Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it"

Transcript

1 Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano

2 Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle malattie genetiche. Essa è orientata alla formulazione della diagnosi clinica di malattia genetica e alla consulenza genetica al fine di valutare l'eventuale rischio riproduttivo per il paziente e la sua famiglia. Il genetista è anche chiamato a svolgere un ruolo diagnostico e preventivo per alcune delle più frequenti malattie, come quelle cardiovascolari e tumorali.

3 Genetista Clinico Medico Consulenza Genetica Consulente (Genetista Clinico) Consultando (la persona che ha richiesto la consulenza)

4 Consulenza Genetica La consulenza genetica è un complesso processo di comunicazione tra consulente e consultando, che si propone di aiutare a comprendere le informazioni mediche riguardanti la diagnosi, il decorso e gli interventi preventivi e terapeuticoassistenziali disponibili, la componente genetica della malattia ed il rischio di trasmetterla e le opzioni, comprese quelle procreative, disponibili nell affrontare il rischio di malattia.

5 Consulenza Genetica Atto sanitario non direttivo Nel caso di richiesta di test genetico Consulenza genetica pre-test Consulenza genetica post-test

6 Genetista Clinico Diagnostica una nuova malattia genetica Informa il consultando sulla sua malattia genetica Informa il consultando sul rischio di ricorrenza di malattie genetiche familiari Prepara la coppia a scelte prenatali consapevoli

7 Diagnosi Tutto o Niente Sindromi cromosomiche Sindrome di Down (Trisomia 21) Sindrome di Edwards (Trisomia 18) Sindrome di Patau (Trisomia 13) Sindrome di Turner (45, X0) Sindrome di Klinefelter (47, XXY) Test genetico: Cariotipo (oltre paia di basi di DNA)

8 Diagnosi Tutto o Niente? Microriarrangiamenti cromosomici Sindrome da Delezione 22q11.2 (Sindrome di DiGeorge) Sindrome di Wolf-Hirschhorn (delezione 4p) Sindrome di Williams (delezione 7q11.23) Sindrome di Miller-Dieker (delezione 17p13.3) Test genetico: FISH o MLPA

9 Diagnosi possibile Array CGH o SNP array (fino a poche migliaia di paia di basi di DNA) Variabilità genomica Patogenicità non sicura

10 Troina network dal 2005 Bert de Vries Sam Knight Christa Lese Martin Frank Kooy Heather Mefford Evan Eichler Delezione 17q21.31 Delezione 15q13.3 Delezione 1q21.1 Duplicazione 7q11.23 Delezione 2q23.1 Delezione 16p12.1 Delezione 22q13.3

11 Disruption of the ASTN2/TRIM32 locus at 9q33.1 is a risk factor in males for autism spectrum disorders, ADHD and other neurodevelopmental phenotypes Hum. Mol. Genet. (2014) 23 (10): first published online December 30, Disordini del neurosviluppo vs controlli Fenotipi ASD ADHD OCD Ritardo di linguaggio Ansietà 46 del 12 dup Disordini del Neurosviluppo

12 Next Generation Sequencing Sequenziamento mirato di pannelli di geni (Targeted NGS testing o Panel NGS testing) Sequenziamento dell intero esoma (Whole exome sequencing; WES) Sequenziamento dell intero genoma (Whole genome sequencing; WGS)

13 Sequenziamento mirato di pannelli di geni (Targeted NGS testing o Panel NGS testing) Pannelli pre-sequenziamento (Targeted Resequencing): che permettono l arricchimento di specifiche regioni genomiche prima del sequenziamento, così da analizzare un certo numero di pazienti in contemporanea e abbattere i costi. Pannelli in silico (Targeted Data Analysis): in questo caso si effettua un WES e successivamente si vanno ad analizzare solo quei geni già noti per essere associati alla patologia in esame. In questo caso è possibile analizzare solo pochi campioni per corsa, a seconda del tipo di strumentazione di cui si dispone, e i costi sono maggiori.

