COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!"

Transcript

1

2 COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

3 rimodellatori? Svolgimento del DNA nucleosmale a par6re dalle estremità (entry/exit sites) I nucleosomi (gli istoni) modificano la loro posizione rispetto alle sequenze del DNA e consentono il legame ai TF.!

4 I NUCLEOSOMI HANNO UNA STRUTTURA DINAMICA (Vicino le estremità) Quindi in linea di principio il DNA nucleosomale è disponibile per l interazione con proteine. Figure 4-28 Molecular Biology of the Cell ( Garland Science 2008)

5 Immunoprecipitazio ne della cromatina (ChIp) per mappare in vivo le proteine associate al DNA

6 ChIP-on-chip per determinare le modifiche dei nucleosomi e del DNA su scala genomica (composizione dell epigenoma) L Epigenoma è la combinazione delle modifiche a carico del DNA e della cromatina in ogni tipo cellulare

7 Modificazioni degli istoni su scala genomica

8 Modificazioni dei nucleosomi dei promotori e delle regioni codificanti. L Attivatore trascrizionale (ACT) legato all UAS recluta modificatori positivi come la HAT sul promotore, mentre la RNA polymerase (POL) recluta le istoni metilasi per metilare i nucleosomi dell inizio e delle ORF.! LE ISTONI METILASI SI ASSOCIANO ALLA CTD DELLA RNA pol II PER MODIFICARE LA CROMATINA DURANTE LA TRASCRZIONE. INIZIO Il complesso COMPASS si associa alla CTD fosforilata nella ser5 della Pol II e tramite la metilasi SET1 associata trimetila K4H3 del nucleosma posizionato sul punto d i inzio. DOT1 metila K79. ALLUNGAMENTO La fosforilazione della Ser 2 della CTD porta al reclutamento della metilasi Set2 che metila K36 di H

9 COME POSSONO LE MODIFICHE COVALENTI DEGLI ISTONI ALTERARE L ATTIVITA TRASCRIZIONALE?! Ogni singola modificazione istonica causa una modifica della struttura della cromatina attraverso due meccanismi (non mutualmente esclusive) 1. Meccanismi in cis: Le modifiche causano alterazioni dei contatti intra- e internucleosomali attraverso cambi di interazioni steriche e di carica (acetilazione e deacetilazione). 2. Meccanismi in trans: Le modifiche servono come elementi di riconoscimento per fattori che conducono a conseguenze funzionali

10 Modificazioni del dominio globulare alterano la struaura dei nucleosomi. 1. Modificazioni localizzate nell interfaccia istoni-istoni (punti di contatto tra gli istoni). L acetilazione di K91 e K92 di H4 possono destabillizare le interazioni dimero-tetramero e condurre al rilascio di H2A/H2B durante la trascrizione

11 Diversi modificatori di nucleosomi sono associate alla ser2-p-ctd della RNA pol II Durante la trascrizione, la HAT acetila i nucleosomi di fronte la polimerasi causando il loro disassemblaggio facilitando il trasferimento degli istoni sulle chaporine istoniche Spt6 (l esasoma) e FACT (H2A- H2B). Set2 metila la K36 di H3 che nel nucleosoma riassemblato dietro la RNA pol viene riconosciuto e legato dal cromodominio di una HDAC. Gli istoni sono così deacetilati e forse demetilati ripristinando il prolilo delle modiliche prima del passaggio della polimerasi. HDAC 11 istone demetilasi?

12 Interazioni tra K16 di H4 e la regione acida di H2A di due nucleosomi adiacen6! Visione lungo l asse diadico della struttura atomica di un di-nucleosoma mostra le interazioni (freccia) tra la coda N-terminale di H4 (verde) e il dominio globulare di H2A (giallo).!

13 La cromatina assemblata in vitro si compatta in presenza di Mg++! Le due strutture 2D di 40S e 50S sono considerate equivalente a due forme, rispettivamente, meno compatte e più compatte della fibra cromatinica di 30 nm presente in vivo. Defined conformational transitions in the nucleosomal array.

