Gene number 19,000 30,000

Save this PDF as:

Dimensione: px
Iniziare la visualizzazioe della pagina:

Download "Gene number 19,000 30,000"


1 Gene number ,000 13,500 30,000 30,000


3 MODULI: Nucleotidi (4) Amino acidi (21) Domini proteici/proteine (Domini di interazione proteina-proteina Proteina/DNA o Proteina /RNA Interazione con membrana Funzione enzimatica) RNA (funzione strutturale/enzimatica) Via metabolica ossidazione/riduzione

4 Gene number ,000 13,500 30,000 Numero di moduli e simile 30,000


6 La regolazione dell espressione genica Geni housekeeping che devono essere espressi in tutti i tipi cellulari sempre allo stesso livello (es. Fattori di trascrizione generali o GTFs, DNA erna polimerasi, actina, istoni.) Geni specializzati/tessuto-specifici specifici di un certo stadio disviluppo embrionale (es. Recettori di membrana, Immunoglobuline, enzimispecifici) Geni inducibili, tessuto-specifici o meno (es. Fattori di trascrizione, enzimi, mediatori dell infiammazione, ormoni)

7 Attivazione/inattivazione dell espressione genica Procarioti: risposte cellulari all ambiente esterno Eucarioti: Decisioni cellulari durante lo sviluppo -> differenziamento Regolazione del ciclo cellulare Attivazione cellulare in risposta a mediatori esterni quali fattori di crescita, ormoni etc. (reversibile, rapida)

8 La regolazione dell espressione genica avviene a numerosi livelli:

9 Negli eucarioti superiori i geni inattivi da un punto di vista trascrizionale hanno una struttura cromatinica meno accessibile BamHI 4,6 kb BamHI BamHI 4,6 kb BamHI Globina Globina DNAseI Eritroblasto DNAseI Isolamento dei nuclei e digestione con quantità crescente di DnasiI. Estrazione DNA, digestione con BamHI, Southern Blot ed ibridazione con globina MBS DNA Eritroblasto MBS 0 0,01 0,05 0,1 0,5 1 1,5 1,5 DnaseI (µg/ml) 4,6kb Geni attivi da un punto trascrizionale sono più suscettibili di quelli inattivi alla digestione con DNAsiI Sono in una conformazione cromatinica particolare che li rende più accessibili a DNAsiI

10 Pre-attivazione (Induzione di uno stato trascrizionalmente competente) Inizio/re-inizio della trascrizione Fattori di trascrizione legati a specifici promotori/enhancers Co-attivatori (acetilasi degli istoni,attivita che rimodellano la cromatina) Fattori generali di trascrizione (GTFs)e RNA polimerasi Allungamento del trascritto Terminazione del trascritto


12 CROMATINA EUCROMATINA -> TRASCRIZIONE POTENZIALE a) geni housekeeping b) geni tessuto-specifici c) espressione ectopica di geni tessuto-specifici (trascrizione illegittima) ETEROCROMATINA FACOLTATIVA -> inattiva quando condensata. Fornisce un meccanismo di compensazione: rapporto geni autosomici/geni X-linked maschi = 2/1 donne = 1/1 ETEROCROMATINA COSTITUTIVA -> sempre inattiva; Localizzata nelle regioni peri - e centromeriche

13 I geni mappano tutti in regioni le cui caratteristiche generali possono essere definite eucromatiche (a parte l eterocromatina facoltativa), tuttavia alcuni geni si eprimono e altri non si esprimono. Ci sono quindi regioni eucromatiche attive e regioni eucromatiche non attive. Qual è la regola?

14 Meccanismi epigenetici Fattori che vengono trasmessi alla progenie, ma che non sono direttamente attribuibili alla sequenza del DNA. Metilazione del DNA; Nelle cellule eucariotiche la metilazione è a carico della C. Solo il 3% delle C sono metilate ed in genere è bersaglio della metilazione la C della doppietta CpG. Modificazioni degli istoni; Acetilazioni, fosforilazioni e metilazioni, responsabili di cambiamenti conformazionali della cromatina.

15 Meccanismi epigenetici: Metilazione del DNA La metilazione del DNA è un processo post-replicativo. L estensione delle modificazioni riguardanti la metilazione del DNA è fondamentalmente decisa durante lo sviluppo. La metilazione del DNA è quindi uno dei meccanismi correlati con il differenziamento cellulare, tramite l inibizione dell espressione genica a livello trascrizionale.

16 Quali regioni sono bersaglio della metilazione? I geni dei vertebrati attivamente trascritti sono marcati da isole CpG al 5. In queste regioni la frequenza di CpG è uguale a quella attesa nel DNA totale (40% GC), nella restante parte del genoma è invece più bassa del 20% rispetto all atteso Nel genoma umano il 56% dei geni sono associati a isole CpG: tutti i geni housekeeping ed il 40% dei geni con espressione tessuto-specifica I geni tessuto-specifici sono metilati in CpG nei tessuti dove non sono espressi

17 Cambiamenti dello stato di metilazione del DNA durante lo sviluppo dei mammiferi Durante la segmentazione si ha subito una fase di demetilazione, seguita da una metilazione de novo dispersa su tutto il genoma, dopo l impianto. La metilazione de novo è rara dopo la gastrulazione, ma è stata vista frequentemente durante la stabilizzazione di colture in vitro e nei tumori.


19 Il mantenimento della metilazione di CpG avviene grazie a metilasi specifiche Metilasi che riconoscono le sequenze emi-metilate (Dmt-1) Duplicazione del DNA

20 La metilazione del DNA regola l espressione genica mediante meccanismi diversi La metilazione del DNA può bloccare direttamente l azione dei fattori di trascrizione impedendo legame alle sequenze bersaglio La metilazione del DNA può reprimere l espressione genica attraverso il reclutamento di diverse metil CpG binding proteins (MECPs) che sono in grado di leggere il pattern di metilazione del DNA

21 La metilazione del DNA è solo una delle componenti del vasto programma epigenetico, che include anche altre modificazioni post-sintetiche della cromatina Meccanismi epigenetici: Modificazioni degli Istoni I residui amminoacidici all N-terminale di ciascun istone (20-60 residui) si estendono al di fuori della superficie del nucleosoma. Queste regioni sono particolarmente ricche in lisina (K) che può essere reversibilmente modificata mediante acetilazione, fosforilazione e metilazione."


23 Modificazioni degli istoni H3 e H4 La lisina 9 di H3 può essere sia acetilata che metilata. L acetilazione è associata alla cromatina trascrizionalmente attiva. Acetilazione e metilazione di H3K9 sono mutualmente esclusive.

