LE MUTAZIONI Modificazioni ereditarie del materiale genetico

Save this PDF as:
 WORD  PNG  TXT  JPG

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "LE MUTAZIONI Modificazioni ereditarie del materiale genetico"

Transcript

1 LE MUTAZIONI Modificazioni ereditarie del materiale genetico

2 I diversi tipi di mutazioni Mutazioni geniche (o puntiformi) Mutazioni cromosomiche Mutazioni nel numero dei cromosomi Mutazioni nella struttura

3 Mutazione Geniche o Puntiformi Mutazione silente o stesso-senso: quando a causa della degenrazione del codice, la mutazione sostituisce una tripletta che codifica er un amminoacido con una tripletta diversa che codifica per lo stesso amminoacido. Mutazione mis-senso: a causa della degenazione del codice, la mutazione sostituisce una tripletta che codifica per un amminoacido con una tripletta diversa che pero codifica per un diverso amminoacido. Mutazione non-senso: quando una tripletta per un dato aminoacido viene modificata in una tripletta corrispondente ad un codone di terminazione della traduzione (si perde uno o piu amminoacidi).

4 Mutazioni Geniche Mutazione genica: evento per cui un gene si trasforma da una forma allelica ad un altra e il nuovo allele è ereditato secondo le leggi di Mendel. Retromutazione: mutazione da un allele anormale ad un allele standard. Mutazione morfologica: mutazione che si esprime in un alterazione della forma dell organismo. Mutazioni letali, subletali, detrimentali: mutazioni che determinano la morte, la bassissima sopravvivenza o il danneggiamento dell organismo. Mutazioni condizionali: mutazioni il cui fenotipo si manifesta solo in particolari condizioni ambientali. Mutazioni biochimiche: mutazioni che determinano la perdita o il cambiamento di un passaggio biochimico. Mutazioni nutrizionali: mutazione per cui microrganismi passano da un genotipo standard con cui è possibile la crescita con terreno minimo (prototrofi) a un nuovo genotipo in cui è richiesta la somministrazione supplementare di specifiche sostanze (auxotrofi). Mutazioni per resistenza: mutazioni che determinano la capacità di resistere a sostanze tossiche o a organismi patogeni cui invece il genotipo standard è sensibile.

5 MUTAZIONI Cambiamento che altera la costituzione fisica o chimica del DNA e che porta ad una alterazione della funzione o della produzione della proteina. Le mutazioni sono la più importante fonte di variabilità genetica nelle specie. 1) Mutazioni cromosomica: un cambiamento nell organizzazione di un cromosoma o più cromosomi 2) Mutazioni geniche: un cambiamento che avviene a livello del gene

6 Se una cellula mutata dà origine solo a cellule somatiche verrà prodotta un'area o un settore mutato, ma le caratteristiche del mutante non verranno trasmesse alle generazioni successive (mutazione somatica). Mutazioni nella linea germinale di organismi che si riproducono sessualmente possono essere trasmesse attraverso i gameti alla generazione successiva (mutazione germinale).

7 Progenie normale Mutazioni somatiche e germinali Tessuto somatico Tessuto germinale Progenie normale Mutazione somatica Clone cellulare mutante Popolazioni finali Mutazione germinale Progenie mutante Cloni cellulari mutanti Eventi mutazionali Tempo Popolazioni iniziali Mutazione tardiva Mutazione precoce

8 MUTAZIONE GENICA: BASI MOLECOLARI Una mutazione può essere trasmessa alle cellule figlie e generazioni seguenti dando origine a cellule mutate o ad individui mutati. Le mutazioni geniche (a livello della sequenza del gene) possono avvenire: - spontaneamente - indotte (trattamento con mutageni) Mutageni= agente fisico/chimico che aumenta in modo significativo la frequenza degli eventi mutazionali al di sopra del tasso spontaneo di mutazione.

9 TASSO DI MUTAZIONE E FREQUENZA DI MUTAZIONE Il tasso di mutazione misura la frequenza con cui una mutazione si origina ex novo in un unità di tempo biologico (di solito una generazione) La frequenza di mutazione misura la frequenza della mutazione in una popolazione nel momento dell osservazione

10 Negli oganismi viventi si sono evoluti alcuni sistemi enzimatici in grado di riparare i danni subiti dal DNA. Il tasso di mutazione e cosi tenuto sottocontrollo. Diversi meccanismi: - Prevenzione degli errori (ad es. enzima superodismutasi) - Reversione del danno (DNA fotoliasi che ripara I dimeri di timina indotti dagli UV) - Riparazione per escissione delle basi danneggiate (complesso di enzimi che tagliano la zona del DNA danneggiata, risintetizzano le sequenze le saldano per mezzo di DNA ligasi) - Riparazione post-replicativa (sistemi di riparazione che riconoscono gli errori una volta che la replicazione e completata).

11 Le mutazioni possono essere indotte attraverso l'uso di radiazioni e mutageni chimici Le radiazioni possono causare danni genetici rompendo i cromosomi, producendo composti chimici che alterano il DNA (come nel caso dei raggi X) o causando la formazione di legami inusuali fra le basi del DNA, quali i dimeri di timina (come nel caso dei raggi ultravioletti). La mancata riparazione dei danni genetici prodotti dalle radiazioni può indurre mutazioni o determinare la morte della cellula.

12 TIPI DI MUTAZIONE GENICA Sostituzione di una coppia di basi: -Mutazioni per transizione: una coppia di basi purina-pirimidina con un'altra coppia purina-pirimidina: AT a GC, GC a AT, TA a CG e CG a TA -Mutazioni per transversione: una coppia di basi purina-pirimidina con una coppia pirimidina-purina: AT a TA, GC a CG, AT a CG e GC a TA.