14 Il compattamento della cromatina è inibito dalla acetilazione di H4-K16. In assenza di Mg++ le quattro fibre hanno lo stesso coefficiente S (open symbols). In presenza di 1.0 mm MgCl2 (solid symbols) le fibre WT e H4-R23C si compattano (>S), mentre le fibre assemblate con H4 deleto della coda N- terminal (H4-ΔN) (solid squares) e quelle con H4-K16Ac, (solid triangles) hanno un folding meno compatto. 0 mm Mg++ 1mM Mg++ -Mg ++ H4 WT H4-R23C H4-K16Ac H4-ΔN

15 La piccola regione acida di H2A sulla superficie del nucleosoma è cruciale per il folding del filamento nucleosomale nella fibra chromatinica più compatta! cromatina assemblata con H2A varianti e mutanti della regione acida Folding nella fibra 30 nm più compatta > 40S! H2A.Bbd! H2A-STT! H2A.Bbd-EE! H2A.Bbd-EEE! H2A! H2A.Bbd inibisce la formazione della fibra di 30 nm più compatta, e probabilmente promuove il rilassamento della cromatina condenzata per consentire la trascrizione

16 LE MODIFICHE DEGLI ISTONI SONO ELEMENTI DI RICONOSCIMENTO DI ALTRI FATTORI REGOLATIVI 1. Il bromodominio è una regione di circa 50 amminoacidi, presente in diverse proteine associate alla cromatina, che si lega alla lisina acetilata delle code degli istoni.! 2. Il cromodominio è una regione di 37 amminoacidi, presente in alcune proteine eterocromatiche (HP1, istone metilasi SUV39), che lega specificamente la lisina 9 metilata di H3!

17 I lettori (readers) riconoscono le modifiche istoniche scritte dai writers e attraggono altri complessi con attività catalitica. Figure 4-43 Molecular Biology of the Cell ( Garland Science 2008)

18

19 Le subunità ATPasiche associate ai complessi di rimodellamento della cromatina contengono il bromodominio o altri domini di interazione con i nucleosomi.

20 Complessi di rimodellamento e modificatori di istoni lavorano insieme per regolare l espressione genica

21

22 Nucleosoma maschera La TATA box. Eventi che conducono alla formazione del PIC del gene HO di lievito. a. L attivatore A (SBF) legato all UAS recluta una Kinasi (Ki) che Phosphorila la Ser10 di H3. b. La HAT vviene reclutata e acetila la lisina 14 di H3. c. L attivatore recluta SWI/SNF. Attraverso il bromodominio lega la acetyl- K14. Il nuclesoma è rimodellato ed esponene la TATA box. d. -Il legame della TBP introduce una curvatura che fa scivolare il NUCLESOMA. Il PIC si assembla e la trascrizione può partire. rimodell. cromat.swf

23 Ordine di reclutamento nel promotore del gene dell Interferone Beta a) I TF si assemblano sull enhancer libero da nucleosmi a formare l enhansoma. b) L enhansosoma recluta un complesso HAT (GCN5) che Acetila la K9 di H3 e K8 di H4. c) L enhansosoma recluta una kinasi che fosforila la S10 di H3. HAT acetila K14 di H3. d) Il complesso SWI/SNF lega gli istoni acetilati e rimodella il nucleosoma posizionato sul promotore. e) Il nucleosoma rimodellato espone la TATA box che può così legare TFIID. f) Il PIC si può assemblare.

24 Sul gene umano dell α1-antitripsina l intero PIC si assembla sul promotore prima del reclutamento dei complessi di rimodellamento e della HAT

25 La modificazione degli istoni e del DNA regola la funzione della cromatina

26

27 Lʼ Eterocromatina in Saccharomyces cerevisiae è localizzata in tre loci! Silent mating-type loci (III)! HMLα! MATa! or! MATα! HMRa! Telomeres! Ribosomal DNA (XII)!

28 = Silent Information Regulators (SIR genes)! HM! Telomeres! rdna! Funzione! SIR1" +! -! -! istaurazione eterocromatina! SIR2" +! +! +! SIR3" +! +! -! SIR4" +! +! -! HDAC! Manteimento/! spreading eterocr.! Manteimento/! spreading eterocr.!

29 La metilazione di H3 K79 da parte di DOT 1 blocca il legame delle proteine eterocromatiche Sir

30 Nel lievito S. cerevisae l eterocromatina e il silenziamento telomerico avviene ad opera delle Sirtuine Sir3! Sir4! Rap1! Rap1! Rap1! Rap1! Rap1! Sir2! telomere! repeats! Heterochromatin! spreading!

31

32

33 HP1 con il cromodominio ombra polimerizza e recluta l istone metilasi SUV39 propagando cos le modifiche agli istoni vicini. HP1 Suv39

34 LA PROPAGAZIONE DELL ETEROCROMATINA PUO INATTIVARE GENI EUCROMATICI

35 VARIEGAZIONE DELL EFFETTO POSIZIONE (PEV)! Nel PEV il gene white non viene mutato; un riarrangiamento cromosomico lo pone vicino ad una regione eterocromatica. Il silenziamneto di white avviene in alcune cellule (omnatidi) durante il differenziamento dell occhio ed è ereditato dalla progenie (effetto clonale). Poiché il genotipo delle cellule è lo stesso mentre il fenotipo è differente, il fenomeno è EPIGENETICO. gene white nella sua normale posizione dell eucromatina boundary!

