazione del DNA n La genomica e la bioinformatica n La genomica funzionale La tipizzazione del DNA DNA Fingerprinting


Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis

Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis Roma, ottobre 204 Metodi Molecolari per la Ricerca, Identificazione e tipizzazione di Francisella tularensis IZSLER Sezione di Pavia Nadia Vicari Metodi molecolari Rilevare Identificare Tipizzare Sub-tipizzare


Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna

Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Microbiologia Dipartimento di Farmacia e BioTecnologie Università di Bologna Prof. Giorgio Gallinella Prof.ssa Giovanna Gentilomi Dott.ssa Francesca Bonvicini (ricercatore) Dott.ssa Elisabetta Manaresi



scaricato da LA TECNOLOGIA DEI MICROARRAYS LA TECNOLOGIA DEI MICROARRAYS 1 8 anni dopo: 4162 riferimenti bibliografici sui microarrays I microarrays misurano il livello di espressione degli mrna trascritti dai geni del sistema biologico di interesse


e dei genotipi tossici

e dei genotipi tossici Metodi molecolari l per il riconoscimento dei cianobatteri e dei genotipi tossici Susanna Vichi Dip. Ambiente e Connessa Prevenzione Primaria Istituto Superiore di Sanità, Roma Workshop Sorveglianza delle


Lezione 4. Il sequenziamento del DNA, Sanger

Lezione 4. Il sequenziamento del DNA, Sanger Lezione 4 Il sequenziamento del DNA, Sanger Schema della lezione Polymerase chain reaction (PCR) Dal prodotto di PCR al sequenziamento di Sanger Lettura dei prodotti di sequenziamento con sequenziatori


Piergiovanni Piatti. NO OGM e carne di RAZZA PIEMONTESE: motivazioni alla base di queste scelte e strumenti per garantirle

Piergiovanni Piatti. NO OGM e carne di RAZZA PIEMONTESE: motivazioni alla base di queste scelte e strumenti per garantirle Piergiovanni Piatti NO OGM e carne di RAZZA PIEMONTESE: motivazioni alla base di queste scelte e strumenti per garantirle Impiego di tecniche biomolecolari per l analisi l degli alimenti e la tracciabilità


Tecniche di sequenziamento del DNA

Tecniche di sequenziamento del DNA Tecniche di sequenziamento del DNA -Metodo di Maxam e Gilbert (della degradazione chimica del DNA) -Metodo di Sanger (a terminazione di catena) Metodo di Maxam-Gilbert Questo metodo, basato sulla degradazione






PROGRAMMA OPERATIVO NAZIONALE RICERCA E COMPETITIVITÀ 2007-2013 AZIONE II - INTERVENTI DI SOSTEGNO ALLA RICERCA INDUSTRIALE Progetto di Ricerca PON 01_02400/2 dal titolo IDEN.Pr.E.P.T- Identificazione del prodotto e della sua provenienza territoriale CUP B38I3000540005 Avviso finalizzato alla formazione di elenchi da utilizzare



Allegato 1. COD_TD2 ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO ATTIVITA PRESTAZIONALI PER CIASCUN PROFILO Profilo 1 Esperto in tecnologie di pastificazione e spettrometria RAMAN L esperto dovrà operare presso la Piattaforma di Tecnologie Alimentari, laboratorio di


PCR (Polymerase Chain Reaction)

PCR (Polymerase Chain Reaction) PCR (Polymerase Chain Reaction) Metodo enzimatico estremamente rapido e semplice per produrre una quantità illimitata di copie della sequenza di un singolo gene Sometime a good idea comes to yow when you


Una proteina nella rete: Introduzione alla bioinformatica

Una proteina nella rete: Introduzione alla bioinformatica Una proteina nella rete: Introduzione alla bioinformatica L era genomica ha assistito ad una crescita esponenziale delle informazioni biologiche rese disponibili dai progressi nel campo della biologia


METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA

METODI ALTERNATIVI. PCR digitale per la rilevazione e quantificazione. assoluta del DNA METODI ALTERNATIVI PCR digitale per la rilevazione e quantificazione assoluta del DNA Roma, 25 settembre 2013 Giuseppina Buonincontro IZS PLV- S.S. Controllo Alimenti La prima generazione di PCR consente


ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli

ERSA - Agenzia regionale per lo sviluppo rurale Servizio ricerca e sperimentazione 33056 Pozzuolo del Friuli ANALISI OGM SOYA Il progetto si proponeva di verificare le caratteristiche qualitative di diversi lotti di soya rispetto alla contaminazione accidentale da OGM per avere una valutazione indicativa della






I MICRORGANISMI E GLI ALIMENTI Le applicazioni attuali delle biotecnologie NON OGM nel settore alimentare I MICRORGANISMI E GLI ALIMENTI Quanti microrganismi ingeriamo con gli alimenti? Si ingeriscono


Identificazione e studio delle Cellule Staminali Tumorali del carcinoma della mammella e dell adenocarcinoma del colon

Identificazione e studio delle Cellule Staminali Tumorali del carcinoma della mammella e dell adenocarcinoma del colon Identificazione e studio delle Cellule Staminali Tumorali del carcinoma della mammella e dell adenocarcinoma del colon Carmelo Lupo Coordinatore Tecnico U.O. Anatomia Patologica e Patologia Molecolare


Progetto POF LAB 3 a.s. 2014-2015. Concorso CusMiBio Una settimana da ricercatore 2015

Progetto POF LAB 3 a.s. 2014-2015. Concorso CusMiBio Una settimana da ricercatore 2015 Progetto POF LAB 3 a.s. 2014-2015 Concorso CusMiBio Una settimana da ricercatore 2015 Nel precedente a.s. 2013-2014, alcuni studenti dell Istituto hanno partecipato all edizione 2014 del concorso Una settimana


sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come


Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico

Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Amplificazione del DNA tramite reazione a catena della polimerasi (POLYMERASE CHAIN REACTION; PCR) e sue applicazioni in ambito biomedico Dottoressa Camerin Consuelo Laboratorio Oncoematologia Pediatrica


Biotecnologie ed OGM : come vengono trasferiti i geni?

Biotecnologie ed OGM : come vengono trasferiti i geni? Biotecnologie ed OGM : come vengono trasferiti i geni? a cura di Leonardo Magneschi Scuola Estiva di Orientamento Volterra 2007 Venerdì 29 giugno 2007 1 Introduzione all Ingegneria Genetica L ingeneria


Sistemi di tracciabilità per un attestato di identità molecolare. FEM 2 - Ambiente S.r.l. Spin-off dell Università degli Studi di Milano-Bicocca

Sistemi di tracciabilità per un attestato di identità molecolare. FEM 2 - Ambiente S.r.l. Spin-off dell Università degli Studi di Milano-Bicocca Sistemi di tracciabilità per un attestato di identità molecolare FEM 2 - Ambiente S.r.l. Spin-off dell Università degli Studi di Milano-Bicocca PROBLEMA L identificazione e il controllo della filiera delle


Progetto pilota europeo di sorveglianza sulla mortalitàdegli alveari

Progetto pilota europeo di sorveglianza sulla mortalitàdegli alveari Progetto pilota europeo di sorveglianza sulla mortalitàdegli alveari Franco Mutinelli Centro di referenza nazionale per l apicoltura Istituto Zooprofilattico Sperimentale delle Venezie 35020 Legnaro (PD)


Dati di Validazione ring-test Clavibacter michiganensis subsp. michiganensis

Dati di Validazione ring-test Clavibacter michiganensis subsp. michiganensis Dati di Validazione ring-test Clavibacter michiganensis subsp. michiganensis Febbraio 2014 1 1 Metodi I metodi scelti per la validazione dei protocolli sono i seguenti: Tipo di saggio Metodi validati Componente


