La Genomica in Sanità Pubblica I Convegno Siciliano

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "La Genomica in Sanità Pubblica I Convegno Siciliano"

Transcript

1 La Genomica in Sanità Pubblica I Convegno Siciliano Catania, 18 Dicembre 2014 Nuove tecnologiche nella genomica in sanità pubblica Marco Fichera Università di Catania A.O.U. Policlinico V.E. Catania 1

2 CMA ( chromosomal microarrarray analysis) postnatale Prenatale NGS (Next generation sequencing) Postnatale NIPT (non invasive prenatal testing) Postnatale 2

3 3

4 ARRAY: insieme ordinato di sequenze genomiche, la cui mappatura è nota, fissate ad un substrato solido secondo uno schema ricostruibile. 4

5 Array CGH-SNPs Gli SNPs sono sequenze nucleotidiche che differiscono per la sostituzione di un nucleotide (A, T, C, G) con un altro. Lo SNP per essere definito tale deve avere una frequenza maggiore dell 1% nella popolazione; per uno studio di CGH-SNPs array, maggiore è la frequenza più informativo sarà lo SNPs per l analisi Single nucleotide polymorphism (SNP) basati su «microarray» permettono l individuazione di regioni di omozigosità (HZ) attraverso i marcatori biallelici dispersi in tutto genoma per la rilevazione di UPD e IBD 5

6 CMA nella Disabilità intellettiva Aberrazioni cromosomiche criptiche: 15% - 20% dei soggetti con DI, negativi al FRAXA, al cariotipo ed all analisi subtelomerica, hanno uno sbilanciamento genico. La correlazione genotipo-fenotipo è resa difficile dalla grande variabilità del genoma umano. L interpretazione dei dati di un array è tuttora molto difficile. Alcune CNV rappresentano fattori di rischio ad alta penetranza, altre solo fattori predisponenti a penetranza incompleta e rappresentano un problema emergente in genetica clinica. Negli ultimi anni hanno permesso la definizione di numerose nuove sindromi genomiche, 6

7 Il microarray rimpiazza il cariotipo come primo test nel RM\ACM ASD AJHG 2010: The International Standard Cytogenomic Array Consortium Available evidence strongly supports the use of CMA in place of G-banded karyotyping as the first-tier cytogenetic diagnostic test for patients with DD/ID, ASD, or MCA. G-banded karyotype analysis should be reserved for patients with obvious chromosomal syndromes (e.g., Down syndrome), a family history of chromosomal rearrangement, or a history of multiple miscarriages. 7

8 La diagnosi nella DI Il CMA deve essere eseguito da persone esperte Il laboratorio deve costruire un database interno di CNV ottenuto sulla popolazione locale ( CNV della stessa etnia) Il laboratorio deve operare in stretta collaborazione con i clinici. L accumularsi di dati facilita l interpretazione dei risultati L analisi dei genitori è da considerarsi fondamentale L analisi bioinformatica è assolutamente necessaria. Refertare un CMA è un lavoro complesso e lungo che richiede parecchia expertise da parte dell operatore e spesso la necessità di conoscere il fenotipo in dettaglio. 8

9 Diag. Prenat. CMA vs cariotipo (DP) DR CGH = 2 X DR Kar Tempi di risposta più rapidi Costi in rapida discesa Indicazioni: stesse del cariotipo indipendenti dall età materna. CMA Non vede traslocazioni bilanciate Vede isodisomie (Eterodisomie se genit.)

10 Ma.. Può identificare varianti il cui significato clinico è sconosciuto (dati non ancora sufficienti per una correlazione genotipo fenotipo) Necessita spesso dell analisi dei genitori Può occorrere il test di paternità (microsatelliti) Il criterio di patogenicità di una variante de novo non è assoluto ed ha meno forza rispetto alla diagnosi prenatale Le varianti possono avere una penetranza incompleta o un espressività variabile rischio di falsi positivi. ( Uccidere un feto sano)

11 Le problematiche CNVs non presenti nei db popolazione generale, non contenenti geni conosciuti come patogenetici VOUS. CNVs de novo ma non patogenetiche CNVs ereditati : penetranza incompleta (es: 7q11.23 dup, 1q21.1 del/dup, 15q13.3 deletion, 16p11.2 dup, 22q11.21del/dup..)

12 Predittività e prevalenza Valore predittivo positivo di un test (VPP) : prob che un soggetto positivo al test sia realmente affetto (proporzione Non bisogna di soggetti confondere positivi la probabilità che sono affetti) di risultare positivo Conoscere ad il un tasso test di qualora falsi positivi si sia e sani negativi ( che non dipende è dal sufficiente test), con ma la probabilità occorre sapere di essere anche la sani reale qualora prevalenza si sia della positivi malattia. test ( che dipende anche dalla prevalenza) Se la malattia è rara, anche se il tasso di falsi positivi è ridotto, un risultato positivo al test ha alte probabilità di non essere significativo. E importante sapere se si è in un gruppo a rischio alto 12

13 E nella diagnosi prenatale? De novo è un criterio forte? Probabilità di non essere malati ( CNV de novo non causativa) se si ha una CNV de novo? 2% della pop. gen. ha una CNV de novo non causativa (> 100 Kb) (falsi positivi) Possiamo approx. che negli individui con DI e ACM, il 20% ha una CNV de novo causativa ( veri positivi) 13

14 In diagnosi postnatale Supponiamo falsi negativi = 0 Su individui con DI/ACM ci sono 2000 veri positivi ( in cui la CNV de novo è causativa) e 200 falsi positivi (CNV de novo non causativa) Prob di essere affetto (CNV de novo causativa) = veri pos./ (veri pos. + falsi pos.) = 2000 /( ) oltre il 90% 14

15 In diagnosi prenatale Su feti (senza alcuna indicazione) ce ne saranno circa 2/100 (200) con DI/ACM e 9800 normali. Ci saranno dunque 40 (20% di 200) con CNV de novo causative e 200 con CNV de novo non causative. Prob che una CNV de novo sia causativa = 40/240 meno del 17% Il criterio de novo perde molta forza 15

16 A de novo deletion of 3.5 Mb The deletion was not present in the Database of Genomic Variants what about if detected in prenatal diagnosis???? Courtesy of Prof. O. Zuffardi

17 17

18 Array-targeted a bassa risoluzione : <<VOUS ma può non identificare zone prive di sonde o inferiori al limite di risoluzione 18