36 ELEMENTI CROMATINICI CHE DELIMITANO DOMINI D ESPRESSIONE GENICA: ISOLATORI Gli isolatori croma6nici possono avere una o entrambe funzioni: Elemen6 barriera o di confine (Boundary Elements) Blocco dell enhancer (Enhancer Blocking)

37 1. Isolatori come barriera all avanzamento dell eterocromartina e quindi al silenziamento genico Eucromatinico Gli elementi barriera bloccano l avanzata dell eterocromatina mediante il reclutamento degli enzimi come le HAT o rimodellatori di nucleosomi come CRA che conferiscono uno stato permissivo alla trascrizione al dominio cromatinico.

38 B. LEWIN, IL GENE - Edizione compatta, Zanichelli Editore S.p.A. Copyright 2007

39 1. Enhancer blocking. Blocca la diffusione di una influenza posi6va (enhancer) o nega6va (silenziatori) solo se interpos6 tra ques6 elemen6 gene6ci e i promotori. Ins En1 En2 Prom En3 Ins Effetto Direzionale: A monte dell enhancer l isolatore non ha effetto. En1 Ins En2 Prom En3 Effetto Polare: L isolatore posto tra due enhancers, blocca quello localizzato più distale rispetto al promotore.

40 L enhancer bloccato nell interazione con il promotore in una direzione, può attivare la trascrizione da un promotore nella direzione opposta.

41 Gli isolatori cromatinici sono degli elementi genetici che separano domini d espressione genica.

42 Meccanismi epigenetici! Fattori che vengono trasmessi alla progenie, ma che non sono direttamente attribuibili alla sequenza del DNA. Modificazioni degli istoni; Acetilazioni, fosforilazioni e metilazioni, responsabili di cambiamenti conformazionali della cromatina. Metilazione del DNA; Nelle cellule eucariotiche la metilazione è a carico della C. Solo il 3% delle C sono metilate ed in genere è bersaglio della metilazione la C della doppietta CpG.

43 EREDITA GENETICA ED EREDITA EPIGENETICA! Figure 4-35 Molecular Biology of the Cell ( Garland Science 2008)

44 Metilazione del DNA

45

46 LA METILAZIONE DEL DNA PUO ESSERE MANTENUTA ATTRAVERSO LE DIVISIONI CELLULARI

47 Quali regioni sono bersaglio della metilazione? I geni dei vertebrati e piante sono marcati da isole CpG di lunghezza compresa tra 0,3 e 3 kb. Sono regioni ipometilate del genoma solitamente localizzate nelle vicinaze dei promotori della maggior parte dei geni (>50%) umani e di altri vertebrati attivamente trascritti. In queste regioni la frequenza di CpG è circa del 60%, nella restante parte del genoma è invece più bassa del 20% rispetto all atteso. gene housekeeping espresso in tutti i tessuti : abbondanza di isole CpG al 5 gene tessuto specifco: povero di isole CpG

48 Attivatore legato al DNA non metilato

49 La metilazione della ICR controlla l imprinting

50 LA METILAZIONE DEL DNA E ASSOCIATA AL SILENZIAMENTO GENICO

51 Il DNA metilato recluta il complesso HDAC e HMT Histone methylase Histone deacetylase methyl-cpg-binding domain [MBD] proteins Silenziamento eterocromatinico 51

52 RELAZIONE TRA GENOMA E EPIGENOMA Il Genoma è l informazione genetica codificata nel DNA.! i. LʼEpigenoma è la combinazione delle modifiche a carico del DNA e cromatina in ogni tipo cellulare e rappresenta lo stato Epigenetico delle cellule.! ii. Lʼepigenoma è la maniera delle cellule di esprimere lʼinformazione genetica.! iii. Un solo genoma per tutte le cellule, epigenomi differenti per i diversi tipi cellulari.! Genoma Epigenoma DNA Cromatina Histone Acetylation Ac Me Histone Methylation Gene Expression DNA Methylation Phenotype 52

53 CLASSICA DEFINIZIONE DI EPIGENETICA Cambio nello stato d espressione di un gene che non coinvolge una mutazione, ma che può essere ereditato anche in assenza di segnali o eventi che hanno iniziato il cambio. Le modifiche della croma6na e la me6lazione del DNA possono essere considerate epigene6che solo se stabilmente propagate alla progenie cellulare aaraverso la replicazione del DNA e della croma6na. 53