24 La metilazione delle CpG, richiama delle CpG binding protein che a loro volta, sono associate a delle metil transferasi istoniche in grado di metilare gli istoni e delle deacetilasi che rimuovono i gruppi acetile. Il risultato è la condensazione della cromatina.

25 Alcune modificazioni si rinforzano mutuamente, altre si contrastano. I risultati assicurano la stabilizzazione dei domini cromatinici nello stato di attività trascrizionale o di silenziamento trascrizionale. La repressione delle sequenze CpG metilate nei promotori è legata a due proteine che, riconoscendo e legandosi a CpG metilati, attivano la deacetilazione degli istoni.

26 1) Chromatin ImmunoPrecipitation (ChIP) 2) Chromatin ImmunoPrecipitation combinata con microarray a DNA (ChIP on CHIP) 3) Sequenziamento del materiale immnunoprecipitato (ChIP-Seq)


28 Immunoprecipitazione della Cromatina (ChIP) Crosslinking Sonicazione Immunoprecipitazione Reverse Crossilink Estrazione DNA e analisi

29 H H C O H H C O H H C O H H C O H H C O

30 Sonicazione

31 Controllo Sonicazione Gel controllo sonicazione

32 Immunoprecipitazione Sepharose Beads IgG Proteina A TAFs TAG Sito di Inizio TBP


34 Reverse Crosslink Proteinasi K 65 C

35 Estrazione DNA e analisi DNA Immunoprecipitato PCR ChIP Chip PCR Quantitativa Studi sull intero genoma Determinazione del grado di occupanza di una proteina su una sequenza nota


37 Input 2) ChIP on CHIP permette di isolare ed identificare le sequenze di DNA occupate da specifiche DNA binding protein. I siti di legame identificati possono essere usati come base per annotare elementi funzionali nel genoma (promotori, enhancers ecc.)

38 3) ChIP-Seq


40 1) ENZIMI DI RESTRIZIONE: Frazionamento di porzioni metilate e non metilate del genoma da parte di enzimi di restrizione sensibili alla metilazione, seguito da analisi basate su microarray, ibridazione o sequenziamento

41 1) ENZIMI DI RESTRIZIONE: Vantaggi : permette di avere un profilo di metilazione per regioni estese di DNA Svantaggi: studia la metilazione solo delle regioni in cui è presente il sito di restrizione

42 2) BISULFITE SEQUENCING DNA trattato con bisulfito di sodio per convertire le citosine non metilate a uracile. Successivamente analisi mediante classico sequenziamento.



45 2) Bisulfite treatment: Vantaggi : molto accurato Svantaggi: difficile da applicare su analisi high throughput

46 3) MeDIP (mdip, mcip) Arricchimento di frazioni di DNA metilato mediante immunoprecipitazione del DNA con anticorpi anti 5-metilcitosina

47 MeDIP Metodica che può essere facilmente applicata ad indagini high troughtput mediante l utilizzo di microarray ad alta densità

48 Eucromatina aperta o chiusa? Figure 7-47 Molecular Biology of the Cell ( Garland Science 2008)

49 Controllo Trascrizionale Il punto principale responsabile del controllo dell espressione genica negli eucarioti è la trascrizione. Una trascrizione selettiva si ottiene grazie a specifiche DNA binding proteins, che sono in grado di rimodellare la cromatina.

50 Affinché la RNA polimerasi si possa attaccare a un promotore, una serie di fattori di trascrizione si deve prima a sua volta attaccare. Se la RNA polimerasi potrà iniziare la trascrizione dipenderà anche dal legame di proteine regolative, proteine attivatrici e di repressione. Elementi distali Elementi prossimali Promotore basale

51 Gli attivatori trascrizionali sono proteine modulari composte da distinti domini funzionali

52 La struttura eterodimerica di molti fattori trascrizionali aumenta le possibilità di controllo dei geni

53 Repressori e attivatori possono dirigere la deacetilazione degli istoni a livello di specifici geni"



56 CONTROLLO A DISTANZA DELL ESPRESSIONE GENICA La struttura della cromatina può svolgere un controllo a distanza sull espressione genica EFFETTO DI POSIZIONE la vicinanza a regioni eterocromatiche può sopprimere l espressione genica presumibilmente per alterazione della struttura di un ampio dominio cromatinico (distrofia fascio-scapolo-omerale FSHD) COMPETIZIONE l espressione di alcuni geni (geni umani delle globine) è coordinata da una regione di controllo dominante LCR localizzata a monte dei geni delle globine

57 ζ 2 ε 2, Emoglobina Embrionale (espressione nel sacco vitellino) α 2 γ 2 HbF Emoglobina fetale (espressione nel fegato e nella milza) α 2 δ 2 HbA 2 Emoglobina dell adulto α 2 β 2 HbA Le LCR funzionano da enhancer per la trascrizione dei geni globinici Altri siti ipersensibili nella regione dei promotori dei singoli geni -> specificità dello stadio di sviluppo. Siti ipersensibili a DNAsi I Eritroide-specifici (enhancer) Siti ipersensibili del fegato fetale Siti ipersensibili nel midollo osseo adulto

58 CARATTERISTICHE DELLA CROMATINA Caratteristica Cromatina attiva Cromatina inattiva Conformazione della cromatina Estesa, aperta Condensata Metilazione del DNA Acetilazione degli istoni Poco metilata specialmente nelle regioni del promotore Istoni acetilati Metilata Istoni non acetilati

59 Controllo post-trascrizionale

60 L uso di promotori alternativi, di splicing alternativi, di poliadenilazioni alternative e di editing, può dare luogo a isoforme diverse con proprietà differenti quali : Isoforme tessuto-specifiche. Gene DMD presenta otto promotori diversi a seconda del tessuto, che danno origine a 8 diverse proteine Isoforme stadio di sviluppo specifiche Isoforme transmembrana o solubili Diversa localizzazione cellulare Funzione cambiata -> isoforme di fattori trascrizionali che agiscono da attivatori o repressori a seconda dei domini contenuti Lo splicing alternativo è controllato da proteine che si legano alle molecole di premrna e fanno in modo che alcuni siti di splicing non vengano utilizzati e altri siano invece attivati.

61 La stabilità dell mrna citoplasmatico è variabile"

62 Il promotore del gene umano dell insulina Nero: fattori ubiquitari Rossi: fattori specifici delle cellule beta pancreatiche

63 corteccia muscolo Purkinje Promotori alternativi: Il gene della distrofina retina Schwann Generale Tessuto-specificità Diverso stadio di sviluppo Differente localizzazione sub-cellulare regolazione genica sesso-specifica

64 Splicing Alternativo


66 Splycing alternativo delle tropomiosine

67 Gene del Tumore di Wilms: sono possibili 24 isoforme grazie a tre diversi codoni di inizio nell esone 1, un RNA editing U-->C, nell esone 6 e due splicing alternativi, Una omissione variabile (skipping) dell esone 5 e una variazione di lunghezza dell esone 9 dovuta alla competizione di un sito di splicing 5. (3X2X2X2) Gene Dscam di drosofila: sono possibili isoforme (12X48X33X2) selezionando Varianti mutualmente escusive da ciascuno degli esono 4, 6 e 9.