19 Evoluzione nella velocità del sequenziamento 19

20 20

21 Next Generation Sequencing Si basa sul principio del sequenziamento clonale Frammentazione random del DNA da sequenziare Ligazione dei frammenti con linkers specifici Amplificazione clonale dei singoli frammenti Sequenza parallela di milioni di amplificati clonali tramite sintesi con terminatori, pyrosequencing, variazioni del ph Un singolo strumento può generare diverse Gbasi / giorno Sequenziamento mediante sintesi (SBS) Sequenziamento mediante ligazione (SBL) SOLID terminatori SOLEXA Piroseq. 454 Var. ph Ion Torrent 21

22 NGS Whole genome sequence (WGS) ~ 3x10 9 nt Whole exome sequence (WES) ~ 3x10 7 nt Targeted sequence (pannelli di geni) variabile 22

23 Varianti identificate tramite NGS Whole genome NGS : 3-4 milioni di varianti Exome NGS (~ 1% del genoma, ~85% delle mutazioni conosciute cade nella porzione codante ): vars Filtri: Affidabilità tecnica delle varianti Varianti sinonime Modalità di trasmissione Esclusione di varianti conosciute tramite database Possono rimanere centinaia di var ( non sinonime o di splicing). Si devono applicare ulteriori strategie caso- specifiche. Pipeline bioinformatica necessaria 23

24 NGS 24

25 NGS nella routine diagnostica Il sequenziamento di Sanger è stato il gold standard nella diagnostica molecolare, soprattutto per le malattie genetiche per le quali sono prevalentemente responsabili mutazioni rare o private. Oggi tuttavia esso non rappresenta più un metodo soddisfacente nella pratica diagnostica, soprattutto in presenza di malattie geneticamente eterogenee o dovute a mutazioni che interessano geni di grosse dimensioni e che non si raggruppano in particolari domini. 25

26 Malattie con test facili Malattia Gene Mutazione X Fragile FMR1 Repeat FRAXE FMR2 Repeat Atassia di Friedreich FRDA Repeat Haw River DRPLA Repeat Huntington tipo 1 HD Repeat Kennedy AR Repeat Distrofia miotonica DMPK / ZNF9 Repeat Atassia spinocerebellare SCA1,2, 3, 6, 7, 8,10, 12,17 Repeat Sordità GJB2 1 mutazione comune Charcot-Marie-Tooth Tipo 1A PMP22 1 mutazione comune Neuropatia ereditaria (HNPP) PMP22 1 mutazione comune Atrofia muscolare spinale SMN1 1 mutazione comune Emocromatosi di tipo 1 HFE 2 mutazioni comuni Anemia falciforme HBB 1 mutazione comune Fibrosi cistica CFTR Mutazioni comuni 26

27 Test difficili Malattia Gene Mutazioni Cancro al seno BRCA1 Private BRCA2 Private Cancro al Colon MLH1 Private MSH2 Private MSH6 Private 27

28 Malattie Disturbi della glicosilazione Eterogeneità genetica Numero di geni (approx.) 28 Disturbi del neurosviluppo 150 Paraparesi spastiche 30 Epilessia 130 Distrofie muscolari 45 Sordità 70 Rasopatie 10 Microcefalia 11 28

29 Mutazioni de novo: lezioni da NGS Dati NGS (genoma): tasso di mut. per nucleot x 10-8 Circa 74 mutazioni de novo su genoma per generazione Dati NGS (esoma): tasso di mut. per nucleot. 1.5 x 10-8 Circa 1 mutazione de novo su esoma per generazione Il tasso di mutazione aumenta con l età paterna 29

30 Flowchart Sanger: AD Sospetto diagnostico caso sporadico Screening di un gene Spesso vous Variante missense An. filogenetica De novo? Screening popolazione Gene di 9000 pb codificanti: p(de novo casuale) = 1 x (9000/30*10 6 ) = 3/10.000

31 Targeted NGS Parallelamente alla WES sono stati sviluppati dei metodi che permettono di sequenziare determinate regioni genomiche di nostro interesse. E particolarmente usata nell analisi di geni lunghi, nell approccio diagnostico delle malattie geneticamente eterogenee, in farmacogenetica. L arricchimento delle sequenze d interesse viene attuato tramite diversi protocolli ( ibridazione selettiva, circolarizzazione molecolare, PCR). Il costo e la difficoltà d interpretazione sono più bassi e il coverage più alto rispetto alla NGS whole exome. 31

32 NGS targeted La NGS targeted su geni prescelti dà la possibilità di sequenziare contemporaneamente un pannello di geni responsabili di una o di diverse malattie con fenotipo difficilmente distinguibile. Ogni test include usualmente da 10 a centinaia di geni. Questo approccio permette di aumentare molto la sensibilità clinica del test, precedentemente ostacolata dall alto numero di geni potenzialmente responsabili. La profondità di lettura è più alta 32

33 Nn Nat. Rev. Genet Apr;14(4):

34 Sanger vs targeted NGS Target cds Pochi campioni Molti campioni <1.000 bp Sanger Sanger < bp Sanger NGS >10000 bp NGS NGS 34

35 NGS nella routine clinica: conclusioni I SS è ancora lo standard nella routine clinica, le sue caratteristiche impongono dei limiti nella velocità e nella quantità di target da sequenziare. L NGS targeted permette: Alta processività (quantità di DNA sequenziato/tempo) Alta profondità di lettura (<< errori di lettura, mosaic.) Possibilità di costruire pannelli di geni malattia specifici Possibilità di sequenziare un alto numero di campioni contemporaneamente Costi oramai competitivi con SS Alcuni centri attrezzati direttamente exome seq e successiva analisi geni candidati 35

36 NGS nella routine clinica: conclusioni II La tecnologia NGS e il costante abbattimento dei suoi costi sta rivoluzionando la genomica. La sua applicazione nel campo della ricerca sta portando ad una rapida identificazione di geni mendeliani e di fattori di rischi ad alta penetranza L uso della NGS whole genome / exome nella diagnosi si scontra contro un insufficiente comprensione delle implicazioni cliniche dell enorme mole di dati genetici. In attesa di colmare questo gap culturale, l implementazione di test mirati su pannelli di geni specifici, volti ad ottenere risposte diagnostiche e/o prognostiche chiare, possono (e devono) già oggi essere messi a disposizione del SSN. 36

37 NIPT: non invasive prenatal testing Misura la quantità di DNA fetale libero (cfdna) presente nel sangue della gravida. Il cfdna comprende ~2-20% del DNA libero circolante. Aumenta con l età gestazionale. La NIPT determina se c è una quantità alterata di cfdna di particolari sequenze dei cromosomi 13, 18, 21 rispetto a quella attesa. Non è invasiva ( prelievo del sangue dalla gravida) Si può già effettuare dalla 9 settimana di gravidanza 37

38 Two Sources of Fetal DNA in Maternal Blood Fetal cells 1 in a billion of total cell population Require isolation via mechanical and/or biochemical means Cell-free DNA (cfdna) Maternal blood contains both maternal and fetal cfdna 2 20% of total cfdna is fetal.