13 Le mutazioni che alterano una singola coppia di basi del DNA vengono chiamate mutazioni puntiformi. Le mutazioni possono essere anche definite in base agli effetti sulla sequenza aminoacidica della proteina: 1)missenso: sostituzione di un aa con un altro 2)nonsenso: sostituzione di un aa con un codone di stop 3)neutra: sostituzione di un aa con un altro con proprietà chimiche simili (Es: lisina arginina) 4)silente: cambiamento nel codone che non comporta un cambiamento dell aminoacido (Es: AAA=Lys con AAG=Lys) 5)Mutazione frameshift (scivolamento di fase) è il risultato di una delezione o inserzione

14 Mutazioni geniche Le mutazioni geniche o puntiformi sono dovute in gran parte alla sostituzione di una singola base nucleotidica del DNA con un altra Altri tipi di mutazione si originano in seguito alla perdita (delezione) o alla inserzione di una base nel filamento del DNA Sostituzione Delezione Inserzione

15 Mutazioni di senso. Nella maggior parte dei casi la nuova tripletta codifica per un diverso aminoacido CCU Prolina GCU Alanina La proteina avrà quindi lo stesso numero di aminoacidi ma una sequenza che differisce per un aminoacido

16 Come si è già detto, la gravità degli effetti di una sostituzione dipenderà dalla somiglianza tra l aminoacido sostituito e il nuovo e dalla posizione della sostituzione La sequenza dell emoglobina dell uomo, del maiale, del cane o differisce per parecchi aminoacidi e pur tuttavia tutte queste svolgono la funzione in modo efficiente. Alcune regioni della proteina sono molto simili anche filogeneticamente lontane (ad esempio nell emogolobina la regione dice in gergo tecnico che questa è una regione ben conservata. del cavallo emoglobine tra specie dell eme) Si D altra parte una singola sostituzione (la valina al posto di glutammato un posizione 6) che si ha nell anemia falciforme porta alla completa non funzionalità e alla morte del soggetto

17 Mutazioni nonsenso. Se il nuovo codone che si forma dalla sostituzione codifica per il segnale di stop avremo una proteina più corta della precedente (dipende dal punto in cui è avvenuta la sostituzione) AAG Lisina UAG Codone di stop

18 Mutazioni silenti. Se in seguito alla sostituzione di una base si ottiene una tripletta che specifica per lo stesso aminoacido la proteina prodotta sarà la stessa Fino a quattro diverse triplette specificano lo stesso aminoacido (il codice genetico è degenerato) Le sostituzioni silenti riguardano la terza base del codone, quella che varia tra codoni diversi che specificano lo stesso aminoacido

19 Sostituzione di Basi

20

21 Inserzioni di Basi

22 Delezione o inserzione di una base (mutazioni per spostamento della griglia di lettura) Talvolta l errore consiste nell inserire una base in più nella sequenza del DNA. Altre volte durante la replicazione o durante la riparazione del DNA si ha la perdita di una base In entrambi i casi la lettura di tutta la sequenza che segue viene completamente alterata A (inserzione) A U G A G G A C U C C C G G A U U A Met Arg Thr Pro Gly Leu A U G A G G A A C U C C C G G A U U A Asp Ser Arg Iso

23 MUTAZIONI CROMOSOMICHE: caratteristiche generali Le mutazioni cromosomiche possono essere: Bilanciate: tutti i geni sono presenti nello stesso numero di copie (inversioni, traslocazioni, euploidie); Sbilanciate: alcuni geni sono presenti in un numero di copie diverso da tutti gli altri geni (duplicazioni, delezioni, aneuploidie). Stabili: hanno un elevata probabilità di essere ereditate così come sono; Instabili; hanno un elevata probabilità di originare ulteriori mutazioni.

24 ORIGINE DEI RIORDINAMENTI STRUTTURALI A B A B DELEZIONE TERMINALE (instabile) C ROTTURA C SI PERDE IL FRAMMENTO ACENTRICO A B C A B C APPAIAMENTO B A A C C B A B B C A C DELEZIONE INTERSTIZIALE (stabile) IRREGOLARE CROSSING OVER INEGUALE DUPLICAZIONE IN TANDEM (stabile)

25 Mutazioni nella struttura dei cromosomi Esistono 4 tipi principali di mutazione della struttura dei cromosomi delezione duplicazione inversione traslocazione

26

27 1) Delezione. Parte del cromosoma (e quindi delle basi del DNA) viene perduta. Tutti i geni contenuti nella parte interessata dalla delezione vanno perduti e quindi non possono esprimersi nel fenotipo a b c d e f g h i l m n o p q r s t u v z 2) a b c d e f g h i l m n o p q r s v z Duplicazione. Parte del cromosoma viene duplicata. I geni contenuti nella parte interessata sono duplicati. Perciò la cellula contiene tre o quattro copie di ciascun gene. In qualche caso ciò può danneggiare la cellula in quanto i sistemi di regolazione possono essere alterati 1) a b c d e f g h i l m n o p q r s t u v z 2) a b c d e f g e f g h i l m n o p q r s t u v z

28 Inversione. In seguito ad una rottura, una parte del cromosoma viene riunita in posizione invertita. A parte i geni che si possono trovare nel punto di rottura, non ci sono gravi conseguenze per la cellula. Tuttavia non può avvenire crossing over in questa regione in quanto essa non si appaia con quella del cromosoma omologo 1) a b c d e f g h i l m n o p q r s t u v z 2) a b c d e f g h i l m n o s t u v z 3) a b c d e f g h i l m n o r q p s t u v z

29 Tralocazione. In seguito ad una rottura, una parte del cromosoma (es n 6) si stacca e viene inserito in un cromosoma diverso (es n 12). Le traslocazione possono rendere complicato l appaiamento dei cromosomi durante la meiosi 1) a b c d e f g h i l m n o p q r s t u v z A B C D E F G H I L M N O P Q R S T U V Z 2) a b c d e f g h i l m n o p q r s A B C D E F G H I L M N O P Q R S T U V Z t u v z

30 Mutazioni nel numero dei cromosomi (Aneuploidia) Monosomie e trisomie. Accade talvolta che alla meiosi i due omologhi anziché separarsi, migrino entrambi nella stessa cellula figlia (non disgiunzione). In questo modo si creano due cellule figlie, una con un cromosoma in meno e una con un cromosoma in più Dopo la fecondazione un tipo di zigote avrà 1 cromosoma omologo, l altro 3 cromosomi omologhi Monosomia Trisomia

31 Le piante (ma non gli animali) sono in grado di sopravvivere ad un raddoppio completo di tutto il cariotipo (e quindi anche ad un raddoppio dei geni), una condizione nota come poliploidia Alcune varietà della stessa specie possono avere corredo cromosomico 2n, 3n, 4n (ad es o 120 cromosomi) Nelle piante la poliploidia è un importante fattore di speciazione in quanto individui con numero cromosomico differente non possono fare tra loro figli fertili