54 Alterationi che durano meno di un ciclo cellulare non sono epigenetiche (green asterisk, a) perchè non sono ereditate. Alterazioni non-mutazionali che sono trasmesse da una cellula alle cellule figlie (red asterisk, b) o tra generazioni di un organismo (blue asterisk, c) sono qualificate come epigenetiche. Perceptions of epigenetics NATURE Vol May

55 L Epigene6ca svolge importan6 ruoli nel differenziamento cellulare e normale e nel cancro, EPIGENOMA Meccanismi Epigenetici normali Meccanismi Epigenetici de-regolati Differenziamento normale, e.g. embryonic cells, hematopoetic cells Malignant progenitor cell Tumor

56 I cambiamenti Epigenetici possono cooperare con le mutazioni genetiche per promuovere l oncogenesi! GENETIC EPIGENETIC Errori nella replicazione, agenti mutageni alterano la sequenza nucleotidica! Altered! DNA/mRNA/proteins! X X Oncogenesis Errori nelle modificazioni dei nucleosmi e/o della metilazione del DNA alterano la struttua della cromatina! Altered levels of! mrna/proteins! Oncogene function Tumor suppressor function Oncogene levels Tumor suppressor levels Tumor

57 Nei Tumori, Cambiamenti della struttura della Cromatina può silenziare gli Oncosoppressori! Normal cells Ac Ac Ac Cancer cells Ac Ac Ac Ac Ac Ac Tumor suppressor gene expression Tumor suppressor gene expression 57

58

eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni

Dettagli

LA STRUTTURA DELLA CROMATINA E DINAMICA, SI MODIFICA A SECONDA DELLO STATO TRASCRIZIONALE

LA STRUTTURA DELLA CROMATINA E DINAMICA, SI MODIFICA A SECONDA DELLO STATO TRASCRIZIONALE LA STRUTTURA DELLA CROMATINA E DINAMICA, SI MODIFICA A SECONDA DELLO STATO TRASCRIZIONALE La cromatina dei geni che devono espressi viene rilassata per consentire la formazione del complesso di trascrizione.

Dettagli

Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la

Dettagli

Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,

Dettagli

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA)

SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) SUPERAVVOLGIMENTO DEL DNA (ORGANIZZAZIONE TERZIARIA DEL DNA) ORGANIZZAZIONE TERZIARIA DEL DNA Il DNA cellulare contiene porzioni geniche e intergeniche, entrambe necessarie per le funzioni vitali della

Dettagli

Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI

Dettagli

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica 1 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate

Dettagli

www.fisiokinesiterapia.biz

www.fisiokinesiterapia.biz Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici www.fisiokinesiterapia.biz Fattori estrinseci Ambiente Danno genotossico

Dettagli

Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica http://www.nature.com/scitable/ebooks/essentials-of-cell-biology- 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della

Dettagli

Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti

Dettagli

REGOLAZIONE DELL ESPRESSIONE GENICA

REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)

Dettagli

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per

Dettagli

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti

Nella figura si vedono i cromosomi di un fibroblasto umano, colorati con specifiche sonde fluorescenti NUCLEO Il nucleo è la centrale operativa che controlla i vari processi che si svolgono dentro la cellula. Contiene il materiale genetico DNA e proteine. Quando la cellula è a riposo il DNA è sotto forma

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come

Dettagli

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,

Dettagli

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com)

You created this PDF from an application that is not licensed to print to novapdf printer (http://www.novapdf.com) CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT

Dettagli

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz

LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I. www.fisiokinesiterapia.biz LA REGOLAZIONE GENICA DEGLI EUCARIOTI parte I www.fisiokinesiterapia.biz NON TUTTI I GENI VENGONO UTILIZZATI NELLO STESSO MOMENTO E NON TUTTI CON LA STESSA INTENSITÀ Regolazione genica = la modalità con

Dettagli

REGOLAZIONE DELL'ESPRESSIONE GENICA

REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.

Dettagli

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione.

C2. Il rilascio del fattore sigma marca il passaggio alla fase di allungamento della trascrizione. Soluzioni ai problemi del Capitolo 12 Domande concettuali C1. A. I geni dei trna codificano molecole di trna e i geni degli rrna le molecole di rrna che si trovano nei ribosomi. Esistono anche dei geni

Dettagli

Le basi chimiche dell ereditarietà

Le basi chimiche dell ereditarietà Le basi chimiche dell ereditarietà 1 Il codice della vita Il DNA, o acido desossiribonucleico, è cos7tuito da lunghe catene di nucleo7di; ogni nucleo7de è composto da uno zucchero (deossiribosio), un gruppo

Dettagli

Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 renata.tisi@unimib.it Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere

Dettagli

Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di

Dettagli

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%

Dettagli

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di

Dettagli

La rivoluzione epigenetica

La rivoluzione epigenetica La rivoluzione epigenetica Mauro Durante 2011 Perceptions of epigenetics Adrian Bird (2007) Geneticists study the gene; however, for epigeneticists, there is no obvious epigene. Nevertheless, during the

Dettagli

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY.

Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Carpire il segreto della vita con l informatica Giosuè Lo Bosco Dipartimento di Matematica e Informatica, Università di Palermo, ITALY. Lezioni Lincee Palermo, 26 Febbraio 2015 Alla base della vita degli

Dettagli

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22

Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA. Angela Chambery Lezione 22 Corso di Laurea in Farmacia Insegnamento di BIOCHIMICA Angela Chambery Lezione 22 La trascrizione procariotica dell RNA Concetti chiave: L RNA polimerasi è simile alla DNA polimerasi nella struttura e

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from www.immunologyhomepage.com. Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from www.immunologyhomepage.com Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno

Dettagli

Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione

Dettagli

Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di

Dettagli

Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi

Dettagli

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione nei procarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione nei procarioti Concetti base Nucleoside base purinica o pirimidinica legata alla posizione 1 dell anello pentoso Nucleotide base azotata-pentoso-fosfato Concetti base La trascrizione comporta

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Gene number 19,000 30,000

Gene number 19,000 30,000 Gene number 6000 19,000 13,500 30,000 30,000 MODULI: Nucleotidi (4) Amino acidi (21) Domini proteici/proteine (Domini di interazione proteina-proteina Proteina/DNA o Proteina /RNA Interazione con membrana

Dettagli

Replicazione del DNA

Replicazione del DNA Replicazione del DNA Chimica della replicazione del DNA Enzimologia della replicazione del DNA Replicazione del DNA nei procarioti Replicazione del DNA negli eucarioti Replicazione alle estremità www.studxwebmedicina.altervista.org

Dettagli

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16

Sistemi di regolazione. MICROBIOLOGIA GENERALE C. Mazzoni 05/16 Sistemi di regolazione Importanza del controllo I componenti cellulari devono essere presenti nelle giuste concentrazioni. La composizione chimica dell ambiente che circonda la cellula è in contante cambiamento

Dettagli

Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis

Dettagli

GENETICA GENERALE E MOLECOLARE

GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e

Dettagli

SINDROMI MIELODISPLASTICHE

SINDROMI MIELODISPLASTICHE SINDROMI MIELODISPLASTICHE MECCANISMI MOLECOLARI R. Piazza MECCANISMI MOLECOLARI Bejar R et al. JCO 2011;29:504-515 NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic

Dettagli

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8

Prof. C. Mazzoni. Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza. Appunti della lezione 16 Capitolo 8 MICROBIOLOGIA GENERALE Prof. C. Mazzoni Corso di Laurea Triennale in Biotecnologie Agro- Industriali Università di Roma La Sapienza Appunti della lezione 16 Capitolo 8 REGOLAZIONE TRASCRIZIONE DELLA Negli

Dettagli

Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri

Dettagli

Applicazioni biotecnologiche in systems biology

Applicazioni biotecnologiche in systems biology Applicazioni biotecnologiche in systems biology Lezione #6 Dr. Marco Galardini AA 2012/2013 Gene regulation analysis Lezione #6 Dr. Marco Galardini AA 2012/2013 Regolazione genica Elementi molecolari e

Dettagli

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma

Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Dal macroscopico al microscopico. L interpretazione molecolare Giuseppe Macino La Sapienza Roma Animali buoni Animali pericolosi Animali fastidiosi Animali inutili Cromosomi umani Quanto DNA e contenuto

Dettagli

Dal paziente al gene malattia : il clonaggio posizionale del gene Met

Dal paziente al gene malattia : il clonaggio posizionale del gene Met Dal paziente al gene malattia : il clonaggio posizionale del gene Met Una storia di interazione fra Medicina e Ricerca a cura di Debora Angeloni, Ph.D., Settore di Medicina Scuola Estiva di Orientamento

Dettagli

www.fisiokinesiterapia.biz TRASCRIZIONE

www.fisiokinesiterapia.biz TRASCRIZIONE www.fisiokinesiterapia.biz TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti

Dettagli

IL RUOLO DELLA METILAZIONE DELL ISTONE H3 DURANTE LA FORMAZIONE DELL ETEROCROMATINA FACOLTATIVA

IL RUOLO DELLA METILAZIONE DELL ISTONE H3 DURANTE LA FORMAZIONE DELL ETEROCROMATINA FACOLTATIVA UNIVERSITÀ DEGLI STUDI DELLA TUSCIA DI VITERBO DIPARTIMENTO DI AGROBIOLOGIA ED AGROCHIMICA CORSO DI DOTTORATO DI RICERCA GENETICA E BIOLOGIA CELLULARE - XXI CICLO. TITOLO TESI DI DOTTORATO DI RICERCA:

Dettagli

Vettori di espressione

Vettori di espressione Vettori di espressione Vengono usati per: 1.Generare sonde di RNA 2.Produrre la proteina codificata Per fare questo viene utilizzato un promotore che risiede sul vettore, modificato per ottimizzare l interazione

Dettagli

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz

DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI. www.fisiokinesiterapia.biz DIFFERENZIAMENTO E COMUNICAZIONE TRA CELLULE - LE CELLULE STAMINALI www.fisiokinesiterapia.biz sito dell NIH sulle cellule staminali in genere http://stemcells.nih.gov/info/basics/basics4.asp sito completo

Dettagli

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25

Stabilità della doppia elica di DNA in soluzione 23 Strutture alternative e strutture superiori degli acidi nucleici 25 Indice DALLA SCOPERTA DEL DNA AL CODICE GENETICO E STRUTTURA DEGLI ACIDI NUCLEICI 1 A Capitolo 1 Introduzione alla Biologia Molecolare 3 1.1 Che cos è la Biologia Molecolare? 3 1.2 Il gruppo del fago e

Dettagli

Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina

Dettagli

LA REGOLAZIONE DELL'ESPRESSIONE GENICA

LA REGOLAZIONE DELL'ESPRESSIONE GENICA LA REGOLAZIONE DELL'ESPRESSIONE GENICA La regolazione genica nei Procarioti Il cromosoma dei Procarioti Il cromosoma procariote è formato da una catena continua (circolare) di DNA a doppio filamento dello

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

DI REGOLAZIONE A DUE COMPONENTI

DI REGOLAZIONE A DUE COMPONENTI LEZIONE 16 Sistemi di regolazione SISTEMI DI REGOLAZIONE A DUE COMPONENTI In che modo un batterio sente e risponde a specifici segnali provenienti dall ambiente? Per esempio, nel caso dell operone lac

Dettagli

Jazz e DNA. Paolo Vineis Imperial College London. con Paolo Fresu e Luca Carra

Jazz e DNA. Paolo Vineis Imperial College London. con Paolo Fresu e Luca Carra Jazz e DNA Paolo Vineis Imperial College London con Paolo Fresu e Luca Carra Charlie Parker Qualche notizia sugli avanzamenti della genetica molecolare: - il dogma un gene-una proteina non e piu vero:

Dettagli

Invecchiamento cellulare e dell organismo

Invecchiamento cellulare e dell organismo Invecchiamento cellulare e dell organismo Un problema sociale di enorme importanza nel mondo occidentale; L Italia é il Paese piú vecchio del mondo!!! Invecchiamento fisiologico e invecchiamento patologico

Dettagli

Corso di aggiornamento sulle Biotecnologie CusMiBio

Corso di aggiornamento sulle Biotecnologie CusMiBio Corso di aggiornamento sulle Biotecnologie CusMiBio Regolazione dell espressione genica dal DNA alle proteine Prof. Paolo Plevani, Aula 200, 22/09/2014 LEARNING WEEK Qualche novità e/o stimolo sul controllo

Dettagli

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la

Dettagli

La Biopsia Prostatica: where are we going?

La Biopsia Prostatica: where are we going? La Biopsia Prostatica: where are we going? Sabato 28 Novembre 2015, Catania Dott. Michele Salemi Screening genetico correlato a rischio di carcinoma prostatico. BRCA1, BRCA2, TP53, CHEK2, HOXB13 e NBN:

Dettagli

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare

Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Le cellule eucariotiche svolgono durante la loro vita una serie ordinata di eventi che costituiscono il Ciclo Cellulare Interfase comprende le fasi G 1, S, and G 2 Sintesi di macromolecole durante la

Dettagli

Base cellulare della vita

Base cellulare della vita Base cellulare della vita Prof.ssa Flavia Frabetti 2011-2012 La cellula è l unità strutturale e funzionale degli organismi viventi 1 BASE CELLULARE DELLA VITA Teoria cellulare (Schleiden e Schwann 1839;

Dettagli

Genetica dei microrganismi 3

Genetica dei microrganismi 3 Genetica dei microrganismi 3 2 In questo caso il filtro poroso non eliminava lo scambio, indicando l esistenza di un fattore diffusibile DNasi resistente Trasduzione generalizzata 3 Figura 10.14 4 Trasduzione

Dettagli

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano

Riparazione del DNA ed insorgenza di tumori. Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Riparazione del DNA ed insorgenza di tumori Marco Muzi Falconi Dip. Scienze Biomolecolari e Biotecnologie Università degli Studi di Milano Danni al DNA e cancro Le cellule tumorali L importanza della stabilità