39 Fetal Cell-free DNA in Maternal Blood A Reliable Analyte During Pregnancy Released through apoptosis Fetal cfdna likely arises from cytotrophoblastic cells of placenta Released into bloodstream as small DNA fragments ( bp) Reliably detected after 7+ weeks gestation Undetectable within hours postpartum.

40 DNA Sequencing using cell free DNA Fetal DNA fragments in maternal blood. Cell free DNA fragments are then sequenced. Compare the individual sequenced chromosomes against a reference for analysis..

41 Detection of Fetal Aneuploidy MPS Enables Precise Molecular Counting Fetal cfdna (20%) Maternal cfdna NOT TO SCALE 10% more Chr21 cfdna in T21 Counting VS Chromosomes: Trisomy Verinata. Content is proprietary and confidential.

42 Accuratezza del calcolo cfdna fetale cfdna Materno Cromosoma reference Cromosoma trisomico Frazione fetale ratio attesa per la trisomia 4% % % %

43 Evidenze per la NIPT Aneuploidie Sensibilità FPR Sindrome di Down % ~0.1% Trisomy % ~0.1% Trisomy % ~0.1% Benn et al, Ultras Obstet Gynceol 2013, 42: 15-33

44 Il PPV scende molto quando il test si applica su gravidanze a rischio basso N Engl J Med 2013: 369;6 44

45 NIPT Indicazioni Età materna avanzata Aumento del rischio da test biochimici controindicazioni Anomalie fetali Gravidanza multipla Ansia da test invasivi Anomalie note non rilevabili con la NIPT

46 NIPT : conclusioni La NIPT è una tecnologia molto promettente ed ha il potenziale di offrire un test precoce e non invasivo. La NIPT non dovrebbe essere in questo momento il primo test da effettuare per lo screening per le trisomie 21, 13, 18 dato che la sua validità ed utilità clinica non sono ancora state dimostrate per le gravidanze non a particolare rischio. Attualmente la NIPT è un test di screening visto che deve essere sempre confermato da un test invasivo. Ulteriori studi sono necessari affichè la NIPT diventi un test diagnostico. 46

47 47

48 Grazie per l attenzione 48

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it

Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica. Corrado Romano cromano@oasi.en.it Il Ruolo della Genetica Clinica in Genomica e Sanità Pubblica Corrado Romano cromano@oasi.en.it Genetica Clinica secondo Wikipedia La genetica clinica o medica si occupa dello studio e della diagnosi delle

Dettagli

Diagnosi delle aneuploidie

Diagnosi delle aneuploidie Diagnosi delle aneuploidie DIAGNOSI PRENATALE NON INVASIVA: UNA RIVOLUZIONE La diagnosi prenatale delle malattie monogeniche e delle aneuploidie Bologna, è attualmente 6 Giugno eseguita2014 nel I-II trimestre

Dettagli

Diagnosi prenatale di aneuploidie fetali da DNA fetale circolante nel plasma materno

Diagnosi prenatale di aneuploidie fetali da DNA fetale circolante nel plasma materno Diagnosi prenatale di aneuploidie fetali da DNA fetale circolante nel plasma materno Francesca Torricelli SOD Diagnostica Genetica AOU- Careggi Firenze torricellif@aou-careggi.toscana.it Pievesestina,

Dettagli

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare!

Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale. Dalla citogenetica convenzionale alla citogenetica molecolare! Array-CGH(Comparative Genomic Hybridisation) e diagnosi prenatale Dalla citogenetica convenzionale alla citogenetica molecolare! CARIOTIPO STANDARD Identifica anomalie strutturali bilanciate e sbilanciate

Dettagli

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI

TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI TEST DEL DNA FETALE PRIVO DI RISCHI PER RILEVARE LA SINDROME DI DOWN E LE ANOMALIE CROMOSOMICHE PIÙ COMUNI SICURO: Eseguito su un semplice prelievo di sangue materno COMPLETO: Trisomia 21 (Sindrome di

Dettagli

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene eseguita su cellule

Dettagli

ANALISI GENETICHE. Biologia molecolare

ANALISI GENETICHE. Biologia molecolare ANALISI GENETICHE Biologia molecolare Via F. Ferrer 25/27-21052 Busto Arsizio (VA) - Italy Tel +39 0331 652911 - Fax +39 0331 652919 - www.tomalab.com TOMA_biologia_molecolare_scheda_CORR03.indd 1 06/04/2012

Dettagli

Chiedi al tuo medico

Chiedi al tuo medico Esame del sangue semplice e sicuro per risultati altamente sensibili Test avanzato e non invasivo per la diagnosi della trisomia fetale e del cromosoma Y Chiedi al tuo medico Le seguenti informazioni hanno

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI

INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI INFORMATIVA E CONSENSO INFORMATO ALLA DIAGNOSI CITOGENETICA PRENATALE MOLECOLARE (ARRAY-CGH) SU CELLULE DEL LIQUIDO AMNIOTICO O VILLI CORIALI A. Finalità L indagine citogenetica fetale (o cariotipo) viene

Dettagli

NPTT- NON-INVASIVE PRENATAL TESTING

NPTT- NON-INVASIVE PRENATAL TESTING Dr.ssa Chiara Boschetto NPTT- NON-INVASIVE PRENATAL TESTING Il TEST PRENATALE NON INVASIVO è un test molecolare nato con l obiettivo di determinare l assetto cromosomico del feto da materiale fetale presente

Dettagli

Documento di indirizzo sull impiego di indagini prenatali non invasive

Documento di indirizzo sull impiego di indagini prenatali non invasive Documento di indirizzo sull impiego di indagini prenatali non invasive Premessa La diagnosi prenatale delle malattie monogeniche e delle aneuploidie è attualmente eseguita nel I-II trimestre di gravidanza

Dettagli

L'uso di SNP- array in diagnosi prenatale. Vanna Pecile IRCCS Burlo Garofolo Trieste

L'uso di SNP- array in diagnosi prenatale. Vanna Pecile IRCCS Burlo Garofolo Trieste L'uso di SNP- array in diagnosi prenatale Vanna Pecile IRCCS Burlo Garofolo Trieste Il cariotipo è in grado di evidenziare anomalie cromosomiche nel 8 35% di feti con malformazioni ecoevidenziate [Faas

Dettagli

FINALITA : evidenziare la. cromosomiche fetali.