32 Origine di mutazioni numeriche:2 AUTOPOLIPLOIDIE A-IN MITOSI Il blocco di una mitosi di una cellula Se c è un diploide blocco da nella origine prima a cellule mitosi tetraploidi uno zigote, lo zigote Il e blocco l organismo di k mitosi che ne da deriva origine a cellule con 2 k+1 n cromosomi diventano tetraploidi 4 n cromosomi duplicati DUPLICAZIONE (interfase) 2 n cromosomi duplicati BLOCCO DELLA MITOSI 4 n cromatidi

33 Origine di mutazioni numeriche:2 AUTOPOLIPLOIDIE B- MEIOSI E FECONDAZIONE Blocco di una delle due divisioni meiotiche Fecondazione multipla ZIGOTE 3 n Gamete non ridotto

34 Origine di mutazioni numeriche: 3 ALLOPOLIPLOIDIE Fecondazione interspecifica, fra specie diverse ma compatibili, con sviluppo dell ibrido MEIOSI ABORTIVE, STERILITA MEIOCITA ALLOTETRAPLOIDE MEIOSI NORMALI Zigote anfidiploide ibrido, vitale ma sterile FECONDAZIONE fra gameti anfidiploidi GAMETE ANFIDIPLOIDE ZIGOTE ALLOTETRAPLOIDE INDIVIDUO ALLOTETRAPLOIDE FECONDO

35 Comportamento in meiosi delle mutazioni cromosomiche (I divisione meiotica): autopoliploidia Le cellule autopoliploidi in meiosi I realizzano modalità di appaiamento irregolari: si formano trivalenti, univalenti ecc. a fianco dei normali bivalenti; di conseguenza i cromosomi segregano irregolarmente e si formano sempre gameti con aneuploidie multiple: la conseguenza è la sterilità

36 Principali Specie Agrarie Poliploidi

37 Filogenesi dei frumenti

38 Esempi di Specie Poliploidi Frutti apireni prodotti da piante triploidi Segale Triticale Frumento duro 2n = 2x = 14 2n= 6x = 42 2n = 4x = 28 Triticale: ottenuta per raddoppiamento cromosomico dell ibrido intergenerico tra segale e frumento duro (esaploide) o tenero (ottoploide).

39 Origine Anfidiploide di alcune specie del genere Brassica

40 Mutazioni nel numero dei cromosomi sessuali La non-disgiunzione dei cromosomi sessuali umani provoca varie malattie da aneuploidia. Nonostante il cromosoma X sia tra i più grandi sembra che l aneuploidia degli eterocromosomi causi un minor perturbamento dell equilibrio genetico

41 Agenti intercalanti Cause della Mutazione Errori di replicazione Spontanee Cambiamenti spontanei delle basi (es: depurinazione etc.) Mutazioni Raggi X Radiazioni Indotte Raggi UV Analoghi delle basi Mutageni chimici Agenti mod. le basi

42 Possiamo incrementare la frequenza di mutazione? chimici i mutageni fisici by GP&NA genetici

43 Mutageni chimici e loro azione Nome comune azione, proprietà particolari A. AGENTI ALCHILANTI: donano gruppi alchilici ad altre molecole Gas di mostarda (iprite) transizioni EMS etilazione; transizioni G:C-A:T EES etilazione; bifunzionale lega i due filamenti del DNA provocando rotture ed aberrazioni. NTG deaminazione B. ANALOGHI DI BASE: incorporati durante la replicazione 5-BU analogo della timina; transizioni per tautomeria 5-BrDU analogo della adenina;transizioni per tautomeria 2-AP transizioni per tautomeria C. COLORANTI ACRIDINICI: intercalanti, distorcono la struttura del DNA; alla replicazione si ha l inserzione o la delezione di una o più basi Proflavina sfasamento del modulo di lettura Arancio di acridina sfasamento del modulo di lettura by GP&NA

44 Gli agenti mutageni chimici agiscono in modo diverso: -Gli analoghi di base rimpiazzano fisicamente le basi normali durante la replicazione del DNA, in seguito cambiano forma in modo da cambiare le loro proprietà di accoppiamento. -Gli agenti che modificano le basi causano cambiamenti chimici nelle basi esistenti, alterando le proprietà di accoppiamento. Entrambi danno origine a sostituzioni

45 - Gli agenti intercalanti vengono inseriti tra basi adiacenti durante la replicazione, causando inserzione o delezione delle singole coppie di basi Si creano delle mutazioni frameshift

46 380nm blu verde giallo rosso 750nm Lo spettro elettromagnetico LUCE VISIBILE Raggi Raggi Raggi X UV Infrarossi cosmici Microonde Onde radio gamma 10-5 nm 10-3 nm 1nm lunghezza d onda 10 3 nm 10 6 nm 10 9 nm 10 3 m radiazione ionizzante Livello energetico by GP&NA piu alto piu basso

47 Radiazioni ionizzanti e conseguenze Le radiazioni ionizzanti penetrano nei tessuti in notevole profondità. Nel loro percorso collidono con gli atomi che incontrano e determinano il rilascio di elettroni e la formazione di ioni carichi positivamente. Questi collidono con altre molecole e quindi si liberano ulteriori elettroni e così via. Si forma quindi un cono di ioni lungo il percorso di ogni raggio ad alta energia attraverso i tessuti viventi. Le radiazioni ionizzanti possono provocare rotture cromosomiche e quindi sia riarrangiamenti cromosomici che mutazioni puntiformi. by GP&NA

48 UV formazione di dimeri TGCTCATATGGACA T T AGTCGGTTCATGGT ACGAGTATACCTGT A A TCAGCCAAGTACCA Endonucleasi TGCTCATATGGACA T T AGTCGGTTCATGGT ACGAGTATACCTGT A A TCAGCCAAGTACCA Esonucleasi TGCTCATATGG CGGTTCATGGTTGGT ACGAGTATACCTGT A A TCAGCCAAGTACCA Radiazioni non ionizzanti e riparazione I raggi UV inducono la formazione di dimeri di timina adiacenti nel DNA; questo modifica la conformazione della doppia elica. La distorsione può essere riparata mediante fotoreattivazione e per escissione (a sinistra) by GP&NA DNA polimerasi I TGCTCATATGGACATAGCGGTTCATGGT ACGAGTATACCTGTATCAGCCAAGTACCA Ligasi TGCTCATATGGACATAGCGGTTCATGGT ACGAGTATACCTGTATCAGCCAAGTACCA