14 Raccomandazioni operative per i test NGS La caratterizzazione fenotipica è fondamentale per la scelta della tecnica di diagnosi molecolare (sequenziamento Sanger, Targeted resequencing, WES) e per la successiva analisi delle varianti identificate. Nel caso di fenotipi ben definiti, caratterizzati da bassa eterogeneità genetica, può essere opportuno valutare l analisi con metodiche molecolari convenzionali (ad esempio: sequenziamento Sanger, PCR mirata per mutazioni dinamiche). E auspicabile che l analisi molecolare di geni molto grandi (numerosi esoni) sia trasferita su piattaforme NGS

15 Raccomandazioni operative per i test NGS (2) Nel caso di condizioni con elevata eterogeneità genetica nelle quali mutazioni in un numero ridotto di geni sono responsabili della maggioranza dei casi (> del 50%) è auspicabile l uso di un targeted resequencing. Tale strategia è indicata anche in caso di sospetto mosaicismo. Nel caso di condizioni con eterogeneità genetica particolarmente marcata dove è coinvolto un numero sempre crescente di geni, ma ognuno è responsabile di una bassa percentuale di casi (per esempio paraparesi spastiche ereditarie, retiniti pigmentose, etc.) è indicata l esecuzione di un WES con analisi limitata al pannello di geni responsabili (pannello in silico ).

16 Raccomandazioni operative per i test NGS (3) Infine in tutti i casi in cui non può essere formulata un ipotesi diagnostica su base clinica è preferibile l analisi dell intero esoma

17 Peculiarità della consulenza genetica nei test NGS Consulenza pre-test Valutazione del fenotipo clinico Sequenziamento tradizionale di geni target o altro test genetico convenzionale, in caso di presentazione fenotipica ad alta specificità Analisi NGS di un pannello genico, in caso di condizioni con nota eterogeneità genetica, di condizioni nosologicamente diverse ma con significativa sovrapposizione di segni e sintomi, o in caso di sospetto mosaicismo. In particolare, l analisi di pannelli trova indicazione per condizioni in cui mutazioni di geni già noti consentano di raggiungere la diagnosi genetica in più del 50% dei casi Analisi WES (o WGS), in assenza di un ipotesi di causa clinicamente orientata. In questo ambito è opportuno catalogare tentativamente il fenotipo clinico nell ambito di una patologia mono/oligofattoriale o multifattoriale, a beneficio della successiva modalità di analisi bioinformatica dei dati genomici.

18 Peculiarità della consulenza genetica Consulenza pre-test Anamnesi familiare nei test NGS Malattie mendeliane classiche Sindromi con anomalie congenite multiple/disabilità intellettiva Deficit cognitivo e disturbi nello spettro autistico Patologie tumorali Cardiomiopatie Malattie neurodegenerative

19 Peculiarità della consulenza genetica Consulenza pre-test Consenso informato nei test NGS Variante di sequenza in geni verosimilmente correlati al quesito clinico varianti note a carico di geni-malattia noti varianti non descritte a carico di geni-malattia noti varianti potenzialmente patogenetiche a carico di geni non descritti come associati al fenotipo ma a funzione nota varianti di significato incerto (VUS). Variante in geni non correlati al quesito clinico (risultati incidentali). varianti in geni noti, in base alle quali può essere predisposta una sorveglianza medica efficace ( clinically actionable mutations ) stato di portatore eterozigote per una condizione recessiva varianti geniche note per essere rilevanti nella farmacogenetica varianti in geni di predisposizione (es. per malattie neurodegenerative) per le quali non è ancora disponibile una strategia preventiva di efficacia varianti geniche di significato clinico sconosciuto (VUS).

20 Peculiarità della consulenza genetica nei test NGS Consulenza genetica post-test accompagna la consegna del referto e l interpretazione dei risultati introduce la gestione clinica del paziente, pianificando il contatto con un gruppo interdisciplinare di esperti programma il ricontatto con la famiglia, per il quale va chiesto il consenso, riguardo sia all aggiornamento relativo alle categorie di varianti geniche non ancora trasferibili nella pratica clinica, sia all estensione delle correlazioni genotipo-fenotipo di varianti patogenetiche.

21 Consulenza genetica Preconcezionale Fattori di rischio genetico Diagnostica invasiva Prenatale Individuazione dell eventuale test genetico appropriato Consulenza post-test

22 Primo Step Secondo Step Terzo Step Genetista Clinico Consultando Famiglia Sanità pubblica

23 Appropriatezza del test genetico richiesto Utilizzo del risparmio per investimenti mirati e appropriati Consulenza Genetica Riduzione dei test genetici inappropriati Risparmio per la sanità pubblica

24 Quanto costa la consulenza genetica? da 20 a 30 euro

25 Se questo è quello che può fare il genetista clinico per la sanità pubblica Cosa può fare la sanità pubblica per fare lavorare meglio il genetista clinico?