FINALITA : evidenziare la. cromosomiche fetali. Il Cariotipo Fetale Molecolare l (array-cgh) Il Cariotipo Fetale e TRADIZIONALE FINALITA : evidenziare la presenza di eventuali anomalie cromosomiche fetali. TECNICA: comporta la coltura delle cellule

Dettagli

INFORMAZIONI SUL TEST

INFORMAZIONI SUL TEST QUALITY OF SCIENCE INFORMAZIONI SULLA SOCIETÀ INFORMAZIONI SUL TEST Sequenom Laboratories, una consociata interamente controllata di Sequenom, Inc., è un laboratorio di diagnostica molecolare riconosciuto

Dettagli

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali

CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali CATCH 22 e altre indagini genetiche nel counseling dopo diagnosi di malformazioni fetali Milano Marittima 05/06/2010 Dr. Francesco Pigliapoco Lab. Citogenetica A.O.U.-Salesi- Ancona Le sindromi DiGeorge

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica SEZIONE DI CITOGENETICA E GENETICA MOLECOLARE DIAGNOSI PRENATALE DIAGNOSI MOLECOLARE PRE E POSTNATALE DI MALATTIE GENETICHE DIAGNOSTICA GENETICA DELLA INFERTILITA

Dettagli

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI

Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Dr. med. Lucio Bronz FMH Ostretricia e medicina feto-materno Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Introduzione Cromosoma Cellula Nucleo Ormai a tutti è noto il ruolo del

Dettagli

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo

A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo 2 Convegno Nazionale Sindrome di Rubinstein Taybi Lodi, 17 19 maggio 2013 A cosa serve al clinico e alla famiglia conoscere il difetto di base? Correlazione genotipo fenotipo Donatella Milani Cristina

Dettagli

LA NUOVA GENERAZIONE DELLO SCREENING PRENATALE NON INVASIVO SU DNA FETALE

LA NUOVA GENERAZIONE DELLO SCREENING PRENATALE NON INVASIVO SU DNA FETALE LA NUOVA GENERAZIONE DELLO SCREENING PRENATALE NON INVASIVO SU DNA FETALE Tecnologia SNP assay per l analisi diretta del DNA fetale per le principali aneuploidie cromosomiche Strettamente confidenziale

Dettagli

La consulenza alla paziente che richiede l analisi del DNA fetale

La consulenza alla paziente che richiede l analisi del DNA fetale La consulenza alla paziente che richiede l analisi del DNA fetale Bertinoro, 19 Ottobre 2013 Eva Pompilii eva_pompilii@yahoo.it Limiti attuali del Non invasive Prenatal Testing/ Non Invasive Prenatal

Dettagli

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI

DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIAGNOSI PRENATALE DEI DIFETTI CONGENITI DIFETTI CONGENITI Le anomalie congenite sono condizioni che si instaurano tra il momento del concepimento e la nascita. LA DIAGNOSI PRENATALE insieme di tecniche

Dettagli

Lo studio prenatale dei cromosomi fetali:

Lo studio prenatale dei cromosomi fetali: Laboratorio di Genetica Medica Lo studio prenatale dei cromosomi fetali: esame citogenetico standard vs array Bologna, 06 Giugno 2014 Giorgio Lucci La citogenetica classica Inizio della citogenetica umana

Dettagli

Diagnosi invasiva delle anomalie fetali: dall amniocentesi alla villocentesi

Diagnosi invasiva delle anomalie fetali: dall amniocentesi alla villocentesi Diagnosi invasiva delle anomalie fetali: dall amniocentesi alla villocentesi Gianluigi Pilu Clinica Ginecologica e Ostetrica, Università di Bologna GynePro Medical Centers Bologna, Italy Amniocentesi e

Dettagli

Dr. med. Lucio Bronz FMH Ostetricia e medicina feto-materna Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI

Dr. med. Lucio Bronz FMH Ostetricia e medicina feto-materna Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Dr. med. Lucio Bronz FMH Ostetricia e medicina feto-materna Piazza Indipendenza 4 6500 Bellinzona www.drbronz.ch TEST PRENATALI Sommario Introduzione Informazioni minime sulla genetica e sulla possibilità

Dettagli

www.analisicimatti.it

www.analisicimatti.it Il Laboratorio Cimatti da sempre attento alla innovazione tecnologica e allo sviluppo di Eccellenze nella diagnostica prenatale è partner di Bioscience Genomics, uno spin off accademico partecipato dall

Dettagli

Unità Operativa di GENETICA MEDICA. Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara. Prestazioni richieste

Unità Operativa di GENETICA MEDICA. Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara. Prestazioni richieste Unità Operativa di GENETICA MEDICA Azienda Ospedaliera Universitaria S.Anna AOSPFE, Ferrara Direttore: Prof.ssa Alessandra Ferlini www.ospfe.it/geneticamedica LABORATORIO DI GENETICA MOLECOLARE Responsabile:

Dettagli

Next Generation Sequencing nelle malattie non emopatiche

Next Generation Sequencing nelle malattie non emopatiche Next Generation Sequencing nelle malattie non emopatiche Vilma Mantovani 1,2 & Tommaso Pipucci 2 1 Centro Ricerca Biomedica Applicata - CRBA 2 U.O. Genetica Medica Bologna, 11 maggio 2012 Gene discovery

Dettagli

Quale metodica scegliere?