49 Origine delle mutazioni spontanee Non esiste una quantità adeguata di radiazioni di fondo (raggi cosmici, materiali radioattivi terrestri) sufficiente per spiegare i tassi di mutazione osservati nella maggior parte degli organismi. Ad esempio, in Drosophila, il tasso di mutazione spontanea è circa 1300 volte quello atteso considerando l intensità delle radiazioni naturali e quindi hanno piccola responsabilità nella determinazione delle mutazioni spontanee. by GP&NA

50 Universita di Bari Cause delle mutazioni spontanee La natura del processo di mutazione spontanea va cercata all interno della cellula e dell organismo. In Drosophila maschi e femmine dello stesso ceppo hanno = tasso di mutazione, mentre individui di ceppi diversi hanno TM differenti TEMPERATURA ETA GENI MUTATORI ELEMENTI TRASPONIBILI by GP&NA

51 EFFETTI BIOLOGICI DELLE MUTAZIONI: 1 mutazioni germinali Le mutazioni che insorgono in meiosi o dopo o che vi passano senza subire variazioni, determinano nella progenie i seguenti effetti: 1) MUTAZIONI GENICHE: il loro effetto dipende dalla dominanza e dal tipo di selezione cui sono sottoposte. 2) MUTAZIONI CROMOSOMICHE SBILANCIATE (delezioni, duplicazioni, aneuploidie): sono dannose in eterozigosi e ancora più dannose in omozigosi. 3) MUTAZIONI STRUTTURALI BILANCIATE (inversioni, traslocazioni, fusioni-fissioni centriche): producono un difetto di fecondità negli eterozigoti MUTAZIONI GENOMICHE 4) AUTOPOLIPLOIDIE: sono mal tollerate negli animali, ben tollerate nelle piante ma del tutto sterili. 5) ALLOPOLIPLOIDIE: sono ben tollerate nelle piante e del tutto feconde.

52 EFFETTI BIOLOGICI DELLE MUTAZIONI: 2 mutazioni precoci e somatiche Mutazioni precoci: determinano i loro effetti specifici in settori del corpo tanto più ampi quanto più precoce è la mutazione; sono una delle cause del mosaicismo. Mutazioni somatiche: il rischio più rilevante è il cancro, che viene indotto da mutazioni che coinvolgono geni connessi al controllo della proliferazione cellulare attraverso diversi meccanismi: espressione di nuovi alleli dovuti a mutazione genica; effetto di posizione in inversioni e traslocazioni, per cui un gene modifica la sua espressione in funzione dei geni adiacenti; alterazione del dosaggio genico in seguito a mutazioni cromosomiche sbilanciate pseudodominanza, per cui si manifestano alleli recessivi in seguito alla perdita dei corrispondenti alleli dominanti in seguito a delezione o monosomia.

53 EFFETTI EVOLUTIVI DELLE MUTAZIONI 1) MUTAZIONI GENICHE: danno origine a nuovi alleli, sono quindi la fonte primaria della variabilità genetica; il loro effetto dipende dal tipo di selezione cui sono sottoposte. 2) DUPLICAZIONI: possono dare origine a nuovi geni, consentendo il cambiamento nel tempo e la complessificazione delle specie. 3) INVERSIONI, TRASLOCAZIONI, FUSIONI-FISSIONI: la riduzione di fecondità degli eterozigoti favorisce l isolamento riproduttivo e la nascita di nuove specie. 4) ALLOPOLIPLOIDIA: può dare origine a molti nuovi geni, avendo un intero genoma in eccesso ; gli allopoliploidi costituiscono nuove specie, dato che gli ibridi fra l allopoliploide e le specie da cui origina è del tutto sterile;

La mutazione è una modificazione della sequenza delle basi del DNA

La mutazione è una modificazione della sequenza delle basi del DNA La mutazione è una modificazione della sequenza delle basi del DNA Le mutazioni sono eventi rari e importanti in quanto sono alla base dell evoluzione biologica Le mutazioni possono essere spontanee (dovute

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio

Dettagli

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo

Mutazioni cromosomiche. Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Le mutazioni cromosomiche sono la causa più frequente di aborto precoce e una importante causa di ritardo mentale nell uomo Mutazioni cromosomiche Variazioni della struttura Variazioni

Dettagli

MECCANISMI DI RIPARAZIONE DEL DNA

MECCANISMI DI RIPARAZIONE DEL DNA MECCANISMI DI RIPARAZIONE DEL DNA MUTAZIONI SPONTANEE ED INDOTTE Il danno al DNA non riparato può portare a mutazioni che causano malattie o morte delle cellule. Le mutazioni derivano da cambiamenti della

Dettagli

Le mutazioni Quando le informazioni sono errate

Le mutazioni Quando le informazioni sono errate Le mutazioni Quando le informazioni sono errate Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Storia delle mutazioni Dal 1927 viene usato il concetto di mutazione così come è inteso oggi Il primo

Dettagli

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica

La mutazione. Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione Cambiamento ereditario, raro, casuale ed improvviso che provoca una alterazione qualitativa e/o quantitativa dell informazione genetica La mutazione 1. Crea variabilità sulla quale agisce

Dettagli

Mutazioni cromosomiche

Mutazioni cromosomiche Mutazioni cromosomiche Quadro d insieme delle mutazioni cromosomiche Cambiamenti nel numero di cromosomi Uno più corredi cromosomici: euploidia (monoploidia n, diploidia 2n, triploidia 3n, tetraploidia

Dettagli

Nucleotide / aminoacido? 4 aa. 2 Nucleotide / aminoacido? 4 2 = 16 aa. 3 Nucleotide / aminoacido? 4 3 = 64 aa. UNIVERSALE e DEGENERATO

Nucleotide / aminoacido? 4 aa. 2 Nucleotide / aminoacido? 4 2 = 16 aa. 3 Nucleotide / aminoacido? 4 3 = 64 aa. UNIVERSALE e DEGENERATO La#scoperta#della#stru.ura#a#doppia#elica# nel#1953#ha#fa.o#immediatamente# sorgere#una#domanda:## come#l informazione#gene;ca#può#essere# codificata#dal#dna?# Nucleotide / aminoacido? 4 aa 2 Nucleotide

Dettagli

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8

SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 SOLUZIONI AI PROBLEMI DEL CAPITOLO 8 Domande Concettuali C1. Le duplicazioni e le deficienze causano un cambiamento nella quantità totale del materiale genetico: le duplicazioni comportano la ripetizione

Dettagli

Tecniche di bandeggio

Tecniche di bandeggio Tecniche di bandeggio sono sistemi di colorazione che conferiscono ai cromosomi caratteristici pattern di bande più o meno intense ogni cromosoma umano presenta un bandeggio (ossia una sequenza di bande)

Dettagli

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI

VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI VARIAZIONI DELLA STRUTTURA DEI CROMOSOMI Le alterazioni strutturali implicano cambiamenti di parti di cromosomi. Esistono 4 tipi di tali mutazioni: Delezione Duplicazione inversione Traslocazione Determinano

Dettagli

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446

Corso di. Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Corso di Giandomenico Corrado Dipartimento di Scienze del Suolo, della Pianta e dell Ambiente : giacorra@unina.it : 081.25.39446 Concetti chiave della seconda lezione Il genomadeiplastidie deimitocondrinellepiantesuperiori

Dettagli

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA.

Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica. Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. Mutagenesi: introduzione di alterazioni in una sequenza nucleotidica Mutagenesi random: le mutazioni avvengono a caso su un tratto di DNA. In genere si ottengono trattando il DNA con agenti chimici (es.

Dettagli

Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente

Dettagli

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule

Dettagli

Alberto Viale I CROMOSOMI

Alberto Viale I CROMOSOMI Alberto Viale I CROMOSOMI DA MENDEL ALLA GENETICA AL DNA ALLE MUTAZIONI I cromosomi sono dei particolari bastoncelli colorati situati nel nucleo delle cellule. Sono presenti nelle cellule di ogni organismo

Dettagli

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica

Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Elementi di Patologia Generale Dott.ssa Samantha Messina Lezione: Patologia Genetica Anno accademico 2009/2010 I anno, II semestre CdL Infermieristica e Fisioterapia PATOLOGIA GENETICA Oggetto di studio

Dettagli

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA

LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA LA COSTRUZIONE DEL PEDIGREE NELLA GENETICA UMANA Un metodo di base di analisi genetica negli esseri umani è la costruzione di una storia familiare per seguire la trasmissione ereditaria di un carattere.

Dettagli

GENETICA seconda parte

GENETICA seconda parte GENETICA seconda parte I cromosomi sono lunghe molecole di una sostanza l acido desossiribonucleico. DNA Il DNA è una lunga catena fatta da due lunghi fili avvolti su se stessi a doppia elica. Sembra una

Dettagli

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione

Mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Mutazioni Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Le mutazioni possono essere spontanee oppure causate da agenti fisici, chimici

Dettagli

CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE

CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE CAPITOLO 7 MUTAZIONI ED ELEMENTI GENETICI MOBILI LIGUORI EDITORE 1 Questa opera è protetta dalla Legge sul diritto d autore (Legge n. 633/1941: http://www.giustizia.it/cassazione/leggi/l633_41.html). Tutti

Dettagli

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA

Gaetano Graziano M E I O S I. La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA Gaetano Graziano M E I O S I La via per la diversità e l irripetibilità PREMESSA SIGNIFICATO PROCEDURA IMPORTANZA 1 P r e m e s s e DNA Cromosomi Aploidia e diploidia Geni 2 DNA E la sostanza chimica con

Dettagli

www.fisiokinesiterapia.biz LE LEGGI DI MENDEL

www.fisiokinesiterapia.biz LE LEGGI DI MENDEL www.fisiokinesiterapia.biz LE LEGGI DI MENDEL Gregor Johann Mendel (1822-1884) Comprese i principi che regolano la trasmissione dei caratteri ereditari alla progenie senza conoscere - l esistenza dei geni

Dettagli

LO STUDIO DEI CROMOSOMI: CITOGENETICA

LO STUDIO DEI CROMOSOMI: CITOGENETICA LO STUDIO DEI CROMOSOMI: CITOGENETICA 0.5% DEI NEONATI: MALATTIE CROMOSOMICHE SINDROME DI DOWN, X-FRAGILE ANOMALIE CROMOSOMICHE IN CELLULE SOMATICHE: TUMORI TECNICHE PER LO STUDIO DEI CROMOSOMI A PARTIRE

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica

Meiosi Genetica. Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Meiosi Genetica Riproduzione sessuale Basi molecolari dell ereditarietà dei caratteri Variabilità genetica Batteri e altri organismi unicellulari si riproducono mediante divisione cellulare (riproduzione

Dettagli

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà

GENETICA MENDELIANA. Per i suoi studi, Mendel utilizzò piante di pisello odoroso (Pisum sativum) Facilità di coltivazione. Disponibilità di varietà GENETICA: è la scienza che studia i caratteri ereditari degli organismi viventi, i meccanismi attraverso i quali si trasmettono ai discendenti e le modalità con cui si manifestano. La genetica moderna

Dettagli

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme

= femmina. = maschio. = fenotipo banda bianca. = fenotipo pezzato. =fenotipo colore uniforme Test n.8 Dalle Olimpiadi delle Scienze Naturali 2002 PARTE TERZA Le 5 domande di questa parte riguardano il medesimo argomento e sono introdotte da un breve testo e da uno schema. In una razza bovina il

Dettagli

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà

GENETICA... lessico. Genetica: studio dei geni e dell'ereditarietà GENETICA... lessico Genetica: studio dei geni e dell'ereditarietà Geni: porzioni di DNA contenenti un'informazione che permette di decodificare una certa proteina. Es: gene che determina il colore dei

Dettagli

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione

Dettagli

SCAMBI tra due coppie di cromosomi NON omologhi

SCAMBI tra due coppie di cromosomi NON omologhi TRASLOCAZIONI RECIPROCHE SCAMBI tra due coppie di cromosomi NON omologhi La traslocazione tra i cromosomi X e 21 può interrompere la sequenza del gene DMD e causare la manifestazione della DISTROFIA MUSCOLARE

Dettagli

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide

Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie: il numero dei cromosomi non è un multiplo esatto del normale assetto aploide Aneuploidie Nullisomia: 2n-2 (morte preimpianto) Monosomia: : 2n-1 (generalmente morte embrionale) Trisomia: :

Dettagli

Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche costituzionali acquisite nelle cellule germinali nelle cellule somatiche Le alterazioni che avvengono nelle cellule germinali se compatibili con la vita porteranno alla nascita di

Dettagli

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo LE MUTAZIONI

CORSO DI GENETICA. Roberto Piergentili. Università di Urbino Carlo Bo LE MUTAZIONI CORSO DI GENETICA LE MUTAZIONI Generalità sulle mutazioni - 1 La mutazione è un processo che altera la sequenza di basi nel DNA. Generalità sulle mutazioni - 2 Le mutazioni della linea somatica avvengono