26 Lista dei desiderata per la sanità pubblica Impedire richieste di test genetici da parte di professionisti sanitari incompetenti in materia Costituire una rete regionale di genetisti clinici alla quale affidare la consulenza genetica e la richiesta di test genetici per tutta la popolazione regionale

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE

DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE DIPARTIMENTO DI SCIENZE E TECNOLOGIE BIOMEDICHE Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica DSTB - Università degli Studi di Udine P.le Kolbe,1-33100 Udine - ITALIA

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI SICURO: Eseguito su un semplice prelievo di sangue materno COMPLETO: Trisomia 21 (Sindrome di

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento

Conoscenze, capacità, e comportamenti che ci si ripromette di trasmettere o sviluppare, con riferimento agli obiettivi di apprendimento Docente: HAYEK JOUSSEF Qualifica: DIRIGENTE MEDICO AOUS Insegnamento: NEUROPSICHIATRIA INFANTILE SSD: MED/39 Anno III o Descrivere l approccio clinico-strumentale al bambino con deficit intellettivo isolato

Dettagli

Genetica, malattie rare e contesto familiare

Genetica, malattie rare e contesto familiare XXV Anniversario IRCCS E. Medea La salute del bambino tra genetica e neuroscienze Bosisio Parini, 11 dicembre 2010 Genetica, malattie rare e contesto familiare La genetica negli ultimi 25 anni Sequenziamento

Dettagli

LA DIAGNOSI PRENATALE : PRESENTE E FUTURO

LA DIAGNOSI PRENATALE : PRESENTE E FUTURO LA DIAGNOSI PRENATALE : PRESENTE E FUTURO LA CONSULENZA GENETICA PRENATALE Fare Dr. Renato clic per Scarinci modificare lo stile del sottotitolo dello schema GENETICA CLINICA Costituisce la parte applicativa

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIFETTI CONGENITI Le anomalie congenite sono condizioni che si instaurano tra il momento del concepimento e la nascita. LA DIAGNOSI PRENATALE insieme di tecniche

Dettagli

Aggiornamenti in ambito genetico

Aggiornamenti in ambito genetico 10 Congresso Nazionale sulla Sindrome di Cornelia de Lange 1-4 novembre 2012 - Gabicce Aggiornamenti in ambito genetico Cristina Gervasini Genetica Medica Dip. Scienze della Salute Università degli Studi

Dettagli

COSA SONO? PERCHE? A CHI? QUALE?. E UNA VOLTA CHE ARRIVA IL RISULTATO?

COSA SONO? PERCHE? A CHI? QUALE?. E UNA VOLTA CHE ARRIVA IL RISULTATO? OS SONO? PERHE? HI? QULE?. E UN VOL HE RRIV IL RISULO??? Di cosa stiamo parlando.. Per test genetici si intendono comunemente le analisi di specifici geni, del loro prodotto o della loro funzione, nonché

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

La consulenza alla paziente che richiede l analisi del DNA fetale

La consulenza alla paziente che richiede l analisi del DNA fetale La consulenza alla paziente che richiede l analisi del DNA fetale Bertinoro, 19 Ottobre 2013 Eva Pompilii eva_pompilii@yahoo.it Limiti attuali del Non invasive Prenatal Testing/ Non Invasive Prenatal

Dettagli

Diagnosi delle aneuploidie

Diagnosi delle aneuploidie Diagnosi delle aneuploidie DIAGNOSI PRENATALE NON INVASIVA: UNA RIVOLUZIONE La diagnosi prenatale delle malattie monogeniche e delle aneuploidie Bologna, è attualmente 6 Giugno eseguita2014 nel I-II trimestre

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

Prof. Pier Paolo Piccaluga Università di Bologna

Prof. Pier Paolo Piccaluga Università di Bologna Prof. Pier Paolo Piccaluga Università di Bologna DNA: la molecola della vita L'acido desossiribonucleico (DNA) è un acido nucleico, presente nel nucleo delle cellule, che contiene le informazioni genetiche

Dettagli

La Genomica in Sanità Pubblica: attualità e futuro. Test Genetici «fai da te»: tra appropriatezza e rischi

La Genomica in Sanità Pubblica: attualità e futuro. Test Genetici «fai da te»: tra appropriatezza e rischi La Genomica in Sanità Pubblica: attualità e futuro Test Genetici «fai da te»: tra appropriatezza e rischi Catania, 18 Dicembre 2014 Francesca Torricelli SOD Diagnostica Genetica AOU Careggi Firenze TEST

Dettagli

Lo studio prenatale dei cromosomi fetali:

Lo studio prenatale dei cromosomi fetali: Laboratorio di Genetica Medica Lo studio prenatale dei cromosomi fetali: esame citogenetico standard vs array Bologna, 06 Giugno 2014 Giorgio Lucci La citogenetica classica Inizio della citogenetica umana

Dettagli

L informazione ai pazienti

L informazione ai pazienti PREVENZIONE DELLE MALATTIE RARE: LO STATO DELL ARTE L informazione ai pazienti La Consulenza Genetica come strumento d informazione sulle malattie rare Dott. Danilo Deiana Servizio di Screening e Consulenza

Dettagli

Screening dei soggetti a rischio e diagnostica molecolare

Screening dei soggetti a rischio e diagnostica molecolare Screening dei soggetti a rischio e diagnostica molecolare Daniela Furlan U.O. Anatomia Patologica Varese, 3 luglio 2012 Il carcinoma pancreatico Patogenesi Suscettibilità genetica Implicazioni diagnostiche

Dettagli

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Introduzione Cromosoma Cellula Nucleo Ormai a tutti è noto il ruolo del

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica SEZIONE DI CITOGENETICA E GENETICA MOLECOLARE DIAGNOSI PRENATALE DIAGNOSI MOLECOLARE PRE E POSTNATALE DI MALATTIE GENETICHE DIAGNOSTICA GENETICA DELLA INFERTILITA

Dettagli

LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA

LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA LA RETE DI GENETICA MEDICA IN EMILIA-ROMAGNA A cura del Nucleo di coordinamento per la rete regionale dei servizi di genetica medica dell Emilia-Romagna Con il contributo di Laura Biagetti (Azienda Ospedaliera-Universitaria

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

INFORMAZIONI SUL TEST

INFORMAZIONI SUL TEST QUALITY OF SCIENCE INFORMAZIONI SULLA SOCIETÀ INFORMAZIONI SUL TEST Sequenom Laboratories, una consociata interamente controllata di Sequenom, Inc., è un laboratorio di diagnostica molecolare riconosciuto

Dettagli

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla

Dettagli

DAI TEST GENETICI AL RISCHIO DI MALATTIA

DAI TEST GENETICI AL RISCHIO DI MALATTIA DAI TEST GENETICI AL RISCHIO DI MALATTIA Conosciamo il nostro Genoma Varese, 20 aprile 2013 Elisabetta Lenzini LE TAPPE DELLA 1953 Watson and Crick Struttura del DNA 1956 Tijo e Levan Cariotipo 46 cr 1959

Dettagli

Emiatrofia cerebrale e microftalmia

Emiatrofia cerebrale e microftalmia Emiatrofia cerebrale e microftalmia TROMBOSI TROMBOSI Prevenzione dell handicap congenito Nel 1 gruppo di casi genetici con rischio di ricorrenza, la prevenzione può attuarsi attraverso una corretta diagnosi

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece

Clinica e terapia. malattie. retiniche. delle. Direttore Scientifico Alfredo Pece Clinica e terapia delle malattie retiniche Direttore Scientifico Alfredo Pece Genetica LA GENETICA Cosa sta succedendo nell ambito della diagnostica e della terapia farmacologica oggi? Scoperta di geni

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre più di non conoscere, nell avvedersi di saper sempre meno,

Dettagli

I NOSTRI TEST GENETICI CATALOGO 2017

I NOSTRI TEST GENETICI CATALOGO 2017 I NOSTRI TEST GENETICI CATALOGO 2017 I NOSTRI TEST GENETICI CARIOTIPO MOLECOLARE L analisi array-cgh identifica alterazioni del DNA (CNV - variazione del numero di copie) causative di patologie come ad

Dettagli

Ho pensato di raccogliere in modo organico e chiaro tutte le informazioni pratiche relative alla gravidanza. Mi sono basata sulle emozioni, i dubbi e

Ho pensato di raccogliere in modo organico e chiaro tutte le informazioni pratiche relative alla gravidanza. Mi sono basata sulle emozioni, i dubbi e Ho pensato di raccogliere in modo organico e chiaro tutte le informazioni pratiche relative alla gravidanza. Mi sono basata sulle emozioni, i dubbi e gli interrogativi che le future mamme ci hanno espresso

Dettagli

www.analisicimatti.it

www.analisicimatti.it Il Laboratorio Cimatti da sempre attento alla innovazione tecnologica e allo sviluppo di Eccellenze nella diagnostica prenatale è partner di Bioscience Genomics, uno spin off accademico partecipato dall