Quale metodica scegliere? Quale metodica scegliere? Aggiornamenti in ostetricia Screening prenatali: aspetti pratici e limiti Padova, 13 Aprile 2015 Tamara Stampalija Unità Dipartimentale di Diagnosi Prenatale ed Ecografia IRCCS

Dettagli

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre

il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre il progresso dello spirito umano consiste, o certo ha consistito finora, non nell imparare ma nel disimparare principalmente, nel conoscere sempre più di non conoscere, nell avvedersi di saper sempre meno,

Dettagli

CORSO INTEGRATO DI GENETICA AA 2011/12. Prof Alberto Turco. Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO

CORSO INTEGRATO DI GENETICA AA 2011/12. Prof Alberto Turco. Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO CORSO INTEGRATO DI GENETICA AA 2011/12 Prof Alberto Turco Giovedi 27.10.11 Lezioni 21 e 22 DIAGNOSI PRENATALE DIAGNOSI PREIMPIANTO Definizione DPN Peculiarità - Non è richiesta dall interessato - Non correlazione

Dettagli

Oggetto: presentazione progetto di ricerca anno 2010

Oggetto: presentazione progetto di ricerca anno 2010 Associazione Un Vero Sorriso Onlus via Morghen, 5 10143 Torino Torino, 01/10/2010 Oggetto: presentazione progetto di ricerca anno 2010 Titolo: Nuovi approcci per l identificazione di mutazioni rare in

Dettagli

ELENCO DELLE INDAGINI ESEGUIBILI

ELENCO DELLE INDAGINI ESEGUIBILI Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE n. nome TEST GENETICO metodo giorni TIPOLOGIA CAMPIONE 1 Acondroplasia

Dettagli

INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI

INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI INFORMAZIONI SULLE PRESTAZIONI AMBULATORIALI CONSULENZA GENETICA La consulenza genetica è un processo medico-clinico che ha lo scopo di definire il percorso diagnostico in caso di sospetto di malattia

Dettagli

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS

MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS MUTATION DETECTION DIRECT SEQUENCING OF DNA FRAGMENTS DIRECT SEQUENCING TTCACTGAGAGTCGC TCCCAATAAAAGTGACTCTCAGCGAGC TTCACTGAGAGTCGG TCCCAATAAAAGTGACTCTCAGCCAGC wt mut wt wt/mut mut The Sanger method 07_01.jpg

Dettagli

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE

CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE CORSO INTEGRATO DI GENETICA E BIOLOGIA MOLECOLARE AA2013/14 Prof Alberto Turco Lezioni 57 e 58 11.12.2013 Test Genetici Storiche date. 1865 1859 1953.momenti memorabili dell impresa intellettuale e scientifica

Dettagli

Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE

Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE Diagnosi di Genetica Molecolare Referente di Settore: Dr Alessandro De Luca PATOLOGIA TEST GENETICO POSTNATALE TEMPI DI REFERTAZIONE TIPOLOGIA CAMPIONE n. nome TEST GENETICO metodo giorni 1 Acondroplasia

Dettagli

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo

Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING. dott.ssa Alessandra Cuccurullo Seminari di Specialità di Genetica Medica 22 novembre 2011 EXOME SEQUENCING dott.ssa Alessandra Cuccurullo EXOME SEQUENCING Anche noto come targeted exome capture. Strategia per sequenziare selettivamente

Dettagli

DAI TEST GENETICI AL RISCHIO DI MALATTIA

DAI TEST GENETICI AL RISCHIO DI MALATTIA DAI TEST GENETICI AL RISCHIO DI MALATTIA Conosciamo il nostro Genoma Varese, 20 aprile 2013 Elisabetta Lenzini LE TAPPE DELLA 1953 Watson and Crick Struttura del DNA 1956 Tijo e Levan Cariotipo 46 cr 1959

Dettagli

TARIFFARIO PRESTAZIONI LABORATORIO DI GENETICA MOLECOLARE, SEZIONE DI PSICOLOGIA CLINICA SANITARIA, DELLE ORGANIZZAZIONI E DEL BENESSERE

TARIFFARIO PRESTAZIONI LABORATORIO DI GENETICA MOLECOLARE, SEZIONE DI PSICOLOGIA CLINICA SANITARIA, DELLE ORGANIZZAZIONI E DEL BENESSERE TARIFFARIO PRESTAZIONI LABORATORIO DI GENETICA MOLECOLARE, SEZIONE DI PSICOLOGIA CLINICA SANITARIA, DELLE ORGANIZZAZIONI E DEL BENESSERE PRESTAZIONE IMPONIBILE IVA TOTALE Consulenza genetica 50,00 0,00

Dettagli

Gene Mutations and Disease

Gene Mutations and Disease Gene Mutations and Disease Mutazioni somatiche: Nuove mutazioni che insorgono casualmente nelle cellule somatiche o nella linea germinale di singoli individui. Le mutazioni germinali possono essere trasmesse

Dettagli

L analisi del DNA fetale libero da sangue materno

L analisi del DNA fetale libero da sangue materno L analisi del DNA fetale libero da sangue materno Cos è PrenatalSafe Esame prenatale non invasivo (NIPT) che, analizzando il DNA fetale libero circolante isolato da un campione di sangue materno, valuta

Dettagli

5 modulo didattico - Patologia cromosomica.

5 modulo didattico - Patologia cromosomica. 5 modulo didattico - Patologia cromosomica. G0 IL CICLO CELLULARE DI UNA CELLULA DI MAMMIFERO Avviene ogni volta che la cellula si divide Le tappe fondamentali del processo sono: Separazione dei due filamenti

Dettagli

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI

DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI DIAGNOSI PRENATALE GUIDA INFORMATIVA DNA, GENI E CROMOSOMI Ogni individuo possiede un proprio patrimonio genetico che lo rende unico e diverso da tutti gli altri. Il patrimonio genetico è costituito da

Dettagli

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma

Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Ereditarietà delle PSE e counselling genetico Dr.ssa Gabriella Silvestri Istituto di Neurologia, UCSC, Fondazione Policlinico A. Gemelli Roma Dr.ssa Marcella Masciullo IRCSS Santa Lucia, Roma Paraparesi

Dettagli

Prevenzione. Diagnosi prenatale. La consapevolezza di un accoglienza d amore

Prevenzione. Diagnosi prenatale. La consapevolezza di un accoglienza d amore Prevenzione Diagnosi prenatale La consapevolezza di un accoglienza d amore Bios International Holding La capillare rete di strutture di Bios International opera da anni nel campo della diagnostica con

Dettagli

31 Marzo 2014 NIPT. DNA fetale nel plasma materno: dai trial alla clinica. Un anno di esperienza italiana. Dr.ssa Marianna Andreani

31 Marzo 2014 NIPT. DNA fetale nel plasma materno: dai trial alla clinica. Un anno di esperienza italiana. Dr.ssa Marianna Andreani NIPT DNA fetale nel plasma materno: dai trial alla clinica 31 Marzo 2014 Un anno di esperienza italiana Dr.ssa Marianna Andreani L inizio 2 20 marzo 2013 disponibilità del test in Italia presso CAM 20