La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano

La farmacogeneticanella gestione del paziente con tumore colorettale, l esperienza traslazionaleal CRO di Aviano SOC di Farmacologia Sperimentale e Clinica VI CONGRESSO NAZIONALE FITeLab Slow Medicine Laboratory: IT s the Future 1-2-3 Ottobre 2015 Ospedale Borgo Roma (Verona) La farmacogeneticanella gestione del


Tecniche molecolari per lo studio degli acidi nucleici

Tecniche molecolari per lo studio degli acidi nucleici Tecniche molecolari per lo studio degli acidi nucleici Prof.ssa Flavia Frabetti aa. 2010-11 Estrazione acidi nucleici (DNA o RNA) Verifica tramite elettroforesi su gel di agarosio Amplificazione o clonaggio


Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI)

Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Le tecniche molecolari nell epidemiologia infettiva e nella sorveglianza delle Hospital Acquired Infections (HAI) Dott.ssa G. Scalet Sezione Microbiologia-Dipartimento Di Patologia e Diagnostica Università


Decode NGS data: search for genetic features

Decode NGS data: search for genetic features Decode NGS data: search for genetic features Valeria Michelacci NGS course, June 2015 Blast searches What we are used to: online querying NCBI database for the presence of a sequence of interest ONE SEQUENCE


AlphaReal BREAST Scheda Tecnica

AlphaReal BREAST Scheda Tecnica AlphaReal BREAST Scheda Tecnica A3 DS RT 607 ARBreast_01_2015.doc Pag. 1 di 5 Rev. 01 del Gennaio 2015 Prodotto: AlphaReal BREAST Codice prodotto: RT-607.05.20 / RT-607.10.20 N Tests: 5/10 tests Destinazione


PREVENZIONE SANITARIA IN APICOLTURA conoscere le malattie dell alveare

PREVENZIONE SANITARIA IN APICOLTURA conoscere le malattie dell alveare - Azienda Sanitaria Trento - PREVENZIONE SANITARIA IN APICOLTURA conoscere le malattie dell alveare - dott. Franco Gatti - MORI 25 MARZO 2014 I fattori che causano direttamente le malattie delle api o


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza


Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO


La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007

La brevettazione in campo medico e biotecnologico. Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione in campo medico e biotecnologico Università degli Studi di Ferrara, 29 marzo 2007 La brevettazione delle sequenze di acido nucleico Elena Comoglio Jacobacci & Partners S.p.A. Brevetti


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)


Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #2 Dr. Marco Galardini AA 2012/2013 Contatti Dr. Marco Galardini Dip. Di Biologia Via Madonna del Piano 6, Polo Scientifico S. Fiorentino (c/o Incubatore


Genotipizzazione virale

Genotipizzazione virale Genotipizzazione virale Typing Separazione basata su maggiori differenze genetiche tra i membri di una singola specie virale Subtyping Individuazione di differenze stabili all interno di un gruppo di virus


Premesse. Lo sviluppo di nuovi medicinali è un processo molto impegnativo sia dal punto di vista procedurale che economico:

Premesse. Lo sviluppo di nuovi medicinali è un processo molto impegnativo sia dal punto di vista procedurale che economico: Premesse 2 Lo sviluppo di nuovi medicinali è un processo molto impegnativo sia dal punto di vista procedurale che economico: Su 8 molecole che presentano potenzialità terapeutiche solo 1, solitamente,


Sfrutta subito i Vantaggi! Validità 1 Aprile 30 Giugno 2005. Scopri la qualità e il risparmio!

Sfrutta subito i Vantaggi! Validità 1 Aprile 30 Giugno 2005. Scopri la qualità e il risparmio! Get Eppendorf quality today! Validità 1 Aprile 30 Giugno 2005 Sfrutta subito i Vantaggi! Scopri la qualità e il risparmio! Get Eppendorf quality


CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo INGEGNERIA GENETICA CORSO DI GENETICA INGEGNERIA GENETICA Tecniche di DNA ricombinante: gli enzimi di restrizione Le tecniche di base del DNA ricombinante fanno prevalentemente uso degli enzimi di restrizione. Gli enzimi