Dettagli

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations

Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Exome sequencing in sporadic autism spectrum disorders identifies severe de novo mutations Brian J O Roak1, Pelagia Deriziotis2, Choli Lee1, Laura Vives1, Jerrod J Schwartz1, Santhosh Girirajan1, Emre

Dettagli

Lezione 2 Capitolo 18 del testo

Lezione 2 Capitolo 18 del testo Test genetico Lezione 2 Capitolo 18 del testo Cos e un test genetico/diagnostico M Il test genetico di per se non e solo utilizzato in diagnostica: sono un insieme di tecniche che vengono utilizzate per

Dettagli

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni L array-cgh: -riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni -ha un potere si risoluzione 100 volte superiore al cariotipo (100 Kb versus 10 Mb) Microarray-based

Dettagli

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

NPTT- NON-INVASIVE PRENATAL TESTING

NPTT- NON-INVASIVE PRENATAL TESTING Dr.ssa Chiara Boschetto NPTT- NON-INVASIVE PRENATAL TESTING Il TEST PRENATALE NON INVASIVO è un test molecolare nato con l obiettivo di determinare l assetto cromosomico del feto da materiale fetale presente

Dettagli

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Ad integrazione delle lezioni e del testo di studio Genetica Umana e Medica Neri- Genuardi 3a edizione 2014 Masson (www.mediquiz.it) GENETICA MEDICA

Dettagli

Il G-test aumenta il numero di malattie cromosomiche identificate con un semplice prelievo di sangue materno

Il G-test aumenta il numero di malattie cromosomiche identificate con un semplice prelievo di sangue materno Il G-test aumenta il numero di malattie cromosomiche identificate con un semplice prelievo di sangue materno Roma, 28 gennaio 2016 Cresce in fretta il G-test, il test di screening non invasivo, effettuato

Dettagli

Risposte chiare a domande che contano

Risposte chiare a domande che contano Risposte chiare a domande che contano HARMONY PRENATAL TEST (Test prenatale Harmony) è un nuovo esame del sangue basato sul DNA per valutare il rischio di sindrome di Down. Harmony è più preciso dei test

Dettagli

GENETICA CITOGENETICA MEDICA

GENETICA CITOGENETICA MEDICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE GENETICA A.A.2015/2016 Prof Alberto E.Turco Me 21.10.2015 Lezioni 15 e 16 CITOGENETICA MEDICA ANOMALIE CROMOSOMICHE (Chromosome Disorders) - Abortività

Dettagli

Il Counselling. Padova, 21 marzo 2016. Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari

Il Counselling. Padova, 21 marzo 2016. Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari Il Counselling Padova, 21 marzo 2016 Dr.ssa Stefania ZOVATO Istituto Oncologico Veneto (IOV) IRCCS Padova SSD Unità per i Tumori Ereditari Punti chiave del counselling Significato Scopo e limiti A chi

Dettagli

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE?

SCREENING NEONATALE RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? SCREENING NEONATALE GENETICO RISPARMIO PER IL SERVIZIO SANITARIO NAZIONALE? Pietro Chiurazzi Istituto di Genetica Medica Facoltà di Medicina e Chirurgia Università Cattolica Associazione Culturale Giuseppe

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

Pagina 1 di 9. Il test PrenatalSAFE 3 valuta le aneuploidie dei cromosomi 21, 18, 13, e comprende la determinazione del sesso fetale (opzionale).

Pagina 1 di 9. Il test PrenatalSAFE 3 valuta le aneuploidie dei cromosomi 21, 18, 13, e comprende la determinazione del sesso fetale (opzionale). INFORMATIVA E CONSENSO INFORMATO AL TEST DI SCREENING PRENATALE NON INVASIVO DELLE ANEUPLOIDIE CROMOSOMICHE FETALI MEDIANTE ANALISI DEL DNA FETALE DAL SANGUE MATERNO Finalità del test PrenatalSAFE PrenatalSAFE

Dettagli

Soroptimist International d Italia Club di Varese. Conosciamo il nostro Genoma Varese, 20 aprile 2013. Eugenia Trotti

Soroptimist International d Italia Club di Varese. Conosciamo il nostro Genoma Varese, 20 aprile 2013. Eugenia Trotti Soroptimist International d Italia Club di Varese Conosciamo il nostro Genoma Varese, 20 aprile 2013 Implicazioni Psicologiche delle indagini genetiche Eugenia Trotti Università degli Studi dell Insubria