Dettagli

Referto Analisi : PrenatalSAFE KARYO - Screening prenatale non invasivo di aneuploidie ed alterazioni cromosomiche strutturali fetali

Referto Analisi : PrenatalSAFE KARYO - Screening prenatale non invasivo di aneuploidie ed alterazioni cromosomiche strutturali fetali Referto Analisi : PrenatalSAFE KARYO - Screening prenatale non invasivo di aneuploidie ed alterazioni cromosomiche strutturali fetali Data Referto:14/01/2016 Ora:17:13 Anagrafica Laboratorio / Medico Centro

Dettagli

Pagina 1 di 10. PrenatalSAFE Karyo: anomalie cromosomiche fetali evidenziabili

Pagina 1 di 10. PrenatalSAFE Karyo: anomalie cromosomiche fetali evidenziabili Cos è PrenatalSAFE Karyo? PrenatalSAFE Karyo è un esame prenatale non invasivo che, analizzando il DNA fetale libero circolante isolato da un campione di sangue materno, rileva aneuploidie e alterazioni

Dettagli

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott.

Portatore Malattia genetica.mutazione. La sottoscritta...nata a.il. Portatrice Malattia genetica Mutazione. PREMESSO. con il/la Dott. CONSENSO INFORMATO PER DIAGNOSI GENETICA PRE-IMPIANTO (PGD)* PER MALATTIE GENETICHE EREDITARIE O ALTERAZIONI CROMOSOMICHE NUMERICHE E/O STRUTTURALI SBILANCIATE. *(Preimplantation Genetic Diagnosis) Ai

Dettagli

RUOLO DEL TEST BIOCHIMICO NELL ERA DEL NIPT Dott. E. Troilo GynePro Medical Group Bologna www.gynepro.it Test di screening a cosa servono come si fanno che rischi comportano testi di screening: quale???

Dettagli

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico

Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Il valore dell analisi prenatale non invasiva (non-invasive prenatal testing, NIPT). Un supplemento per il flipbook del consulente genetico Le NIPT utilizzano DNA libero. Campione di sangue materno DNA

Dettagli

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA

Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Alessandra Ferlini Marcella Neri CONSULENZA GENETICA Ad integrazione delle lezioni e del testo di studio Genetica Umana e Medica Neri- Genuardi 3a edizione 2014 Masson (www.mediquiz.it) GENETICA MEDICA

Dettagli

A IFE F G 16 1-17 1 7 O

A IFE F G 16 1-17 1 7 O Colorectal Cancer in a young patient with Partial Androgen Insensitivity Syndrome (PAIS) Stefano Signoroni Unit of Hereditary Digestive Tract Tumours, Department of Preventive and Predictive Medicine,

Dettagli

Diagnosi prenatale invasiva: presente e futuro

Diagnosi prenatale invasiva: presente e futuro Diagnosi prenatale invasiva: presente e futuro Gianluigi Pilu GynePro Medical Group Bologna, Italy www.gynepro.it Sintesi Frequenza delle anomalie cromosomiche I rischi delle diagnosi invasive Diagnosi

Dettagli

GENI E TEST GENETICI: DAL LABORATORIO ALLA PRATICA CLINICA

GENI E TEST GENETICI: DAL LABORATORIO ALLA PRATICA CLINICA PROGRAMMA CORSO ECM 2015 SCUOLA MEDICA OSPEDALIERA OSPEDALE S.SPIRITO IN SAXIA IN ROMA (richiesto il PATROCINIO SIGU) Responsabili scientifici: Guglielmo Sabbadini, Mariano S. Pergola Comitato Scientifico:

Dettagli

GENETICA DEL TUMORE DEL COLON-RETTO

GENETICA DEL TUMORE DEL COLON-RETTO GENETICA DEL TUMORE DEL COLON-RETTO EPIDEMIOLOGIA In tutto l'occidente, il cancro del colon-retto occupa, per incidenza, il secondo posto tra i tumori maligni, preceduto dal tumore al polmone nell'uomo

Dettagli

Tranquility. Il più Accurato Test Prenatale Non Invasivo per le Trisomie Evita l amniocentesi quando non è necessario

Tranquility. Il più Accurato Test Prenatale Non Invasivo per le Trisomie Evita l amniocentesi quando non è necessario Tranquility Il più Accurato Test Prenatale Non Invasivo per le Trisomie Evita l amniocentesi quando non è necessario Un test del sangue semplice, sicuro e sensibile, dalle elevate performance predittive

Dettagli

PraenaTest. Esame non invasivo delle trisomie nel feto. Qualità dall Europa ORA NUOVO. Brochure informativa per gestanti

PraenaTest. Esame non invasivo delle trisomie nel feto. Qualità dall Europa ORA NUOVO. Brochure informativa per gestanti ORA NUOVO PraenaTest express Esito in 1 settimana PraenaTest Qualità dall Europa Esame non invasivo delle trisomie nel feto Brochure informativa per gestanti Care gestanti, Tutti i futuri genitori si chiedono

Dettagli

ALTERAZIONI CROMOSOMICHE STRUTTURALI

ALTERAZIONI CROMOSOMICHE STRUTTURALI Cos è PrenatalSAFE? PrenatalSAFE è un esame prenatale non invasivo che, analizzando il DNA fetale libero circolante isolato da un campione di sangue materno, valuta la presenza di aneuploidie fetali comuni

Dettagli

DNA fetale nel sangue materno. Applicazioni e Prospettive

DNA fetale nel sangue materno. Applicazioni e Prospettive DNA fetale nel sangue materno. Applicazioni e Prospettive Sandro Gabrielli Clinica Ostetrica e Medicina Prenatale Policlinico S.Orsola-Malpighi, Bologna sandro.gabrielli@aosp.bo.it PATOLOGIA Natera Verinata

Dettagli

AZIENDA OSPEDALIERA ISTITUTI OSPITALIERI DI CREMONA Presidio Ospedaliero di Cremona Dipartimento Laboratorio

AZIENDA OSPEDALIERA ISTITUTI OSPITALIERI DI CREMONA Presidio Ospedaliero di Cremona Dipartimento Laboratorio AZIENDA OSPEDALIERA ISTITUTI OSPITALIERI DI CREMONA Presidio Ospedaliero di Cremona Dipartimento Laboratorio Unità Operativa di GENETICA DI COSA CI OCCUPIAMO L attività di Genetica Medica presso l ospedale