Dettagli

EFFETTI BIOLOGICI DELLE RADIAZIONI

EFFETTI BIOLOGICI DELLE RADIAZIONI EFFETTI BIOLOGICI DELLE RADIAZIONI Asp 2- Caltanissetta- Dott.ssa G. Di Franco Dirigente medico U.O. Radioterapia San Cataldo RADIAZIONI IONIZZANTI Radiazioni capaci di causare direttamente o indirettamente

Dettagli

Genetica. Mendel e la genetica

Genetica. Mendel e la genetica Genetica Le leggi dell ereditarietà di Mendel Ereditarietà e cromosomi Estensioni della genetica mendeliana Applicazioni della genetica Genoma umano Mendel e la genetica Mendel 81822-1884), un monaco di

Dettagli

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione MUTAZIONI SPONTANEE MUTAZIONI INDOTTE Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione Tasso di mutazione: probabilità che una mutazione si verifichi nel tempo.

Dettagli

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica

Citogenetica. 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche. Genomica. Paolo Edomi - Genetica Citogenetica 1. classificazione dei cromosomi 2. mutazioni cromosomiche 3. mappe cromosomiche Genomica Indagine citogenetiche La citogenetica studia la morfologia e le caratteristiche genetiche dei cromosomi

Dettagli

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards)

- Markers di anomalie cromosomiche. - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Markers di anomalie cromosomiche - Trisomia 21 (sindrome di Down) - Trisomia 13 (sindrome di Patau) - Trisomia 18 (sindrome di Edwards) - Sindrome di Turner - Sindrome di Williams - Sindrome di Angelman

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

GENETICA MENDELIANA NELL UOMO

GENETICA MENDELIANA NELL UOMO GENETICA MENDELIANA NELL UOMO GENETICA FORMALE o GENETICA CLASSICA basata unicamente su risultati visibili di atti riproduttivi. È la parte più antica della genetica, risalendo agli esperimenti di Mendel

Dettagli

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei

Dettagli

6) Una cellula con 10 coppie di cromosomi entra in mitosi. Quanti cromosomi avrà ognuna delle due cellule figlie? a) 5 b) 20 coppie e) 20 d) 10

6) Una cellula con 10 coppie di cromosomi entra in mitosi. Quanti cromosomi avrà ognuna delle due cellule figlie? a) 5 b) 20 coppie e) 20 d) 10 Corso di Laurea in Scienze Ambientali Genetica e Biologia delle popolazioni Autovalutazione n. 1 1)Il fenotipo è: a) l insieme dei geni di un organismo b) il numero di cromosomi di un individuo c) la capacità

Dettagli

Biomarkers per la diagnosi precoce di tumori

Biomarkers per la diagnosi precoce di tumori Università degli Studi di Bari Aldo Moro Dipartimento di Bioscienze, Biotecnologie e Biofarmaceutica Biomarkers per la diagnosi precoce di tumori Dott.ssa Maria Luana Poeta Cos è un Tumore Omeostasi Tissutale

Dettagli

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE

OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata

Dettagli

CAUSE INTRINSECHE DI MALATTIA CAUSA INTRINSECA (fattore endogeno, insito nell organismo) Alterazioni del Patrimonio Genetico Malattie Ereditarie Predisposizioni Fattori, ereditati geneticamente, che favoriscono

Dettagli

La genetica è la disciplina che si occupa della trasmissione dei caratteri ereditari Si divide in:

La genetica è la disciplina che si occupa della trasmissione dei caratteri ereditari Si divide in: La genetica La genetica è la disciplina che si occupa della trasmissione dei caratteri ereditari Si divide in: 1. Genetica mendeliana 2. Genetica citoplasmatica 3. Citogenetica 4. La genetica delle popolazioni

Dettagli

REPLICAZIONE DEL DNA

REPLICAZIONE DEL DNA REPLICAZIONE DEL DNA La replicazione (o anche duplicazione) è il meccanismo molecolare attraverso cui il DNA produce una copia di sé stesso. Ogni volta che una cellula si divide, infatti, l'intero genoma

Dettagli

La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.

Dettagli

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione

Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione MUTAZIONI SPONTANEE MUTAZIONI INDOTTE Frequenza di mutazione: numero di volte in cui una mutazione si verifica in una popolazione Tasso di mutazione: probabilità che una mutazione si verifichi nel tempo.

Dettagli

Il genoma dinamico: gli elementi trasponibili

Il genoma dinamico: gli elementi trasponibili Il genoma dinamico: gli elementi trasponibili Anni trenta: studi sul mais ribaltano la visione classica secondo cui i geni si trovano solo in loci fissi sul cromosoma principale Esistono elementi genetici

Dettagli

LA GENETICA. Dott.ssa Valentina Terio

LA GENETICA. Dott.ssa Valentina Terio LA GENETICA Dott.ssa Valentina Terio LLA GENETCA SCIENZA NATA CIRCA 150 ANNI FA GRAZIE AD UN STUDIOSO AUSTRIACO DI NOME MENDEL Pisello da giardino per la facilità di crescita e la possibilità di una impollinazione

Dettagli

DOGMA CENTRALE DELLA BIOLOGIA

DOGMA CENTRALE DELLA BIOLOGIA DOGMA CENTRALE DELLA BIOLOGIA REPLICAZIONE DEL DNA (SINTESI o DUPLICAZIONE) MODELLO SEMICONSERVATIVO Meselson e Stahl (1958) DNA POLIMERASI CROMOSOMA NON DUPLICATO CROMOSOMA DUPLICATO (CROMATIDI FRATELLI)

Dettagli

La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono

Dettagli

Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti www.baveno.net Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.