Dettagli

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE

Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE Bari, 27 Febbraio 2010 Nicoletta Resta Dipartimento di Biomedicina dell Età Evolutiva UOC Lab. Genetica Medica INDAGINI GENETICHE: QUANDO E PERCHE EREDITA MENDELIANA CLASSICA ~ 600 E C M 10.000 Enzimi

Dettagli

PraenaTest. Esame non invasivo delle trisomie nel feto. Qualità dall Europa ORA NUOVO. Brochure informativa per gestanti

PraenaTest. Esame non invasivo delle trisomie nel feto. Qualità dall Europa ORA NUOVO. Brochure informativa per gestanti ORA NUOVO PraenaTest express Esito in 1 settimana PraenaTest Qualità dall Europa Esame non invasivo delle trisomie nel feto Brochure informativa per gestanti Care gestanti, Tutti i futuri genitori si chiedono

Dettagli

LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013

LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 LINEE DI RICERCA SOSTENUTE DAL 5xMILLE 2013 I Ricercatori del Centro di Genomica e Bioinformatica Traslazionale stanno lavorando a linee di ricerca legate a 1. Sclerosi Multipla 2. Tumore della Prostata

Dettagli

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA

POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA POLICLINICO UNIVERSITARIO A GESTIONE DIRETTA Istituto di Genetica UNIVERSITA DEGLI STUDI DI UDINE Address: Istituto di Genetica - Facoltà di Medicina e Chirurgia PUGD - Università degli Studi di Udine

Dettagli

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie Nullisomia: 2n-2 (morte preimpianto) Monosomia: : 2n-1 (generalmente morte embrionale) Trisomia: :

Dettagli

GENETICA E LA SCIENZA CHE STUDIA:

GENETICA E LA SCIENZA CHE STUDIA: GENETICA E LA SCIENZA CHE STUDIA: La variabilità biologica degli organismi viventi La trasmissione dei caratteri da un organismo ad un altro o da una cellula ad un altra Il ruolo del genoma (patrimonio

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

La prevenzione: un piano regionale per la Puglia. Perché?

La prevenzione: un piano regionale per la Puglia. Perché? La prevenzione: un piano regionale per la Puglia. Perché? Rita Fischetto Referente Genetica Clinica U.O.C. Malattie Metaboliche Diabetologia A.O.U. Policlinico-Giovanni XXIII Bari -CRESCITA CONOSCENZE

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA 2015/16. Alberto Turco. Lezioni 43 e 44 Gio 26.11.15 CONSULENZA GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA 2015/16. Alberto Turco. Lezioni 43 e 44 Gio 26.11.15 CONSULENZA GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA 2015/16 Alberto Turco Lezioni 43 e 44 Gio 26.11.15 CONSULENZA GENETICA Definizione La consulenza genetica è un servizio con il quale i pazienti o i

Dettagli

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott.

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott. CONSENSO INFORMATO PER DIAGNOSI GENETICA PRE-IMPIANTO (PGD)* PER MALATTIE GENETICHE EREDITARIE O ALTERAZIONI CROMOSOMICHE NUMERICHE E/O STRUTTURALI SBILANCIATE. *(Preimplantation Genetic Diagnosis) Ai

Dettagli

Unità Operativa di GENETICA MEDICA

Unità Operativa di GENETICA MEDICA Unità Operativa di GENETICA MEDICA Direttore: Prof. Mario Savi LABORATORIO DI GENETICA MOLECOLARE Responsabile Prof. Tauro Neri. Servizi forniti: Definizione genotipica e diagnosi molecolare POSTNATALE

Dettagli

L analisi del DNA fetale libero da sangue materno

L analisi del DNA fetale libero da sangue materno L analisi del DNA fetale libero da sangue materno Cos è PrenatalSafe Esame prenatale non invasivo (NIPT) che, analizzando il DNA fetale libero circolante isolato da un campione di sangue materno, valuta

Dettagli

Il test genetico BRCA1/BRCA2

Il test genetico BRCA1/BRCA2 L identificazione Il test genetico BRCA1/BRCA2 M.G.Tibiletti UO Anatomia Patologica Ospedale di Circolo-Università dell Insubria Varese IL CARCINOMA MAMMARIO FORME SPORADICHE FORME EREDITARIE FORME FAMIGLIARI

Dettagli

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica

EREDITARIETÀ E TUMORE MAMMARIO. U.O. Genetica Medica EREDITARIETÀ E TUMORE MAMMARIO Dott.ssa M.Neri U.O. Genetica Medica Responsabile Consulenza Oncogenetica Prof.ssa A. Ferlini Direttore U.O. Genetica Medica I TUMORI AL SENO EREDITARI : L IMPORTANZA DELLA