68 RNA editing: il gene ApoB

69 Controllo traduzionale

70 Translation of some mrnas is regulated by specific RNA-binding proteins" Iron-dependent regulation of translation of ferritin mrna! +Fe -Fe La proteina che si lega a IRE (IRE-BP) inibisce la produzione della catena pesante della ferritina legandosi agli elementi di risposta al ferro (IRE) che si trovano nelle regioni non tradotte al 5

71 An RNA-Centric View of Gene Expression RNA DNA Protein

72 Non Coding RNAs: RiboRegulators (~97% of RNAs Present in Human Cells are Non-Coding) rrna trna Vault Y RNAs 7SK snrnas snornas Guide RNA Introns 5 UTR 3 UTR Catalytic: Ribozymes Telomerase MicroRNAs Viral RNAs Xist, H19 Retrotransposons

73 Ruolo dell RNA nella regolazione dell espressione genica

74 RNA-Mediated Gene Silencing Transcriptional Gene Silencing (TGS) (RNA-dependent DNA Methylation) Post-transcriptional Gene Silencing (PTGS) or RNA Interference (RNAi) Gene Silencing By MicroRNAs

75 MicroRNAs: Expanding Family of RiboRegulators lin-4 and let-7 RNAs (from worm) were first examples Also known as strnas (small temporal RNAs) Regulate expression of proteins and developmental timing Tip of the iceberg..micrornas are everywhere!

76 sirna and Silent Chromatin - Model 1) RNA homologous to centromeric repeats are processed -> sirnas 2) sirnas may recruit Clr4 histone H3 methylase result in meth. of H3 Lys9 3) Swi6 binds chromatin 4) Gene silencing Dicer = RNasi Ago1 =Argonaute gene family Swi6 = heterochromatic protein 1 Rdp1 = RNA dependent RNA polimerase 1

77 RNAi by sirnas " Developmental regulation" by strnas (µ RNAs) " ~22nt! sirnas" processing" ~22nt! lin-4! processing" ~22nt! let-7! mrna! target" recognition" lin-14! mrna! lin-41! mrna! target" recognition" 3ʼUTR! 3ʼUTR! degradation" Translational repression"

78 Proposed Biologic Roles Immune System of the Genome Antiviral Defense Suppress Transposon Activity Response to Aberrant RNAs Gene Regulation (e.g. MicroRNAs)

79 La quasi totalità dei geni è biallelica espressione di entrambi gli alleli o di nessuno dei due alleli ECCEZIONI AUTOSOMI -IMPRINTING GENOMICO (emizigosi funzionale). L allele che si esprime dipende dal genitore da cui deriva -ESCLUSIONE ALLELICA in seguito a riarrangiamento programmato del DNA nei linfociti B -> Ig e nei linfociti T-> TCR (emizigosi funzionale) CROMOSOMI DEL SESSO -XY emizigosi costitutiva -XX inattivazione X (corpo di barr), emizigosi funzionale (compensazione di dose)


81 Diploidie uniparentali sono letali SVILUPPO NORMALE Nell uomo, 46XX di origine esclusivamente paterna origina moli idatiformi, spesso si trasformano in coriocarcinoma. I teratomi ovarici sono invece il risultato di una diploidia uniparentale materna. LETALE LETALE LO SVILUPPO NORMALE RICHIEDE LA PRESENZA DI UN GENOMA MATERNO E DI UN GENOMA PATERNO CHE FUNZIONANO IN MODO DIVERSO. L ATTIVITA DI ALCUNI GENI NELL EMBRIONE DIPENDE DAL GENITORE DI ORIGINE


83 Le UPD possono essere isodisomie in cui entrambi gli omologhi sono identici, o eterodisomie quando derivano da entrambi gli omologhi di un genitore. Si pensa che la causa più comune delle UPD sia il recupero di una trisomia: un prodotto del concepimento che sia trisomico e che quindi morirebbe, occasionalmente perde da una cellula ancora totipotente uno dei cromosomi, per non disgiunzione mitotica o per ritardo anafasico. La progenie euploide di questa cellula forma l embrione, mentre tutte le altre cellule muoiono. Molte UPD nell uomo non vengono normalmente diagnosticate, in quanto non sono causa di alcuna patologia.

84 In alcuni casi le UPD sono alla base di patologie CROMOSOMA 11 piccolo entrambi materni normale uno paterno e uno materno grande entrambi paterni

85 Imprinting genomico

86 Nell uomo due regioni, rispettivamente dei cromosomi 11 e 15 sono associate a patologie se presenti in UPD. Queste regioni contengono diversi loci con espressione differenziale: loci imprinted loci responsabili di Beckwith-Wiedemann loci responsabili di AS e PWS

87 EREDITARIETA NON TRADIZIONALE Mendel: i geni trasmessi da un genitore o dall altro hanno lo stesso effetto fenotipico: l espressione di un gene è la stessa indipendentemente da quale genitore l abbia trasmesso. Dimostrazioni recenti: l espressione di alcuni geni dipende dal genitore di origine. GENOMIC O PARENTAL IMPRINTING: diversa espressione di un gene o di parti di cromosomi a seconda del genitore che l ha trasmesso. IMPRINTING MATERNO o IMPRINTING PATERNO: la gametogenesi in un sesso marca un gene in modo da renderlo diverso dalla controparte fornita dal genitore dell altro sesso. Durante la gametogenesi alcuni geni sono inattivati in modo differenziale nei due sessi, per cui la loro espressione dipende da quale genitore l ha trasmesso.

88 Loci AS e PW

89 Perché i geni imprinted sono spesso organizzati in clusters? I diversi geni sottostanno al controllo di elementi in cis, imprint control elements, che agiscono su grande distanza. All interno di ciascun cluster è facile trovare sia geni che mostrano espressione paterna che geni con espressione materna. Elementi di controllo specifici per l espressione paterna o materna, IC (responsabili dell imprinting e del suo mantenimento) sono presenti nelle immediate vicinanze.