Dettagli

Genetica, malattie rare e contesto familiare

Genetica, malattie rare e contesto familiare XXV Anniversario IRCCS E. Medea La salute del bambino tra genetica e neuroscienze Bosisio Parini, 11 dicembre 2010 Genetica, malattie rare e contesto familiare La genetica negli ultimi 25 anni Sequenziamento

Dettagli

DNA fetale su sangue materno

DNA fetale su sangue materno DNA fetale su sangue materno Sabrina Frusconi SOD Diagnostica Genetica AOU Careggi Firenze frusconis@aou-careggi.toscana.it DNA fetale su sangue materno Determinazione non invasiva del sesso genetico fetale

Dettagli

CGH-array in PGD. dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd

CGH-array in PGD. dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd an innovative diagnostic company dddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd CGH-array in PGD Padova, 18-19 gennaio 2016 Pre-implantation Genetic Diagnosis (PGD) e Non Invasive Prenatal

Dettagli

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali:

L informazione ottenuta dal test genetico può apportare notevoli benefici, quali: INFORMATIVA E CONSENSO INFORMATO ALL ESAME BREASTSCREEN Il test BreastScreen BreastScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie

TEST GENETICI INDIRETTI. per la diagnosi di patologie genetiche ereditarie TEST GENETICI INDIRETTI per la diagnosi di patologie genetiche ereditarie Diagnosi molecolare indiretta Quando non è nota la mutazione malattia, la diagnosi molecolare di quella malattia in una data famiglia

Dettagli

Il test combinato del primo trimestre:

Il test combinato del primo trimestre: CORSO DI ECOGRAFIA CLINICA: SCREENING DEL I TRIMESTRE e SCREENING GINECOLOGICO PRECHIRURGICO Il test combinato del primo trimestre: interpretazione e gestione del referto A.Visentin M.Segata Azienda USL

Dettagli

La prevenzione: un piano regionale per la Puglia. Perché?

La prevenzione: un piano regionale per la Puglia. Perché? La prevenzione: un piano regionale per la Puglia. Perché? Rita Fischetto Referente Genetica Clinica U.O.C. Malattie Metaboliche Diabetologia A.O.U. Policlinico-Giovanni XXIII Bari -CRESCITA CONOSCENZE

Dettagli

La rete dei centri di genetica e il futuro della medicina

La rete dei centri di genetica e il futuro della medicina La rete dei centri di genetica e il futuro della medicina Rosario Casalone,, MD, PhD SSD Genetica Dipartimento Materno Infantile Azienda Ospedaliera-Polo Universitario Ospedale di Circolo e Fondazione

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN

INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN INFORMATIVA E CONSENSO INFORMATO ALL ESAME COLONSCREEN Il test ColonScreen ColonScreen è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi genetica multipla per valutare

Dettagli

La Diagnosi Genetica Preimpianto

La Diagnosi Genetica Preimpianto CRA Centro Riproduzione Assistita - Catania www.cragroup.it 19-20-21 Giugno 2012 La Diagnosi Genetica Preimpianto Dott.ssa Raffaella Cavallaro Cos è la PGD? È una procedura ormai collaudata utilizzata

Dettagli

La Citogenetica nella Diagnosi Prenatale

La Citogenetica nella Diagnosi Prenatale La Citogenetica nella Diagnosi Prenatale Per diagnosi prenatale si intende l insieme delle indagini strumentali e di laboratorio finalizzate ad individuare determinate patologie su base : genetica infettiva

Dettagli

Ottimizzazione e validazione di un test di screening per la diagnosi prenatale non invasiva delle aneuploidie cromosomiche

Ottimizzazione e validazione di un test di screening per la diagnosi prenatale non invasiva delle aneuploidie cromosomiche Ottimizzazione e validazione di un test di screening per la diagnosi prenatale non invasiva delle aneuploidie cromosomiche Proponente: dr.ssa F. Torricelli AOU Careggi INDICE 1) INTRODUZIONE pag. 1 1.1

Dettagli

Lodi 17 maggio 2013 Gli aspetti relativi alla consulenza prenatale

Lodi 17 maggio 2013 Gli aspetti relativi alla consulenza prenatale Lodi 17 maggio 2013 Gli aspetti relativi alla consulenza prenatale Faustina Lalatta Medico genetista Responsabile UOD Genetica Medica Dipartimento area salute della donna, del bambino e del neonato Direttore

Dettagli

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni

-riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni L array-cgh: -riesce a identificare riarrangiamenti cromosomici sbilanciati, ovvero delezioni o duplicazioni -ha un potere si risoluzione 100 volte superiore al cariotipo (100 Kb versus 10 Mb) Microarray-based

Dettagli

L interpretazione e la gestione del test

L interpretazione e la gestione del test LO SCREENING DEL I TRIMESTRE : TECNICHE, RUOLI E PROSPETTIVE Imola 14 Settembre 2013 L interpretazione e la gestione del test combinato del I trimestre : come e chi? A.Visentin Azienda USL di Bologna U.O.

Dettagli

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING

INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING INFORMATIVA E CONSENSO INFORMATO ALL ESAME ONCOSCREENING Il test OncoScreening OncoScreening è un test diagnostico, sviluppato da GENOMA Group, che permette di eseguire un analisi multipla per valutare

Dettagli

Il Cancro è una malattia genetica

Il Cancro è una malattia genetica Il Cancro è una malattia genetica PROCESSO MULTIFASICO Il Cancro è sempre genetico Talvolta il cancro è ereditario Ciò che viene ereditato non è la malattia, bensì la PREDISPOSIZIONE In assenza di ulteriori

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica molecolare Responsabile: Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni per la diagnosi molecolare di sordita

Dettagli

Tranquility. Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie

Tranquility. Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie Tranquility Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie Test del DNA fetale sicuro e altamente sensibile Eseguito sul sangue materno tramite

Dettagli

Pagina 1 di 9. Il test PrenatalSAFE 3 valuta le aneuploidie dei cromosomi 21, 18, 13, e comprende la determinazione del sesso fetale (opzionale).