Dettagli

Le cellule cancerose

Le cellule cancerose Le cellule cancerose Cosa è il cancro? Malattia che insorge in conseguenza di anomalie della funzionalità cellulare E la Seconda causa di morte si possono sviluppare in quasi tutti gli organi Le diverse

Dettagli

PNEINEWS ALIMENTAZIONE E CANCRO LE DUE FACCE I NUOVI SAPERI DELLA SALUTE. Cibi che promuovono, cibi che proteggono

PNEINEWS ALIMENTAZIONE E CANCRO LE DUE FACCE I NUOVI SAPERI DELLA SALUTE. Cibi che promuovono, cibi che proteggono rivista della società italiana di psico - neuro - endocrino - immunologia diretta da Francesco Bottaccioli PNEINEWS I NUOVI SAPERI DELLA SALUTE ALIMENTAZIONE E CANCRO LE DUE FACCE Cibi che promuovono,

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali

SOLUZIONI AI PROBLEMI DEL CAPITOLO 21. Domande concettuali SOLUZIONI AI PROBLEMI DEL CAPITOLO 21 Domande concettuali C1. La genomica strutturale studia la composizione di un genoma. Lo scopo è di mappare tutti i geni nel genoma e alla fine di determinare la sequenza

Dettagli

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT

MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e

Dettagli

Regolazione trascrizionale della biogenesi dei ribosomi in Saccharomyces cerevisiae: geni per snorna e geni ribi

Regolazione trascrizionale della biogenesi dei ribosomi in Saccharomyces cerevisiae: geni per snorna e geni ribi Dottorato di ricerca in Biochimica e Biologia Molecolare XXV ciclo Regolazione trascrizionale della biogenesi dei ribosomi in Saccharomyces cerevisiae: geni per snorna e geni ribi Maria Cristina Bosio

Dettagli

Prof. Maria Alessandra Santucci

Prof. Maria Alessandra Santucci La famiglia Abl consiste di due isoforme Abl (1a e 1b ) e due isoforme Arg (1a e 1b). Le isoforme di tipo b contengono un sito di miristoilazione all N-teminale che manca nelle isoforme a. c-abl è una

Dettagli

Lezione XXVII-XXVIll giovedì 1-XII-2011

Lezione XXVII-XXVIll giovedì 1-XII-2011 Lezione XXVII-XXVIll giovedì 1-XII-2011 corso di genomica Laurea Magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 libro consigliato Zanichelli Introduz.

Dettagli

Stem Cells. Medicine Biology. Bioethics

Stem Cells. Medicine Biology. Bioethics Stem Cells Medicine Biology Bioethics Dal DNA all organismo complesso Organismo (uomo) Il corpo umano è composto damiliardi di cellule Ogni nucleo cellulare è dotato di un identico corredo cromosomico

Dettagli

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

Il metabolismo dell RNA. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie Il metabolismo dell RNA I vari tipi di RNA Il filamento di DNA che dirige la sintesi dello mrna è chiamato filamento stampo o filamento antisenso. L altro filamento che ha sequenza identica a quella dello

Dettagli

Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene

Dettagli

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica.

Si tratta di corpiccioli di natura ribonucleoproteica che nel citoplasma di tutte le cellule presiedono ai processi di sintesi proteica. I R I BOSOM I I RIBOSOMI sono organuli citoplasmatici presenti in tutte le cellule, sia procariotiche che eucariotiche. Sono visibili al M.O. solo quando presenti in gran numero, (come capita nelle cellule

Dettagli

Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,

Dettagli

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico

Attori principali nei TCRS. Processi biologici in cui sono coinvolti sistemi a due componenti. Numero di TCRS nel genoma batterico rocessi biologici in cui sono coinvolti sistemi a due componenti Utilizzazione di elementi necessari alla crescita (azoto); NtrC Virulenza (BvgAS di Bordetella pertussis) Resistenza a metalli pesanti (pco)

Dettagli

Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici

Dettagli

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico

LA REGOLAZIONE GENICA NEGLI EUCARIOTI. 1. Il genoma eucariotico è più complesso di quello procariotico LA REGOLAZIONE GENICA NEGLI EUCARIOTI INTRODUZIONE Tutti sanno, almeno in generale, come una generazione di esseri viventi dà origine alla successiva; ma quali meccanismi sono alla base di questo processo?

Dettagli

Il flusso dell informazione genetica. DNA -->RNA-->Proteine

Il flusso dell informazione genetica. DNA -->RNA-->Proteine Il flusso dell informazione genetica DNA -->RNA-->Proteine Abbiamo visto i principali esperimenti che hanno dimostrato che il DNA è la molecola depositaria dell informazione genetica nella maggior parte

Dettagli

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma).

Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). Geni sovrapposti Lo splicing alternativo aumenta in modo considerevole la complessità del trascrittoma (e quindi del proteoma). % Splicing Alternativo Oltre il 90% dei geni umani è in grado di esprimere

Dettagli

The Role of Nucleoporin Genes in Human Leukemias

The Role of Nucleoporin Genes in Human Leukemias The Role of Nucleoporin Genes in Human Leukemias INTRODUZIONE Il mio progetto di ricerca, finanziato dall Associazione Damiano per l Ematologia, si è inserito in un più ampio studio di caratterizzazione

Dettagli

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari

Dettagli

D ora in poi ci occuperemo, per semplicità, soltanto della RNA polimerasi II.

D ora in poi ci occuperemo, per semplicità, soltanto della RNA polimerasi II. RNA Polimerasi di eucarioti (vedi Alberts III ed. pag.483) Il processo di sintesi di RNA su di uno stampo di DNA presenta, negli eucarioti, una complessità assai elevata. A tutt oggi mancano ancora alcune

Dettagli

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà

Bioinformatica (1) Introduzione. Dott. Alessandro Laganà Bioinformatica (1) Introduzione Dott. Alessandro Laganà Dott. Alessandro Laganà Martedi 15.30 16.30 Studio Assegnisti - 1 Piano (Davanti biblioteca) Dipartimento di Matematica e Informatica (Città Universitaria)

Dettagli

A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla

Dettagli

LE MOLECOLE DI RNA: rrna trna mrna

LE MOLECOLE DI RNA: rrna trna mrna LE MOLECOLE DI RNA: rrna trna mrna RNA polimerasi Localizzazione Prodotti Effetti dell α-amanitina I Nucleolo 25S, 17S e 5.8S rrna Nessuno II Nucleoplasma mrna, U1, U2, U4 e U5 Fortemente inibitori III

Dettagli

NIACINA (vitamina B3 o PellagraPreventing)

NIACINA (vitamina B3 o PellagraPreventing) NIACINA (vitamina B3 o PellagraPreventing) (vitameri: ACIDO NICOTINICO, NICOTINAMMIDE o NIACINAMMIDE) Fonti alimentari: carni, fegato, cereali, legumi, tè, caffè RDA: 18 (M)-14 (F) mg NE/die Coenzima:

Dettagli

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro

Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Checkpoint ATM-K e ATR-K nella riparazione dei mismatch dopo la trascrizione del DNA Vincenzo Dipierro Le chinasi ATM e ATR sono coordinatrici di un fine meccanismo di controllo noto come checkpoint del

Dettagli

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri

LA GENETICA: DNA e RNA LA GENETICA. DNA e RNA. Prof. Daniele Verri LA GENETICA DNA e RNA Prof. Daniele Verri L'acido desossiribonucleico o deossiribonucleico (DNA) è un acido nucleico che contiene le informazioni necessarie per la formazione di RNA e proteine. LA GENETICA:

Dettagli

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo A COSA SERVE il

Dettagli

«La sola speranza di arrivare un giorno a controllare i tumori risiede nella maggiore comprensione delle cause e della patogenesi di questa malattia»

«La sola speranza di arrivare un giorno a controllare i tumori risiede nella maggiore comprensione delle cause e della patogenesi di questa malattia» «La sola speranza di arrivare un giorno a controllare i tumori risiede nella maggiore comprensione delle cause e della patogenesi di questa malattia» Oncologia Definizioni, e criteri di classificazione

Dettagli

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula

Mediatore chimico. Recettore. Trasduzione del segnale. Risposta della cellula Mediatore chimico Recettore Trasduzione del segnale Risposta della cellula I mediatori chimici sono prodotti da cellule specializzate e sono diffusi nell organismo da apparati di distribuzione Sistemi

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

IL FATTORE DI RIMODELLAMENTO DELLA CROMATINA BRM HA UN RUOLO SPECIFICO NEL CORSO DEL DIFFERENZIAMENTO MUSCOLARE

IL FATTORE DI RIMODELLAMENTO DELLA CROMATINA BRM HA UN RUOLO SPECIFICO NEL CORSO DEL DIFFERENZIAMENTO MUSCOLARE Dottorato di Ricerca in Genetica e Biologia Cellulare - XVIII ciclo IL FATTORE DI RIMODELLAMENTO DELLA CROMATINA BRM HA UN RUOLO SPECIFICO NEL CORSO DEL DIFFERENZIAMENTO MUSCOLARE s.s.d.: BIO-11 Sonia

Dettagli