Dettagli

SINDROMI CROMOSOMICHE

SINDROMI CROMOSOMICHE SINDROMI CROMOSOMICHE Lo sviluppo di ciascun organo del corpo è regolato da un gran numero di geni che interagiscono in maniera complessa. Oggi si conoscono bene i meccanismi con cui si ereditano molte

Dettagli

CAUSE INTRINSECHE DI MALATTIA

CAUSE INTRINSECHE DI MALATTIA CAUSE INTRINSECHE DI MALATTIA CAUSA INTRINSECA (fattore endogeno, insito nell organismo) Alterazioni del Patrimonio Genetico Malattie Ereditarie Predisposizioni Fattori, ereditati geneticamente, che favoriscono

Dettagli

Trasmissione del materiale ereditario

Trasmissione del materiale ereditario Trasmissione del materiale ereditario Confronto tra mitosi e meiosi: La mitosi consiste in una duplicazione dei cromosomi seguita da una regolare separazione Ciascun cromosoma si comporta indipendentemente

Dettagli

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884)

La trasmissione dei caratteri ereditari. Le leggi di Mendel (1882-1884) La trasmissione dei caratteri ereditari Le leggi di Mendel (1882-1884) Le leggi di Mendel studiano la trasmissione di caratteri qualitativi prodotti da un singolo gene Procedimento sperimentale di Mendel

Dettagli

Genetica dei microrganismi

Genetica dei microrganismi Genetica dei microrganismi Dott.ssa Silvia Preziuso Dipartimento di Scienze Veterinarie Università di Camerino Sezione di Patologia Animale, Profilassi e Igiene degli Alimenti Argomenti trattati Gli acidi

Dettagli

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012

Meiosi. Meiosi 16/01/2013. Biotecnologie 2012 Meiosi Meiosi Biotecnologie 2012 La meiosiè un tipo specializzato di ciclo cellulare che dimezza il numero di cromosomi, dando origine alla produzione di cellule figlie aploidi. Mentre le cellule somatiche

Dettagli

LE MUTAZIONI. www.slidetube.it Pagina 1

LE MUTAZIONI. www.slidetube.it Pagina 1 LE MUTAZIONI Buongiorno a tutti, io sono una collaboratrice del professor Fazio e oggi lo sostituisco perché non può venire. Questa lezione verte soprattutto sulle mutazioni, meccanismi di formazioni di

Dettagli

Estensioni e variazioni dell eredit. ereditàmendeliana

Estensioni e variazioni dell eredit. ereditàmendeliana Estensioni e variazioni dell eredit ereditàmendeliana I principi dell ereditariet ereditarietà enunciati da Mendel non sono sempre rispettati. Sbagliati? No, insufficienti per spiegare tutte le modalità

Dettagli

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed

Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed Inattivazione dell X per imprinting: non si osserva metilazione del DNA; questo probabilmente spiega la rapida reversibilita dell inattivazione ed anche la maggiore dipendenza dalle proteine policomb per

Dettagli

Analisi molecolare dei geni

Analisi molecolare dei geni Analisi molecolare dei geni Denaturazione e rinaturazione di una molecola di DNA Si rompono i legami idrogeno 100 C Denaturazione del DNA Rinaturazione per riassociazione delle sequenze complementari Ogni

Dettagli

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI?

EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? EREDITA MENDELIANA IL CARATTERE E TRASMESSO CON GLI AUTOSOMI O E ASSOCIATO AI CROMOSOMI SESSUALI? CARATTERE AUTOSOMICO -codificato da geni su cromosomi non sessuali -non ci sono differenze di trasmissione

Dettagli

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2

Scala fenotipica. Dominante o recessivo? fenotipo. fenotipo. fenotipo A 1 A 1 A 2 A 2 A 1 A 2 fenotipo Dominante o recessivo? Scala fenotipica fenotipo A 1 A 1 A 2 A 2 fenotipo A 1 A 2 A 1 dominante A 1 e A 2. codominanti A 2 dominante A 1 dominanza incompleta A 2 dominanza incompleta Nei casi

Dettagli

Mutazioni genetiche 2

Mutazioni genetiche 2 Mutazioni genetiche 2 Cosa sono le mutazioni? Le proteine sono in grado di svolgere la loro funzione solo se la loro sequenza amminoacidica è quella corretta. In caso contrario si possono generare delle

Dettagli

Le leggi della Genetica

Le leggi della Genetica Le leggi della Genetica La genetica studia le caratteristiche ereditarie e come esse si trasmettono attraverso le generazioni. Si tratta di un campo di indagine scientifica vastissimo che, sulla base di

Dettagli

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene

I marcatori molecolari. Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene I marcatori molecolari Dipartimento di Scienze Agronomiche e Genetica Vegetale Agraria Corso di Genetica Agraria Giovanna Attene Marcatori molecolari del DNA I marcatori molecolari sono sequenze di DNA

Dettagli

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia

R.J.Brooker, Principi di genetica Copyright 2010 The McGraw-Hill Companies S.r.l., Publishing Group Italia Capitolo 6 Trasferimento genetico e mappatura genetica nei batteri e nei batteriofagi 6.1 Circa 10 8 cellule di Escherichia coli appartenenti a un ceppo mutante vengono inoculate su un terreno colturale

Dettagli

8. MUTAZIONI CROMOSOMICHE

8. MUTAZIONI CROMOSOMICHE 8. MUTAZIONI CROMOSOMICHE CAUSA: segregazione mitotica o meiotica errata TIPI: Poliploidia (3n, 4n, ecc) Autopliploidia Allopoloploidia Cause: dispermia, endomitosi, meiosi anomala EFFETTI: spesso letale

Dettagli

I.7.1 Malattie genetiche legate al sesso

I.7.1 Malattie genetiche legate al sesso verificare tutti i possibili risultati della fecondazione tra cellula uovo e spermatozoi e constatare come le probabilità che nasca una femmina o un maschio sono entrambe pari al 50%. Figura 7 - Ad ogni

Dettagli

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione.

LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. LA GENETICA scienza che studia i caratteri ereditari e i meccanismi che ne regolano la trasmissione. Gregor Jhoann Mendel (1822-1884) Mendel viveva nel monastero di Brum, a Brno in Repubblica Ceca, studiò

Dettagli

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO

www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO www.fisiokinesiterapia.biz CARIOTIPO UMANO NORMALE E PATOLOGICO CROMOSOMI Appaiono come corpi compatti solo nelle cellule in divisione, in particolare durante la metafase, quando possono essere identificati

Dettagli

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed.

PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015. Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. PROGRAMMA DI SCIENZE Cl. II sez. E A.S. 2014/2015 CHIMICA Testo: S. Passannanti C. Sbriziolo Noi e la chimica Dai fenomeni alle leggi Ed. Tramontana S. Passannanti C. Sbriziolo Noi e la chimica agli atomi

Dettagli

MANIPOLAZIONE GENETICA DEGLI ANIMALI

MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza

Dettagli

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali

Lo sviluppo del cancro è un processo complesso che coinvolge parecchi cambiamenti nella stessa cellula staminale. Poiché tutte le cellule staminali Tumore Cos è il tumore? Il tumore o neoplasia (dal greco neo,, nuovo, e plasìa,, formazione), o cancro se è maligno, è una classe di malattie caratterizzate da una incontrollata riproduzione di alcune

Dettagli

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI:

Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Prima Legge di Mendel LEGGE DELLA SEGREGAZIONE IN PROPORZIONI UGUALI: Durante la meiosi, i membri di una coppia allelica si separano in modo simmetrico nelle uova e negli spermatozoi. Questa separazione

Dettagli

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,

Dettagli

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA

27/07/2011 DISCUSSIONE SUI TEST DI BIOLOGIA APPLICATA Facoltà di Medicina e Chirurgia Preside: Prof. Gian Franco Gensini Biologia Docente Chiara Donati data 27 Luglio 2011 PRECORSO 2011: ciclo formativo di orientamento alle prove di ammissione ai Corsi di

Dettagli

RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.

Dettagli

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA.

Risposta: 2. Uracile. Risposta: 2. legami idrogeno. Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. Risposta: 2. Uracile Adenina, Citosina e Guanina si trovano sia nell RNA che nel DNA. La Timina si trova soltanto nel DNA; l Uracile si sostituisce alla Timina nelle molecole dell RNA. Risposta: 2. legami

Dettagli

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di

Dettagli

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani

LE MOLECOLE INFORMAZIONALI. Lezioni d'autore Treccani LE MOLECOLE INFORMAZIONALI Lezioni d'autore Treccani Introduzione (I) I pionieri della biologia molecolare, scoperta la struttura degli acidi nucleici, pensarono di associare al DNA una sequenza di simboli,

Dettagli

I CARATTERI EREDITARI

I CARATTERI EREDITARI I CARATTERI EREDITARI I primi passi per comprendere come si trasmettono le caratteristiche attraverso le generazioni furono lenti e difficili. I caratteri di un individuo sono spesso molto simili a quelli

Dettagli

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia

Delezione. Duplicazione. Variazioni della struttura. Inversione. Traslocazione. Mutazioni cromosomiche. Nullisomia Monosomia Trisomia Tetrasomia Delezione Variazioni della struttura Duplicazione Inversione Mutazioni cromosomiche Variazioni del numero Traslocazione Aneuploidie Nullisomia Monosomia Trisomia Tetrasomia Variazioni del numero di assetti

Dettagli

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI

Componenti cellulari 24 2.3 Divisione e morte cellulare 38 Introduzione alla genetica 1 CERCASI DONATRICI DI OVULI L Autrice v Prefazione xiii L aspetto umano xvi Applicazioni della genetica umana xvii Il sistema Lewis di apprendimento guidato xviii P A R T E 1 Introduzione 1 A P I T O L O 1 2.2 omponenti cellulari

Dettagli

MUTAZIONI ED EVOLUZIONE

MUTAZIONI ED EVOLUZIONE MUTAZIONI ED EVOLUZIONE Durante la duplicazione del DNA possono verificarsi errori di copiatura se ad esempio al posto di una base azotata ne viene inserita un altra. In questo caso può succedere che cambi

Dettagli

Crescita e divisione cellulare

Crescita e divisione cellulare 08-04-14 CANCRO Crescita e divisione cellulare ogni cellula deve essere in grado di crescere e riprodursi una cellula che cresce e si divide genera due nuove cellule figlie gene4camente iden4che alla cellula

Dettagli

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel il sesso di un individuo

Dettagli

La regolazione genica nei virus

La regolazione genica nei virus La regolazione genica nei virus Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri I VIRUS INDICE Caratteristiche dei virus: il capside e il genoma virale Classificazione virale Fasi del ciclo riproduttivo

Dettagli

TEORIA CROMOSOMICA : ALLEGATI

TEORIA CROMOSOMICA : ALLEGATI TEORIA CROMOSOMICA : ALLEGATI FIG. 2 a pag. 1 FIG. 5 a pag. 3 FIG. 7 a pag. 5 FIG. 9 a pag. 7 FIG. 3 e 4 a pag. 2 FIG. 6 a pag. 4 FIG. 8 a pag. 6 FIG. 10 e 11 a pag. 8 1 FIGURA 2 Perché sono tutti maschi

Dettagli

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA

I MOTORI DELL EVOLUZIONE PT1. POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA I MOTORI DELL EVOLUZIONE PT1 POMERIGGIO DI AGGIORNAMENTO 23.03.2011 PROF. M.A. ZORDAN, Ph.D UNIVERSITÀ DEGLI STUDI DI PADOVA 1 GREGOR MENDEL 1822-1884 2 2 Grandi navigatori 3 3 Rotte commerciali per le

Dettagli

CLASSE I classico A e B

CLASSE I classico A e B LICEO SCIENTIFICO "A. APROSIO" VENTIMIGLIA CLASSE I classico A e B Anno scolastico 2011-2012 UNITA' DIDATTICA N 1 METODI ED ORGANIZZAZIONE DEI CONCETTI IN BIOLOGIA 1.1 LE CARATTERISTICHE COMUNI A TUTTI

Dettagli

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare

Nozioni di base. cromosoma. 2. I cromosomi sono composti dal DNA. Ogni essere vivente è composto di cellule DNA. corpo cellulare Nozioni di base cromosoma Ogni essere vivente è composto di cellule 2. I cromosomi sono composti dal DNA batterio cellula vegetale cellula muscolare cellula nervosa DNA corpo cellulare 1. I geni sono situati

Dettagli

CORSO INTEGRATO DI GENETICA

CORSO INTEGRATO DI GENETICA CORSO INTEGRATO DI GENETICA a.a.2010-2011 Prof. Pier Franco Pignatti 20.10.2010 Lezioni N. 15 e16 Mutagenesi e malattie da difetto di riparazione Neri-Genuardi cap 10 Xeroderma pigmentoso, Atassia teleang.,

Dettagli

Le mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione

Le mutazioni. Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Le mutazioni Un cambiamento nel materiale genetico che non venga riparato dai meccanismi di riparo costituisce una mutazione Le mutazioni possono essere spontanee oppure causate da agenti fisici, chimici

Dettagli

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked Trasmissione ereditaria di un singolo gene (eredità monofattoriale) Mendeliana Autosomica Dominante (AD) Autosomica Recessiva (AR) X-linked Recessiva (X-linked R) X-linked Dominante (X-linked D) Y-linked

Dettagli