Pagina 1 di 9. Il test PrenatalSAFE 3 valuta le aneuploidie dei cromosomi 21, 18, 13, e comprende la determinazione del sesso fetale (opzionale). INFORMATIVA E CONSENSO INFORMATO AL TEST DI SCREENING PRENATALE NON INVASIVO DELLE ANEUPLOIDIE CROMOSOMICHE FETALI MEDIANTE ANALISI DEL DNA FETALE DAL SANGUE MATERNO Finalità del test PrenatalSAFE PrenatalSAFE

Dettagli

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA

a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA CORSO INTEGRATO di Genetica e Biologia Molecolare GENETICA a.a. 2012-2013 31/10/2012 Lezioni 25 e 26 I polimorfismi del DNA Dott.ssa Elisabetta Trabetti POLIMORFISMO La presenza nella popolazione di due

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica Caratterizzazione molecolare delle Distrofie Muscolari di Duchenne (DMD) e di Becker (BMD): diagnosi di malattia e studi familari L Proda esegue le indagini molecolari per le Distrofie muscolari di Duchenne

Dettagli

Sequenziamento del DNA: strutture dei nucleotidi

Sequenziamento del DNA: strutture dei nucleotidi Sequenziamento del DNA: strutture dei nucleotidi il metodo di Sanger 2-3 DIDEOSSINUCLEOTIDI Il contenuto di ciascuna provetta viene caricato in 4 pozzetti separati di un gel di poliacrilammide * Indica

Dettagli

Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO

Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO Struttura Semplice Dipartimentale GENETICA MEDICA - OSPEDALE SAN BASSIANO PRESENTAZIONE DELLA STRUTTURA La Struttura Semplice Dipartimentale di genetica medica fa parte del Dipartimento di Medicina dei

Dettagli

Bioinformatica (modulo bioinf. dei genomi moderni )

Bioinformatica (modulo bioinf. dei genomi moderni ) Bioinformatica (modulo bioinf. dei genomi moderni ) Dr. Marco Fondi Lezione # 5 Corso di Laurea in Scienze Biologiche, AA 2011-2012 giovedì 3 novembre 2011 1 Sequenziamento ed analisi di genomi: la genomica

Dettagli

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136)

ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) ATASSIA SPINOCEREBELLARE 17 (SCA17) (OMIM #607136) Il gene implicato nella SCA17 è il gene TATA box-binding protein (TBP) che fa parte del complesso della RNA polimerasi II ed è essenziale per dare inizio

Dettagli

Dissezione del fenotipo

Dissezione del fenotipo Clinica molecolare (molecular medicine):come utilizzare le informazioni del genoma per studiare le patologie genetiche Clinica molecolare Nuova branca della medicina che nasce 2.400 anni fa con Democrito

Dettagli

Tranquility. Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie

Tranquility. Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie Tranquility Il più accurato test prenatale non invasivo per le trisomie fetali Evita le amniocentesi non necessarie Test del DNA fetale sicuro e altamente sensibile Eseguito sul sangue materno tramite

Dettagli

GENETICA MEDICA. Analisi genetiche per oltre 400 geni testabili vengono inviati a strutture pubbliche esterne, ospedaliere e universitarie.

GENETICA MEDICA. Analisi genetiche per oltre 400 geni testabili vengono inviati a strutture pubbliche esterne, ospedaliere e universitarie. GENETICA MEDICA PRESENTAZIONE DELLA STRUTTURA L ambulatorio di Genetica Medica fa parte del Dipartimento Materno Infantile. Essa collabora ed interagisce strettamente con le Strutture del Dipartimento

Dettagli

Censimento 2002 Strutture di Genetica Medica in Italia

Censimento 2002 Strutture di Genetica Medica in Italia Censimento 2002 Strutture di Genetica Medica in Italia A cura di: Bruno Dallapiccola, Isabella Torrente, Arnaldo Morena Istituto CSS-Mendel, Roma Con la collaborazione di Errepi Comunicazione, Roma OBIETTIVI

Dettagli

CATCH 22 altre indagini genetiche nel counceling dopo diagnosi di malformazioni fetali. Silvia Sansavini

CATCH 22 altre indagini genetiche nel counceling dopo diagnosi di malformazioni fetali. Silvia Sansavini CATCH 22 altre indagini genetiche nel counceling dopo diagnosi di malformazioni fetali Silvia Sansavini CATCH 22 FIBROSI CISTICA DISTROFIA MIOTONICA CATCH 22: microdelezione 22q11 Diagnosi Counceling Diagnosi

Dettagli

Profilo aziendale. Prodotti e servizi per il mercato italiano

Profilo aziendale. Prodotti e servizi per il mercato italiano Profilo aziendale La ATLAS Biolabs GmbH è fornitore leader di servizi di genomica su microarray, quali espressione genica sull intero genoma e analisi degli SNP, analisi CGH e servizi diagnostici per dottori

Dettagli

IL TEST COMBINATO: caratteristiche e impiego clinico. L. Sgarbi

IL TEST COMBINATO: caratteristiche e impiego clinico. L. Sgarbi IL TEST COMBINATO: caratteristiche e impiego clinico L. Sgarbi STUDIO DEI DIFETTI CROMOSOMICI NEL 1 TRIMESTRE DIAGNOSI CARIOTIPIZZAZIONE VILLOCENTESI, AMNIOCENTESI (TEST INVASIVI) ETA materna; SCREENING

Dettagli

Censimento 2004 Strutture di Genetica Medica in Italia

Censimento 2004 Strutture di Genetica Medica in Italia Censimento 2004 Strutture di Genetica Medica in Italia A cura di: Bruno Dallapiccola, Isabella Torrente, Arnaldo Morena, Rita Mingarelli Istituto CSS-Mendel, Roma con la collaborazione di Errepi Comunicazione,

Dettagli

Mutation screening mediante PCR

Mutation screening mediante PCR Mutation screening mediante PCR Denaturing High-Perfomance Liquid Chromatography (DHPLC) E una tecnica di analisi cromatografica ad alta pressione che consente di discriminare tra homoduplex ed heteroduplex

Dettagli

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica

Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla clinica Corso postcongressuale XV congresso SIGU Come refertare e comunicare varianti genomiche Tavola rotonda: La consulenza genetica come strumento fondamentale nel trasferimento delle nuove conoscenze alla

Dettagli

PRODA Istituto di Diagnostica Clinica

PRODA Istituto di Diagnostica Clinica PRODA Istituto di Diagnostica Clinica Sezione di Citogenetica e Genetica Molecolare Responsabile Dott. Guglielmo Sabbadini Specialista in Genetica Medica Informazioni sull analisi genetica per fibrosi

Dettagli