93 S. di PRADER-Willi Delezione UPD Mutazione Mutazione a carico del IC paterno Traslocazione bilanciata M P X 70% 25% 0% <5% 0.1% IMPRINTING PATERNO S. di ANGELMAN Delezione UPD Mutazione Mutazione a carico del IC materno Traslocazione bilanciata M P X 70% 2% 20% <5% <0.1% IMPRINTING MATERNO

94 Gli spermatozoi e gli oociti possono contenere cromosomi che presentano un imprinting differenziale. L effetto fenotipico sulla progenie di un determinato allele dipenderà dal fatto che derivi dal padre o dalla madre. In ogni generazione al momento della gametogenesi tutti gli imprint vengono azzerati ed i cromosomi subiranno un nuovo imprinting a seconda del sesso dell individuo.



97 Nelle prime fasi dello zigote femminile le due X sono attive, segue poi l inattivazione random


99 L inizio del processo di inattivazione del cromosoma X avviene nelle prime fasi dell embriogenesi e richiede una inattivazione in cis XIC XIST trascrizione INATTIVAZIONE XIST RNA Chr X Attivo XIST met. No trascrizione Il mantenimento dell inattivazione è probabilmente dovuto alla successiva metilazione del DNA


101 Il processo di silenziamento dell X, mediato da Xist può essere diviso in tre fasi: a) inizio, b) stabilizzazione, c) mantenimento. Sia la fase di inizio sia quella di stabilizzazione sono caratterizzate dalla dipendenza di Xist. La fase di mantenimento è invece Xist-indipendente ed irreversibile.



104 Il differenziamento


106 Figure Molecular Biology of the Cell ( Garland Science 2008)

107 Figure 7-75 Molecular Biology of the Cell ( Garland Science 2008)

108 Figure 23-5 Molecular Biology of the Cell ( Garland Science 2008)

109 21_01.jpg

110 La clonazione animale dimostra che si può tornare indietro

111 Data questa differenziazione è possibile prendere una qualsiasi cellula e ottenere da essa un organismo completo? 1975-J.Gurdon

112 E possibile anche con cellule di mammifero? Fino al 1997, la clonazione era stata possibile solo utilizzando nuclei provenienti da embrioni precoci. Nasce Dolly 1997-I.Wilmut

113 Principi chiave: Cellule animali differenziate non sono in grado di svilupparsi in animali adulti completi, tuttavia la maggior parte dei loro nuclei mantiene tutta l informazione genetica necessaria per farlo. E quindi possibile trasferire il nucleo di una cellula differenziata in una cellula uovo il cui nucleo sia stato rimosso. L ambiente della cellula uovo riprogramma il nucleo e permette il pieno sviluppo di un animale vitale e geneticamente identico all individuo donatore della cellula somatica. Ricerche recenti suggeriscono che animali prodotti mediante clonazione a partire da cellule adulte invecchiano precocemente. Sono tuttavia necessarie ulteriori ricerche.

114 Fifty years of animal cloning. 1952: Cloning by nuclear transfer first demonstrated in animals. Source of nuclei was the very early embryo of the frog Rana pipens. 1956: Animal cloning in toads (Xenopus laevis) achieved by nuclear transfer from tadpoles : Cloning first achieved in mammals (rabbits, sheep, cows) by nuclear transfer from very early embryos. 1995: Cloning first achieved by nuclear transfer from cultured mammalian cell line, resulting in the sheep Megan and Morag. 1997: Cloning first achieved using adult sheep cell, resulting in Dolly. 1997: Cloning first achieved using a transgenic sheep, Polly : Cloning achieved using adult cells in mice, cows, pigs, goats and monkeys. 2001: Cloning first achieved following gene knockout in sheep.

115 Prima la Rana, poi Dolly, infine...?

116 According to the simplest model, in which each gene is either ON or OFF, a genome with N genes can (theoretically) encode 2 N states.

117 ON Gene Unspliced RNA Spliced RNA Protein

118 OFF Gene

119 Hypothetical organism with 2 genes in the genome Hi!

120 Gene 1 Gene 2 Gene 1 Gene 2 ON ON ON OFF 2 2 states Gene 1 Gene 2 Gene 1 Gene 2 ON OFF OFF OFF

121 Gene 1 Gene 2 Gene 3 Gene ON ON OFF OFF Fibroblast Gene 1 Gene 2 Gene 3 Gene ON OFF OFF ON Lymphoblast

122 According to Claverie s model, the human species appears 2 30,000 /2 20,000 = 2 10,000 = more complex than the nematode species. This very big number (much bigger than the total number of elementary particles in the known universe) x = 2 20, ,000

123 Non solo...

124 Ma gli altri primati?

125 Settembre 2005: The Chimpanzee genome

126 The Power of Comparative Genomics Approx. same number of genes, 98,8% sequence identity

127 COSA CI RENDE UMANI? Chiaramente la risposta deve essere collegata all effettivo utilizzo dei singoli geni, piuttosto che al loro numero. IPOTESI: un migliore utilizzo delle potenzialità già esistenti: mutazioni in punti strategici, regolazione genica, efficienza di splicing, interazioni proteina-proteina

128 Overlapping transcriptional units Alternative promoters Noncoding RNAs Conserved non-coding sequences Alternative splicing



131 Naturally occurring antisense transcripts found in the mouse transcriptome Sense-antisense transcript pair (cdna sequences overlapping) Number Percentage Highest Lowest % chr 19; 19.7% X chr; 6.4% Non-antisense bidirectional transcription pair (cdna sequences not overlapping) Number Percentage Highest Lowest % chr 6; 6.9% chr 3; 3.6% H. Kiyosawa et al. Cytogenet Genome Res 99: (2002)

132 Geni dentro i geni NF1 Filamento di senso esone 26 Introne 26 esone Filamento antisenso 3 5 OGMP 2.2KB EVI2B 10 KB EVI2A 4 KB F8 CpG F8B F8C F8A

133 Universal Declaration on the Human Genome and Human Rights. ( The human genome underlies the fundamental unity of all members of the human family, as well as the recognition of their inherent dignity and diversity. In a symbolic sense, it is the heritage of humanity

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa

Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa Epigenetica ed espressione genica monoallelica Negli eucarioti, per la maggior parte dei geni, entrambe le copie sono espresse dalla cellula, ma una piccola classe di geni è espressa monoallelicamente,





La regolazione genica nei eucarioti

La regolazione genica nei eucarioti La regolazione genica nei eucarioti Lic. Scientifico A. Meucci Aprilia Prof. Rolando Neri Differenziamento negli eucarioti pluricellulari Negli eucarioti le cellule specializzate dei vari tessuti contengono


Regolazione dell espressione genica EUCARIOTI

Regolazione dell espressione genica EUCARIOTI Regolazione dell espressione genica EUCARIOTI Regolazione della espressione genica Molte proteine sono comuni a tutte le cellule RNA polimerasi, proteine ribosomali, enzimi che regolano il metabolismo,


1 a LEGGE DI MENDEL Legge della Segregazione

1 a LEGGE DI MENDEL Legge della Segregazione IMPRINTING 1 a LEGGE DI MENDEL Legge della Segregazione I due membri di una coppia di alleli, durante la formazione dei gameti segregano in maniera indipendente, cioè in modo che metà dei gameti porti


eucarioti Cellula umana contiene circa 30000 geni

eucarioti Cellula umana contiene circa 30000 geni Eucarioti eucarioti Cellula umana contiene circa 30000 geni Geni per RNA Geni per proteine Ogni cellula in un determinato momento esprim e solo una piccola parte di questo potenziale ( 5000 geni) Geni


RNA polimerasi operone. L operatore è il tratto

RNA polimerasi operone. L operatore è il tratto La regolazione genica nei procarioti Alcune proteine vengono prodotte dalla cellula ad un ritmo relativamente costante e l attività dei geni che codificano queste proteine non è regolata in modo sofisticato.