Dettagli

Quotidiano. www.ecostampa.it

Quotidiano. www.ecostampa.it Quotidiano 097156 www.ecostampa.it Quotidiano 097156 www.ecostampa.it Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013 Dir. Resp.: Ezio Mauro da pag. 1 Lettori: 2.835.000 Diffusione: 431.913 12-NOV-2013

Dettagli

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale

HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale HI-TECH IN SANITA'. MINI-INVASIVITA' 2.0: nuove tecnologie al servizio dell'appropriatezza e della bioetica professionale L evoluzione della professione tecnica tra robotica, automazione e nuove tecnologie

Dettagli

La Genomica in Sanità Pubblica I Convegno Siciliano

La Genomica in Sanità Pubblica I Convegno Siciliano La Genomica in Sanità Pubblica I Convegno Siciliano Catania, 18 Dicembre 2014 Nuove tecnologiche nella genomica in sanità pubblica Marco Fichera Università di Catania A.O.U. Policlinico V.E. Catania 1

Dettagli

MALATTIE GENETICHE causate da un alterazione del DNA

MALATTIE GENETICHE causate da un alterazione del DNA MALATTIE GENETICHE causate da un alterazione del DNA CLASSIFICAZIONE DELLE MALATTIE GENETICHE - Malattie Monogeniche (Mendeliane) A.D., A.R., X-L. - Malattie Cromosomiche (Anomalie di numero e di struttura)

Dettagli

Prevenzione. Diagnosi prenatale. La consapevolezza di un accoglienza d amore

Prevenzione. Diagnosi prenatale. La consapevolezza di un accoglienza d amore Prevenzione Diagnosi prenatale La consapevolezza di un accoglienza d amore Bios International Holding La capillare rete di strutture di Bios International opera da anni nel campo della diagnostica con

Dettagli

Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare

Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare Genetica dell autismo: il percorso diagnostico e le nuove tecnologie di indagine molecolare Dr.Rosario Casalone SSD Genetica Azienda Ospedaliera Universitaria Ospedale di Circolo e Fondazione Macchi Varese

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards)

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Markers di anomalie cromosomiche - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Sindrome di Turner - Sindrome di Williams - Sindrome di Angelman

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

TEST PRENATALE. Screening del DNA non invasivo per le anomalie cromosomiche fetali

TEST PRENATALE. Screening del DNA non invasivo per le anomalie cromosomiche fetali TEST PRENATALE Screening del DNA non invasivo per le anomalie cromosomiche fetali Che cos è PANORAMA PANORAMA è un test di screening prenatale non invasivo (non-invasive prenatal test, NIPT) che si esegue

Dettagli

DIAGNOSI PRENATALE DI MALATTIE RARE: IL FETO COME PAZIENTE

DIAGNOSI PRENATALE DI MALATTIE RARE: IL FETO COME PAZIENTE PROF. GIOVANNI NERI Istituto di Genetica Medica, Università Cattolica del S. Cuore, Roma DIAGNOSI PRENATALE DI MALATTIE RARE: IL FETO COME PAZIENTE La diagnosi prenatale di malattie genetiche rare è pratica

Dettagli

PROTOCOLLI OPERATIVI PER L ESECUZIONE DI TEST GENETICI NELL INFERTILITA DI COPPIA E IN PREPARAZIONE A PROCEDURE DI PROCREAZIONE MEDICALMENTE ASSISTITA

PROTOCOLLI OPERATIVI PER L ESECUZIONE DI TEST GENETICI NELL INFERTILITA DI COPPIA E IN PREPARAZIONE A PROCEDURE DI PROCREAZIONE MEDICALMENTE ASSISTITA Allegato A PROTOCOLLI OPERATIVI PER L ESECUZIONE DI TEST GENETICI NELL INFERTILITA DI COPPIA E IN PREPARAZIONE A PROCEDURE DI PROCREAZIONE MEDICALMENTE ASSISTITA Finalità del documento Il presente documento

Dettagli

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI Ogni individuo possiede un proprio patrimonio genetico che lo rende unico e diverso da tutti gli altri. Il patrimonio genetico è costituito da

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

Che cos è la fibrosi cistica

Che cos è la fibrosi cistica La scoperta del gene responsabile della fibrosi cistica ha permesso la messa a punto di un test genetico per identificare il portatore sano del gene della malattia. Si è aperto quindi un importante dibattito