Facoltà di Medicina e Chirurgia A.A. 2011/2012

Facoltà di Medicina e Chirurgia A.A. 2011/2012 Facoltà di Medicina e Chirurgia A.A. 2011/2012 Prof.ssa Cinzia Di Pietro Deborak Rasà Claudia Reddavid Sara Romano Eliana Russo Il comportamento di un gene non dipende dal genitore che lo trasmette UGUALI


Controllo post-trascrizionale dell espressione genica

Controllo post-trascrizionale dell espressione genica Controllo post-trascrizionale dell espressione genica Livelli di controllo dell espressione genica Rivisitazione del concetto di gene Per gli organismi eucariotici più evoluti il dogma un gene = una proteina


Il nobel per l interferenza dell RNA

Il nobel per l interferenza dell RNA Il nobel per l interferenza dell RNA Andrew Fire e Craig Mello, i due vincitori del Premio Nobel 2006 per la Medicina e la Fisiologia. I due biologi molecolari vengono premiati per aver scoperto uno dei



GENETICA GENERALE E MOLECOLARE GENETICA GENERALE E MOLECOLARE Il genoma umano: organizzazione e funzione delle sequenze - Correlazione tra contenuto di DNA e complessità -Sequenze uniche: struttura dei geni -Famiglie multigeniche e


Regolazione dell espressione genica in eucarioti

Regolazione dell espressione genica in eucarioti Regolazione dell espressione genica in eucarioti -Regolazione spaziale e temporale dei geni eucariotici -Regolazione a livello trascrizionale -Regolazione a livello traduzionale Alcuni elementi per la


Dal DNA alle proteine: La trascrizione e la traduzione

Dal DNA alle proteine: La trascrizione e la traduzione Dal DNA alle proteine: La trascrizione e la traduzione DNA RNA Trascrizione RNA PROTEINE Traduzione Dove avvengono? GLI EUCARIOTI I PROCARIOTI Cambell, Reece Biologia ZANICHELLI Trascrizione Sintesi di



REGOLAZIONE DELL'ESPRESSIONE GENICA REGOLAZIONE DELL'ESPRESSIONE GENICA Con ESPRESSIONE GENICA si intende quella serie di eventi che dall'attivazione della trascrizione di un gene, conducono alla produzione della proteina corrispondente.


ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma.

ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti del genoma. ncdna è caratteristico degli eucarioti: Sequenze codificanti 1.5% del genoma umano Introni in media 95-97%


Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA

Attivazione/repressione trascrizionale a lungo raggio: raggio: Altro meccanismo per reprimere la trascrizione: la metilazione del DNA Attivazione/repressione trascrizionale a lungo raggio:! Le regioni di controllo di un locus (Locus Control Regions LCR)! Le regioni di attacco alla matrice nucleare (MAR)! Gli isolatori Attivazione/repressione


Inattivazione del cromosoma X e eredita X-linked

Inattivazione del cromosoma X e eredita X-linked Inattivazione del cromosoma X e eredita X-linked By NA Lezione 15 1 X inattivo By NA 2 J L inattivazione domande Vengono inattivati tutti i geni della X? No, inizialmente si riteneva che l inattivazione


I Genomi degli Eucarioti:

I Genomi degli Eucarioti: I Genomi degli Eucarioti: Eucromatina ed Eterocromatina Eucromatina: regioni cromosomiche non condensate, attivamente trascritte e ad alta densità genica. Eterocromatina: (facoltativa o costitutiva): cromatina


Struttura e funzione dei geni. Paolo Edomi - Genetica

Struttura e funzione dei geni. Paolo Edomi - Genetica Struttura e funzione dei geni 1 Il DNA è il materiale genetico La molecola di DNA conserva l informazione genetica: topi iniettati con solo DNA di batteri virulenti muoiono 2 Proprietà del DNA Il DNA presenta


Soluzioni ai problemi del Capitolo 15. Domande concettuali

Soluzioni ai problemi del Capitolo 15. Domande concettuali Soluzioni ai problemi del Capitolo 15 Domande concettuali C1. 1. La struttura DNA-cromatina. Questo livello comprende l amplificazione genica, un aumento del numero di copie; riarrangiamenti di geni, come


Organizzazione del genoma umano III

Organizzazione del genoma umano III Organizzazione del genoma umano III Lezione 9 Il DNA codificante Ricapitoliamo l'organizzazione e il funzionamento dei geni eucariotici Sito di inizio trascrizione +1 Codone di stop AATAAA segnale di poliadenilazione


Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato.

Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Nei sistemi modello approcci di modificazione genetica che producono o sequenze genetiche alterate o espressione genetica alterata fenotipo alterato. Correlazione tra fenotipo alterato, o a livello cellulare,





Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti

Dal DNA all RNA. La trascrizione nei procarioti e negli eucarioti Dal DNA all RNA La trascrizione nei procarioti e negli eucarioti DOGMA CENTRALE DELLA BIOLOGIA MOLECOLARE Gene Regione di DNA che porta l informazione (= che CODIFICA) per una catena polipeptidica o per


Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso?

Come funzionano gli oligo Antisenso? RNA WORLD. mrna. Regolare l espressione genica tramite molecole di RNA. Come funzionano gli oligo antisenso? RNA WORLD RNA Come funzionano gli oligo Antisenso? mrna Non coding RNA AAAAAAA rrna trna snrna snorna RNA Antisenso sirna Arresto della traduzione Proteina incompleta o nessuna sintesi MECCANISMO PASSIVO


Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica 1 Eucarioti pluricellulari -un singolo organismo, utilizzando un unico genoma, deve produrre centinaia di tipi cellulari differenti e specializzati. -le cellule differenziate


Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica?

Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? Regolazione dell espressione genica imputabile esclusivamente a regolatori di natura proteica? 18 1 Watson-Baker-Bell-Gann-Levine-Losick Biologia molecolare del gene Gli RNA regolatori Già gli studi di


Cenni al controllo dell espressione genica

Cenni al controllo dell espressione genica 14749010/16433210#bookContentViewAreaDivID Cenni al controllo dell espressione genica Biotecnologie_2012 Il controllo differenziale della





Eredità non mendeliana

Eredità non mendeliana Eredità non mendeliana eredità extranucleare o citoplasmatica effetto materno eredità epigenetica (imprinting) anticipazione Eredità extranucleare eredità materna o paterna geni non nucleari: genomi mitocondriali





Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario

Indice dell'opera. Prefazione. Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Sommario Indice dell'opera Prefazione Capitolo 1 Introduzione alla genetica Genetica classica e moderna Genetisti e ricerca genetica Capitolo 2 DNA: il materiale genetico La ricerca del materiale genetico La composizione


SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione

SINTESI DELL RNA. Replicazione. Trascrizione. Traduzione SINTESI DELL RNA Replicazione Trascrizione Traduzione L RNA ha origine da informazioni contenute nel DNA La TRASCRIZIONE permette la conversione di una porzione di DNA in una molecola di RNA con una sequenza

Dettagli TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE TRASCRIZIONE Processo mediante il quale una sequenza di DNA (un gene) viene copiata in una sequenza di RNA Dalla trascrizione derivano gli mrna, che verranno tradotti



MODIFICAZIONI POST-TRASCRIZIONALI. 5 NT non tradotto 3 NT MODIFICAZIONI POST-TRASCRIZIONALI 5 NT non tradotto 3 NT Numero introni per gene n esoni = n introni +1 Media esoni: 150 basi Introni: anche migliaia di basi Sequenze consenso presenti sul pre-mrna e


Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del

Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del Tutte le cellule, anche quelle più differenziate, esprimono molti geni comuni, detti housekeeping, che codificano per proteine strutturali, del metabolismo o richieste per altre funzioni basali Nei mammiferi


La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie

La trascrizione negli eucarioti. Prof. Savino; dispense di Biologia Molecolare, Corso di Laurea in Biotecnologie La trascrizione negli eucarioti Il promotore eucariotico L inizio della trascrizione negli eucarioti necessita della RNA polimerasi e dei fattori di trascrizione. Qualsiasi proteina sia necessaria per


Dal Genotipo al Fenotipo

Dal Genotipo al Fenotipo Dal Genotipo al Fenotipo Dal Fenotipo normale al Fenotipo patologico Regolazione dell espressione genica Figure 7-1 Molecular Biology of the Cell ( Garland Science 2008) Una cellula differenziata contiene


Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B

Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B Downloaded from Riarrangiamento dei geni per le Immunoglobuline e sviluppo dei linfociti B I geni che codificano i recettori per gli antigeni (BCR e TCR) sono presenti in uno


Determinazione del sesso Cromosomi sessuali

Determinazione del sesso Cromosomi sessuali Determinazione del sesso Cromosomi sessuali Negli Eucarioti un cromosoma del sesso è un cromosoma presente in forme diverse nei due sessi. Uno è un cromosoma "X", l'altro strutturalmente e funzionalmente


Differenziamento cellulare

Differenziamento cellulare Differenziamento cellulare Differenziamento: acquisizione progressiva di nuove caratteristiche che porta a tipi cellulari specifici (es cell muscolari, neuroni,.) Dopo la fecondazione lo zigote va incontro


A che servono le piante transgeniche?

A che servono le piante transgeniche? A che servono le piante transgeniche? Ricerca di base Applicazioni Ricerca di base Favorire la comprensione e lo studio del ruolo fisiologico di molti geni Effetti correlati alla sovraespressione o alla


GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali

GENOMA. c varia da pochi kb nei virus a milioni di kb in piante e animali GENOMA Insieme del materiale genetico presente in una cellula (DNA nucleare, plastidiale e mitocondriale) Contiene tutte le informazioni necessarie per consentire la vita alla cellula e all individuo Nei


1. Capacità di autorinnovamento illimitato

1. Capacità di autorinnovamento illimitato 1. Capacità di autorinnovamento illimitato 2. Capacità di dare origine in risposta a stimoli adeguati e specifici a cellule progenitrici di transito dalle quali discendono popolazioni di cellule altamente





Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3

Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Un caso di pubertà precoce familiare causato da una nuova mutazione nel gene MKRN3 Grazia Cantelmi, AIF SUN Napoli Prof.ssa L.Perrone, Dipartimento della donna, del bambino, di chirurgia generale e specialistica


Incontro con bioinformatici

Incontro con bioinformatici Incontro con bioinformatici Giuseppe Macino Universita di Roma La Sapienza Quanto DNA e contenuto nei genomi di Amoeba dubia 670 miliardi c.b Zea maize 4 miliardi c.b. Homo sapiens 2,9 miliardi c.b Arabidopsis


You created this PDF from an application that is not licensed to print to novapdf printer (

You created this PDF from an application that is not licensed to print to novapdf printer ( CROMATINA E CROMOSOMI UNA SCALA DI GRANDEZZE (E. coli) RNA + proteine Histon-like + DNA 4,64 Mb UNA SCALA DI GRANDEZZE (H. sapiens) TTCAGGAAATGACCCCTTTGCCCCGTCTGAAGGTAGTGCAGAGGCTGCACCTGAGCTGGACCTCTTTGCAATGAAGCCACCT


10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing

10/30/16. non modificato CAP al 5 e poly-a al 3. RNA messaggero: soggetto a splicing procarioti eucarioti poli-cistronico mono-cistronico non modificato CAP al 5 e poly-a al 3 RNA messaggero: procarioti eucarioti policistronico monocistronico non modificato CAP al 5 e poly-a al 3 continuo


Lo Splicing dell RNA. Geni non interrotti

Lo Splicing dell RNA. Geni non interrotti Lo Splicing dell RNA I geni interrotti negli eucarioti si ritrovano in ogni classe: geni nucleari codificanti per proteine, rrna e trna. I geni interrotti sono presenti anche nei mitocondri e nei cloroplasti,


Come identificare i Cromosomi

Come identificare i Cromosomi Come identificare i Cromosomi Fino al 1970, i cromosomi sono stati classificati in base alle dimensioni ed alla posizione del centromero. A I più grandi (metacentrici) B Grandi (submetacentrici) C Medi


sirna Strategie di silenziamento genico post-trascrizionale

sirna Strategie di silenziamento genico post-trascrizionale sirna Strategie di silenziamento genico post-trascrizionale RNAi Introduction RNAi = RNA interference Il termine è utilizzato per descrivere l interferenza dell RNA come meccanismo naturale e anche come


Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna.

Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. ( RNAi ) RNA Interference Silenziamento genico sequenza specifico. Pathway di regolazione dell'espressione genica provocato da dsrna. E un meccanismo naturale in piante, funghi, insetti e mammiferi. Cronologia:


La riproduzione cellulare

La riproduzione cellulare La riproduzione cellulare La riproduzione è una proprietà fondamentale dei viventi, che si manifesta a partire dalle singole cellule. Attraverso la riproduzione viene assicurata la continuità della vita.


1 Gene => + fenotipi. ambiente

1 Gene => + fenotipi. ambiente 1 Gene => + fenotipi (Fattori di) trascrizione Cromatina (etero,eu, remodeling) Splicing Silenziamento (Interference) Modificazioni post traduzionali ambiente Lattosio nel mezzo Ormoni Heat shock Luce


La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi

La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi La divisione cellulare e la riproduzione degli organismi Parte II: Meiosi 1 Cromosomi omologhi I cromosomi in un corredo cromosomico diploide sono presenti come coppie di omologhi Negli animali le cellule



MANIPOLAZIONE GENETICA DEGLI ANIMALI MANIPOLAZIONE GENETICA DEGLI ANIMALI Perché creare animali transgenici Per studiare la funzione e la regolazione di geni coinvolti in processi biologici complessi come lo sviluppo di un organismo e l insorgenza


DNA non codificante ncdna

DNA non codificante ncdna DNA non codificante ncdna Teorie sul ruolo genetico RNAi e mirna Liberamente tratto dalla tesina del Dr. Emiliano Mancini ncdna Per ncdna si intende il DNA intronico, intergenico e altre zone non codificanti


Corso di Biologia Molecolare

Corso di Biologia Molecolare Corso di Biologia Molecolare Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Acidi nucleici Il ruolo degli acidi nucleici è quello di custodire e trasmettere



REGOLAZIONE DELL ESPRESSIONE GENICA REGOLAZIONE DELL ESPRESSIONE GENICA Solo una piccola parte dei 4000 geni che costituiscono il genoma batterico o dei circa 30000 geni del genoma umano viene espressa in maniera costante (GENI COSTITUTIVI)



INATTIVAZIONE DEL CROMOSOMA X INATTIVAZIONE DEL CROMOSOMA X Compensazione del dosaggio Nelle specie in cui la femmina ha due X e il maschio un solo X, esistono dei meccanismi di compensazione del dosaggio che rendono equivalente l


La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing

La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing Modificazioni post- trascrizionali dell RNA La rimozione degli introni e la successiva unione degli esoni devono essere estremamente accurate per gli mrna. Sequenze targets per lo splicing degli introni:


Regolazione dell espressione genica

Regolazione dell espressione genica Regolazione dell espressione genica I promotori batterici hanno due sequenza consenso distinte Trascrizione nei procarioti Regolazione dell espressione genica nei procarioti Il modello dell operone di


Biologia Cellulare e DNA «Bigino»

Biologia Cellulare e DNA «Bigino» Biologia Cellulare e DNA «Bigino» Giulio Barigelletti Premesse 2 Sempre più frequentemente si sente parlare di DNA, Proteine, Amminoacidi, etc., relazionati all esistenza dell essere umano.


LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni

LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni LE CELLULE STAMINALI: dalla ricerca di base alle applicazioni Perché ci troviamo oggi a parlare delle cellule staminali? Driesch (fine 800) dimostra la totipotenza dei blastomeri dell embrione embrione





DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi.

DNA - RNA. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. DNA - RNA Le unità fondamentali costituenti il DNA e l RNA sono i Nucleotidi. Nucleotide = Gruppo Fosforico + Zucchero Pentoso + Base Azotata. Esistono 4 basi azotate per il DNA e 4 per RNA Differenze


Epigenetica nella regolazione dell espressione genica

Epigenetica nella regolazione dell espressione genica Epigenetica nella regolazione dell espressione genica Argomenti della lezione: Che cosa è l epigenetica Modelli di regolazione epigenetica Alterazioni di regolazione epigenetica NH2 CH3 N O N H H Tutti


Il differenziamento cellulare

Il differenziamento cellulare Liceo Classico M. Pagano Campobasso Docente: prof.ssa Patrizia PARADISO Allieve (cl. II sez. B e C): BARONE Silvia Antonella DI FABIO Angelica DI MARZO Isabella IANIRO Laura LAUDATI Federica PETRILLO Rosanna


Regolazione genica post- trascrizionale

Regolazione genica post- trascrizionale 18. L RNA regolatore contiene materiale protetto da copyright, ad esclusivo uso personale; non è consentita diffusione ed utilizzo di tipo commerciale Regolazione genica post- trascrizionale L espressione


I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel

I caratteri legati ai cromosomi. sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel I caratteri legati ai cromosomi sessuali sono un eccezione rispetto alle leggi di Mendel il sesso di un individuo


Materiale genetico e Caratteri

Materiale genetico e Caratteri Materiale genetico e Caratteri Come l informazione genetica contenuta nel DNA sito nel nucleo condiziona la sintesi delle catene polipeptidiche che avviene nel citoplasma Materiale genetico e Caratteri


Analisi Molecolare di sequenze di acidi nucleici

Analisi Molecolare di sequenze di acidi nucleici Analisi Molecolare di sequenze di acidi nucleici 1. L Analisi di restrizione di frammenti o RFLP (Restriction Fragment Lenght Polymorphism) di DNA comporta lo studio delle dimensioni dei frammenti di DNA


Organizzazione del genoma umano II

Organizzazione del genoma umano II Organizzazione del genoma umano II Lezione 7 & Pseudogeni I Pseudogeni non processati : convenzionali ed espressi * Copie non funzionali del DNA genomico di un gene. Contengono esoni, introni e spesso


Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522

Dott.ssa Renata Tisi. Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Dott.ssa Renata Tisi Dip. Biotecnologie e Bioscienze Ed. U4 Tel. 02 6448 3522 Il ruolo degli acidi nucleici è quello di custodire e trasmettere l informazione genetica nelle cellule,


RNA non codificanti ed RNA regolatori

RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori RNA non codificanti ed RNA regolatori Piccoli RNA non codificanti RNA regolatore microrna RNAi e sirna Piccoli RNA non codificanti Gli RNA non codificanti (ncrna)



OMOZIGOTE Dominante. OMOZIGOTE Recessivo ETEROZIGOTE GENI E CARATTERI EREDITARI I caratteri ereditari corrispondono a precisi tratti di DNA, i geni, che contengono le informazioni per la sintesi delle proteine. Ciascun gene occupa nel cromosoma una determinata


Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera

Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera Riassunto della presentazione dal titolo I mirna, lo sviluppo ontogenico e la trasformazione tumorale: nuovi meccanismi molecolari all opera 1- I microrna sono coinvolti in numerosi meccanismi molecolari


Capitolo 11 Il controllo dell espressione genica

Capitolo 11 Il controllo dell espressione genica Capitolo 11 Il controllo dell espressione genica La regolazione genica nei procarioti e negli eucarioti 11.1 Le proteine che interagiscono con il DNA attivano e disattivano i geni dei procarioti in risposta


Geni e ambiente. Veronica Mariotti

Geni e ambiente. Veronica Mariotti Geni e ambiente nello sviluppo del fenotipo Veronica Mariotti Innato e Appreso XVII secolo- filosofo Jhon Locke : le esperienze hanno un ruolo predominante nella formazione dell individuo XIX secolo -


RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico

RNA interference. La tecnologia dell RNAi è basata su un processo di inattivazione genica post-trascrizionale, altamente specifico RNA interference Tecnica che permette di interferire con l espressione di alcuni geni mediante la trasfezione di piccoli frammenti di RNA a doppio filamento in grado di antagonizzare l RNA messaggero corrispondente.


immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo

immagine Biologia applicata alla ricerca bio-medica Materiale Didattico Docente: Di Bernardo Esperto in processi innovativi di sintesi biomolecolare applicata a tecniche di epigenetica Materiale Didattico Biologia applicata alla ricerca bio-medica immagine Docente: Di Bernardo Per animali transgenici


Anomalie cromosomiche

Anomalie cromosomiche Anomalie cromosomiche Alterazioni che interessano il DNA genomico determinando la perdita o l acquisizione di interi cromosomi o segmenti di essi. Se l alterazione è tale da poter essere visibile al microscopio


Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche

Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche Definire i meccanismi con cui si verifica la correzione naturale delle anomalie cromosomiche La patogenesi di aborti dovuti ad anomalie cromosomiche è dovuta a: A) Ipoplasia placentare; B) Malformazioni





GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1.

GENETICA. Ibridi discendenti ottenuti dall incrocio di due linee pure ovvero la generazione F1. BASI FISICHE DELL EREDITARIETA GENETICA La Genetica è quella branca della Biologia che si occupa dello studio dei caratteri ereditari e delle loro implicazioni. I caratteri ereditari prendono il nome di


EPIGENETICA (2014) 1. Metilazione del DNA. 2. Organizzazione della cromatina. 3. Imprinting genomico

EPIGENETICA (2014) 1. Metilazione del DNA. 2. Organizzazione della cromatina. 3. Imprinting genomico EPIGENETICA (2014) Il "dogma centrale" della biologia molecolare sostiene che le informazioni ereditarie sono trasmesse attraverso meccanismi genetici. In realtà, lungo le generazioni, una cellula scambia

Dettagli Genetica delle neoplasie ematologiche Individua le alterazioni genetiche ed epigenetiche presenti nei vari disordini onco-ematologici Fattori estrinseci Ambiente Danno genotossico


Definizione di genoteca (o library) di DNA

Definizione di genoteca (o library) di DNA Definizione di genoteca (o library) di DNA Collezione completa di frammenti di DNA, inseriti singolarmente in un vettore di clonaggio. Possono essere di DNA genomico o di cdna. Libreria genomica: collezione


The difference between genetics and epigenetics can probably be compared to the difference between writing and reading a book.

The difference between genetics and epigenetics can probably be compared to the difference between writing and reading a book. Epigenetica Definita come lo studio dei meccanismi responsabili di cambiamenti ereditabili nelle funzioni del genoma senza alcuna modificazione nella sequenza del DNA The difference between genetics and


La possibilita di conoscere i geni deriva dalla capacita di manipolarli:

La possibilita di conoscere i geni deriva dalla capacita di manipolarli: La possibilita di conoscere i geni deriva dalla capacita di manipolarli: -isolare un gene (enzimi di restrizione) -clonaggio (amplificazione) vettori -sequenziamento -funzione Il gene o la sequenza


COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.!

COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! COME FANNO I FATTORI DI TRASCRIZIONE AD ACCEDERE AL DNA NUCLEOSMALE? L incorporazione del DNA in nucleosomi inibisce quasi sempre il legame dei TF.! rimodellatori? Svolgimento del DNA nucleosmale a par6re



GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: GENOMICA STRUTTURALE: GENOMICA FUNZIONALE: 1. Anatomia dei genomi 8. Funzionamento dei genomi Il genoma dei procarioti Modificazioni della cromatina e l espressione del Il genoma degli eucarioti genoma


La traduzione: dall mrna alle proteine

La traduzione: dall mrna alle proteine La traduzione: dall mrna alle proteine Le infezioni batteriche sono una grave causa di malattie e morte in Europa e negli USA. Le infezioni batteriche si curano con antibiotici che colpiscono l espressione


INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1

INDICE. VOLUME 1 Cellula. VOLUME 2 Genetica. Capitolo 9 Comunicazione cellulare 181. Capitolo 1 Introduzione alla biologia 1 00PrPag_Vol_02_BROOKER 30/07/10 11:22 Pagina V VOLUME 1 Cellula Capitolo 1 Introduzione alla biologia 1 PARTE I Capitolo 2 Chimica Basi chimiche della vita I: atomi, molecole e acqua 19 Capitolo 3 Basi


Genoma umano: illusioni, realtà, prospettive

Genoma umano: illusioni, realtà, prospettive Genoma umano: illusioni, realtà, prospettive Giovedì 15 Marzo 2007 - ore 17.30 Istituto Veneto di Scienze, Lettere ed Arti - Venezia Giuseppe Borsani e Gerolamo Lanfranchi, coordina Fabio Pagan Il flusso


Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1

Fibrillina Sindrome di Marfan sindrome di Marfan sindrome di Marfan Sindrome di Marfan Fibrillina 1 Genoma La determinazione e la conoscenza dell intera sequenza genomica è la condizione necessaria per comprendere la biologia di un determinato organismo Il genoma contiene le istruzioni (geni) per la


La cellula. Copyright (c) by W. H. Freeman and Company

La cellula. Copyright (c) by W. H. Freeman and Company La cellula Gli organismi contengono organi, gli organi sono costituiti da tessuti, i tessuti sono composti da cellule e le cellule sono formate da molecole Evoluzione molecolare L evoluzione è un processo





Nuovi ruoli dei telomeri e della telomerasi

Nuovi ruoli dei telomeri e della telomerasi Nuovi ruoli dei telomeri e della telomerasi Marco Santagostino Tutor: Elena Giulotto Dipartimento di Genetica e Microbiologia, Università degli Studi di Pavia Argomenti trattati 1. I telomeri e la telomerasi