Dettagli

GENI E TEST GENETICI: DAL LABORATORIO ALLA PRATICA CLINICA

GENI E TEST GENETICI: DAL LABORATORIO ALLA PRATICA CLINICA PROGRAMMA CORSO ECM 2015 SCUOLA MEDICA OSPEDALIERA OSPEDALE S.SPIRITO IN SAXIA IN ROMA (richiesto il PATROCINIO SIGU) Responsabili scientifici: Guglielmo Sabbadini, Mariano S. Pergola Comitato Scientifico:

Dettagli

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche La patogenesi di aborti dovuti ad anomalie cromosomiche è dovuta a: A) Ipoplasia placentare; B) Malformazioni

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

Documento di indirizzo sull impiego di indagini prenatali non invasive

Documento di indirizzo sull impiego di indagini prenatali non invasive Documento di indirizzo sull impiego di indagini prenatali non invasive Premessa La diagnosi prenatale delle malattie monogeniche e delle aneuploidie è attualmente eseguita nel I-II trimestre di gravidanza

Dettagli

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali Milano Marittima 05/06/2010 Dr. Francesco Pigliapoco Lab. Citogenetica A.O.U.-Salesi- Ancona Le sindromi DiGeorge

Dettagli

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di

Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di GENETICA MEDICA Docenti: Prof. Emilio Donti Sezione di Genetica Medica e Neuropsichiatria Infantile Dip. Scienze Chirurgiche e Biomediche Università degli Studi di Perugia Centro Riferimento Regionale

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

La natura dell informazione genetica L informazione genetica è diversa o uguale alle altre informazioni mediche?

La natura dell informazione genetica L informazione genetica è diversa o uguale alle altre informazioni mediche? CONSULENZA GENETICA Diagnosticare, confermare o escludere la presenza di una malattia genetica. Identificare le possibili opzioni di condotta medica. Calcolare e fornire una stima del rischio genetico.

Dettagli

Modificazione del 1 gennaio 2016

Modificazione del 1 gennaio 2016 Ordinanza del DFI del 29 settembre 1995 sulle prestazioni dell assicurazione obbligatoria delle cure medico-sanitarie (Ordinanza sulle prestazioni, OPre, allegato 3) 832.112.31 Modificazione del 1 gennaio

Dettagli

COUNSELING GENETICO NELLE FORME DI DEMENZA FAMILIARE: IL PROGETTO DIAfN

COUNSELING GENETICO NELLE FORME DI DEMENZA FAMILIARE: IL PROGETTO DIAfN AZIENDA OSPEDALIERA DI PERUGIA CENTRO DI RIFERIMENTO REGIONALE DI GENETICA MEDICA Responsabile: Dr.ssa Gabriela Stangoni COUNSELING GENETICO NELLE FORME DI DEMENZA FAMILIARE: IL PROGETTO DIAfN Dr. Paolo

Dettagli

INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI

INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI CONSULENZA GENETICA La consulenza genetica è un processo medico-clinico che ha lo scopo di definire il percorso diagnostico in caso di sospetto di malattia

Dettagli

Dr. med. Lucio Bronz FMH Ostetricia e medicina feto-materna Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI

Dr. med. Lucio Bronz FMH Ostetricia e medicina feto-materna Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Dr. med. Lucio Bronz FMH Ostetricia e medicina feto-materna Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Sommario Introduzione Informazioni minime sulla genetica e sulla possibilità

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

Tranquility. Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie

Tranquility. Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie Tranquility Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie Test del DNA fetale sicuro e altamente sensibile Eseguito sul sangue materno tramite

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLERE AA 2014/15. Prof Alberto Turco. Lezioni 47 e 48. Merc 27.11.2013 CONSULENZA GENETICA

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLERE AA 2014/15. Prof Alberto Turco. Lezioni 47 e 48. Merc 27.11.2013 CONSULENZA GENETICA CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLERE AA 2014/15 Prof Alberto Turco Lezioni 47 e 48 Merc 27.11.2013 CONSULENZA GENETICA (R.Lewis, 2015) .lo richiederei anch io subito un appuntamento.o

Dettagli

IL PUNTO DI PARTENZA

IL PUNTO DI PARTENZA IL PUNTO DI PARTENZA Convocare o ricevere una convocazione durante l attesa di un esito di diagnosi prenatale è sempre difficile, fonte di angoscia o perlomeno di preoccupazione. Obiettivo delle donne:

Dettagli